ID: 1079376700

View in Genome Browser
Species Human (GRCh38)
Location 11:19899356-19899378
Sequence CTGGTGATTAGATGTAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079376699_1079376700 -5 Left 1079376699 11:19899338-19899360 CCAAGTTATTTATCTGAGCTGGT 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1079376700 11:19899356-19899378 CTGGTGATTAGATGTAACCATGG 0: 1
1: 0
2: 1
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079376700 Original CRISPR CTGGTGATTAGATGTAACCA TGG Intronic
900485982 1:2923046-2923068 CTGTGGGTTAGAGGTAACCAGGG - Intergenic
900843380 1:5076230-5076252 CAGGTGATCAGATGTCACCTGGG - Intergenic
903725048 1:25435479-25435501 CTGGAGATCAGATGTAGACAAGG - Intronic
904029813 1:27527249-27527271 CTGGTGTTTACATGTAACCGAGG - Intergenic
904218819 1:28947483-28947505 CTTTTTATTAGATGCAACCAGGG + Intronic
912759460 1:112354200-112354222 CGGGTAATTAGATGAGACCAAGG - Intergenic
915115330 1:153594996-153595018 CTGGTGGAGAGATGTAACAATGG - Intergenic
917357230 1:174139342-174139364 CAGTTGATTAGATGTAGACATGG - Intergenic
919469986 1:197966139-197966161 TGGCTGATTAGATGGAACCAGGG + Intergenic
923135952 1:231118980-231119002 CTGGAGATCAGCTGTAAGCAAGG + Intergenic
1062912192 10:1218599-1218621 CTGGGGATTACATGTCAACATGG - Intronic
1065248006 10:23778611-23778633 CTGGTGATAAGTTGTAAGCAGGG + Intronic
1066697183 10:38089696-38089718 CTTGTGATTACTTGTATCCATGG - Intergenic
1067964283 10:50891354-50891376 ATGGTTTTTAGATGTAGCCAGGG - Intergenic
1072179256 10:92964766-92964788 CTGCTCAGTAGATGTCACCATGG + Intronic
1072739025 10:97898520-97898542 CTGCTGCTTAGATGTAAACAGGG + Intronic
1079376700 11:19899356-19899378 CTGGTGATTAGATGTAACCATGG + Intronic
1080672920 11:34397520-34397542 CTGGTGATAAAATGAAAACACGG - Intergenic
1081010416 11:37804338-37804360 CTGGTGGTTACATTTAAACACGG - Intergenic
1082097657 11:48144324-48144346 CCTGTGATTAGATGAAACCTTGG + Intronic
1082720220 11:56665266-56665288 CTGGTGACTAGCTATAATCAGGG + Intergenic
1084467006 11:69329320-69329342 ATGGTGATTAGATCTTACAATGG + Intronic
1095215930 12:39547636-39547658 CTGGTGGTTAGTTGGAACTAGGG + Intergenic
1099044225 12:77695865-77695887 TTTGTGATCAGATGTCACCATGG + Intergenic
1099423344 12:82492394-82492416 CTTGGGAATAAATGTAACCAAGG + Intergenic
1109201006 13:59430902-59430924 CTTAGGATTATATGTAACCAAGG - Intergenic
1109955534 13:69560466-69560488 TCGGTCATTAGAAGTAACCATGG - Intergenic
1112721773 13:102253880-102253902 CTTGTGATTAGAAGTAAACTGGG + Intronic
1112982723 13:105406310-105406332 CTAGTGAATCAATGTAACCATGG + Intergenic
1116439551 14:44936688-44936710 CTGCTGCTCAGATGTAGCCATGG + Intronic
1118443581 14:65832639-65832661 CTCGTGATCAGATGTAACCATGG - Intergenic
1118534600 14:66746744-66746766 CTGGTGATAAGATGCCACCAAGG + Intronic
1119206510 14:72798529-72798551 CTGAGGATTACATGTGACCAAGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123669976 15:22646230-22646252 CTGGTGATTTGATTTGACCAAGG + Intergenic
1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG + Intronic
1125300453 15:38249427-38249449 CTGGAGATTTGATGAAAACAAGG - Intergenic
1125811722 15:42548056-42548078 CTAGTGATCAGCTGTTACCAGGG - Intronic
1126220000 15:46201997-46202019 TTGGGGAATAGATGTAACCAAGG - Intergenic
1131875046 15:96796860-96796882 CTGGTGAAAAGAGGTGACCAGGG + Intergenic
1138624484 16:58238172-58238194 TAGGTGATTAGATGTAGACAAGG + Intronic
1146282319 17:31552669-31552691 CTCATGATGAGATGTGACCAGGG + Intergenic
1150763347 17:67982758-67982780 CAGATGATTATATGTAACCGGGG - Exonic
1158223938 18:55181012-55181034 CATGTGATTAGTTATAACCAAGG + Intergenic
1159718245 18:71851640-71851662 CTCGTAACTACATGTAACCAAGG + Intergenic
925235659 2:2275097-2275119 CTGGTGGTTGGATGTCACCTTGG + Intronic
931265864 2:60660030-60660052 CTGGTGTTTAGAAGACACCATGG - Intergenic
932821252 2:74902989-74903011 CTGGTCATTAAATGACACCATGG - Intergenic
935219097 2:100996852-100996874 CTGGTGAAAAGATGTATGCAGGG - Intergenic
937323616 2:120975667-120975689 CAGGTGATTAGAGATGACCATGG + Intronic
942307578 2:174624215-174624237 GTGGTTATTACATCTAACCATGG - Intronic
945196980 2:207245811-207245833 CTCTTGATTAGATGTAAAGATGG - Intergenic
947751856 2:232536920-232536942 TTAATGTTTAGATGTAACCAAGG + Intergenic
1169578052 20:6987883-6987905 CAGGTGATTAGATGAAAAGATGG - Intergenic
1173137263 20:40449608-40449630 CTGGTGATTTGAAGTGAACAGGG - Intergenic
1174278026 20:49417721-49417743 CTCCTGAGTAGATGTAACTATGG + Intronic
1174805649 20:53602219-53602241 CTCCTGAGTAGATGGAACCATGG - Intronic
1178365195 21:31984523-31984545 CTGGTGACCTGATGTAACCTGGG + Intronic
1179654794 21:42838190-42838212 CTGGTGATGAGAACTAAACAGGG - Intergenic
950468831 3:13172260-13172282 CTGGGGAGTAGATGGAACCATGG + Intergenic
950804169 3:15583313-15583335 CTGGTTATTAGATGATATCAGGG - Intronic
951868069 3:27329553-27329575 CTGGTGGTTACCTGTAGCCAAGG + Intronic
952105863 3:30068545-30068567 GGGATGATTGGATGTAACCATGG + Intergenic
955095411 3:55792485-55792507 CTGGTGATTAGGTGTAAGAAGGG - Intronic
960797860 3:121507336-121507358 CTGTTGATTAGAATTTACCATGG + Intronic
961074350 3:123967784-123967806 ATTGTGATTGGATGTTACCATGG - Intergenic
961309283 3:125984351-125984373 ATTGTGATTGGATGTTACCATGG + Intergenic
962422119 3:135238101-135238123 CTGGTGCTCAGAGGTAATCATGG - Intronic
963211211 3:142693526-142693548 CTGCTGATAAGATGTAAACTAGG + Intronic
964767673 3:160194266-160194288 GAGGTGATTAGAAGTAAGCAAGG - Intergenic
964832044 3:160895062-160895084 ATAGAGGTTAGATGTAACCAGGG + Intronic
966049602 3:175598496-175598518 CTGGTTATTATATGAAACAAGGG - Intronic
967812974 3:193775851-193775873 CTGGTGATTAGATACAACAGGGG + Intergenic
972239092 4:37170130-37170152 ATGGTGCTTAGATGTTTCCAAGG - Intergenic
975663334 4:76708970-76708992 GTGGTGCTTAGATATAACTAAGG + Intronic
978116575 4:105025764-105025786 CTGGTGATTATAGGGCACCAAGG + Intergenic
978502206 4:109421591-109421613 ATGGTGATTAGATTGGACCATGG - Intergenic
983262731 4:165474576-165474598 ATTGTGATGAGATGGAACCAAGG - Intronic
993283196 5:85955522-85955544 CTGGTGTTTACTTGTTACCATGG - Intergenic
994226909 5:97263326-97263348 CTGCTGAATAGCTGTAGCCAAGG - Intergenic
994688427 5:102986503-102986525 CTGATGAATAAATTTAACCAAGG + Intronic
995881813 5:116851736-116851758 CTGCTGAATAGAAGTAACTATGG - Intergenic
997111385 5:131078773-131078795 TAGGTCATTAGATGTCACCATGG + Intergenic
1001748408 5:174109572-174109594 CTGGTGATTAGCTGCAACTGAGG + Intronic
1002029136 5:176415660-176415682 GAAGTGATTAAATGTAACCAAGG + Intronic
1006761930 6:36470529-36470551 CTGCTTATTAGTTGTAACCATGG + Intronic
1011518859 6:88182399-88182421 AGGGTGATTAGATGTCACCTGGG - Intergenic
1012160476 6:95878942-95878964 CTGGTGAGTAGATCTCACCTTGG - Intergenic
1018800375 6:167217671-167217693 CTGGTGAGTTGAAGCAACCAAGG - Intergenic
1018809780 6:167289674-167289696 CTGGTGAGTTGAAGCAACCAAGG + Intronic
1021847443 7:24776540-24776562 CTGGTTATAAGATGAAACCTAGG - Intergenic
1022866047 7:34421529-34421551 CTGGTAACTACTTGTAACCATGG - Intergenic
1023602337 7:41892357-41892379 CTGGTCAGTAGATTTAAACATGG + Intergenic
1026302990 7:69115191-69115213 CTGGTGATTACATGGATGCAAGG - Intergenic
1026637149 7:72094171-72094193 CTGGGGAATAGGTGTAACAATGG + Intronic
1028386701 7:90262310-90262332 CTAAATATTAGATGTAACCAAGG + Intronic
1032065299 7:128764603-128764625 CTGGGTATTAGATGATACCAAGG + Intronic
1032124586 7:129183958-129183980 CTTGTGAATAAATCTAACCAAGG - Intergenic
1033323403 7:140360380-140360402 TTGTTGATTAAATGAAACCATGG - Intronic
1034455904 7:151169730-151169752 CTGGTGGTAAGATGTCACAATGG + Intronic
1034549829 7:151813399-151813421 CTGGTGATTAGGAGTGACCTGGG - Intronic
1036098948 8:5756276-5756298 CTGGGGATCAGATTTCACCATGG + Intergenic
1045968515 8:108054107-108054129 CTGGTGATACAATGTAAACAAGG + Intronic
1048668142 8:136687490-136687512 CTGGAGAAAAGATGGAACCATGG + Intergenic
1050335042 9:4582597-4582619 GTGGTGAGTAGATGGAACAAGGG + Intronic
1052139134 9:24956131-24956153 CTGGTGATTAATTGTCAACAGGG - Intergenic
1055017059 9:71630104-71630126 CTGGTCAATAGATGTAATGATGG - Intergenic
1058957979 9:109967086-109967108 CTGGTGGTTAGATGTAGCTGGGG + Intronic
1059449795 9:114363384-114363406 CAGAAGATTAGATGTGACCAGGG - Intronic
1060269926 9:122133028-122133050 GTGAGGATTAGATGGAACCATGG - Intergenic
1186058006 X:5672024-5672046 CTGAAAATTAGATGTAACCAAGG - Intergenic
1189415373 X:40808080-40808102 CTTGTGCTTTGATGTTACCATGG + Intergenic
1195480545 X:105339737-105339759 ATGATGATCAGATGTAATCAGGG + Intronic
1197855343 X:130908504-130908526 ATTGTGAATAGATGTACCCATGG - Intergenic
1197903984 X:131403650-131403672 CAGTAGATTAGATGTATCCAAGG - Intergenic
1201988852 Y:20002279-20002301 CTTCTGAATAGATTTAACCAAGG + Intergenic