ID: 1079378840

View in Genome Browser
Species Human (GRCh38)
Location 11:19918903-19918925
Sequence CAGAGCATAAAGCAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 511}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079378840_1079378846 9 Left 1079378840 11:19918903-19918925 CCTTCCTTCTGCTTTATGCTCTG 0: 1
1: 0
2: 6
3: 36
4: 511
Right 1079378846 11:19918935-19918957 CAAGACCTGGAACCCCTTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 159
1079378840_1079378842 -4 Left 1079378840 11:19918903-19918925 CCTTCCTTCTGCTTTATGCTCTG 0: 1
1: 0
2: 6
3: 36
4: 511
Right 1079378842 11:19918922-19918944 TCTGTTTCATCCCCAAGACCTGG 0: 1
1: 0
2: 1
3: 16
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079378840 Original CRISPR CAGAGCATAAAGCAGAAGGA AGG (reversed) Intronic
900161424 1:1225815-1225837 CAGAGCAAAAAGCAAAAAGGTGG + Intronic
900354989 1:2256732-2256754 CAGAGCCCAAAGCAGATGGCAGG - Intronic
901370405 1:8792854-8792876 CGGAACATAAAGAAGCAGGAAGG + Intronic
901397569 1:8992572-8992594 TAGAGAACAAAGCAGCAGGAAGG - Intergenic
901747765 1:11385836-11385858 CAGAGCCAAAAGCTGGAGGAAGG - Intergenic
902074171 1:13769437-13769459 CAGAACAGAAAGCAGAACCAGGG - Intronic
902221483 1:14968660-14968682 CTGAGCATGGAGCAGAAGAAAGG + Intronic
902338999 1:15770528-15770550 CAGAGCTTCTACCAGAAGGATGG + Exonic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
903007695 1:20309475-20309497 CAGAGCAGCAAGCACAGGGATGG + Intronic
903269564 1:22178795-22178817 CAGAGAAGGAAGGAGAAGGAAGG - Intergenic
904045100 1:27603958-27603980 GAGAGCAGAAGGCAGGAGGAGGG - Intronic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
905654052 1:39674696-39674718 CAGAGAGAGAAGCAGAAGGAGGG + Intergenic
905695438 1:39970113-39970135 GAGAGGGTGAAGCAGAAGGAAGG - Intergenic
906592450 1:47039161-47039183 CAAAGCATAAAGGAGAACCAAGG - Intronic
906662017 1:47589770-47589792 CAGAGTATTATGCAAAAGGAAGG - Intergenic
906926683 1:50125400-50125422 CAGCTCATCAAGCAGAAGCAAGG - Intronic
908017065 1:59853868-59853890 AACAGCATAAAGCAGAGGGGAGG - Intronic
908742953 1:67347656-67347678 CAGAGCAGAAAGAAAATGGAAGG + Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909793275 1:79701558-79701580 CGGAGCAGAGAGCAGGAGGACGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910861288 1:91744534-91744556 CAGACCAAGAAGCAGATGGATGG - Intronic
911068977 1:93817132-93817154 GATAACATAAAGCAGAAGCAGGG - Intronic
911305576 1:96228128-96228150 GAGAGCAGAATGCAGAAGGGAGG - Intergenic
912412900 1:109490253-109490275 CAGAACTAAAGGCAGAAGGAAGG - Exonic
914807619 1:151003015-151003037 GAGAGCACAAAGGAGAAAGAAGG + Intronic
914998755 1:152567375-152567397 CTAAACATAAAGCAGGAGGAAGG - Intronic
915730783 1:158052679-158052701 CAGAGGATAAGGCAGGAGAATGG + Intronic
916485851 1:165257828-165257850 TAGACAAAAAAGCAGAAGGATGG + Intronic
918456165 1:184717936-184717958 CAGAGGAAAAAGTAGAGGGAAGG - Intronic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
918694515 1:187527642-187527664 TAGTGCATAAAGCAGCAGAAGGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919538221 1:198814832-198814854 GACAACTTAAAGCAGAAGGAGGG + Intergenic
919910569 1:202108122-202108144 CGGAGCAGAAAGCAGAAGAGAGG - Intergenic
919993508 1:202726535-202726557 TAGAGCCTGAACCAGAAGGAGGG - Exonic
920126824 1:203700182-203700204 TAGAGCACAAAGGGGAAGGAGGG - Intronic
920808405 1:209257049-209257071 CAGAGCAGACAGCAGACGGGAGG + Intergenic
922114013 1:222591564-222591586 AATAGCATAAACAAGAAGGAAGG + Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
923100691 1:230813988-230814010 CAAAGCAGAAAGCAGAAGCAGGG - Intergenic
923327019 1:232888938-232888960 AAGAAAATAAAGAAGAAGGAAGG - Intergenic
1063606942 10:7530963-7530985 CAAAGCCAAAAGCAGACGGAGGG - Intergenic
1063743420 10:8852440-8852462 CGAAGCCTAAAGCACAAGGATGG - Intergenic
1063919310 10:10916060-10916082 CAGAGCATAATCTAGAAGCATGG + Intergenic
1064196856 10:13250699-13250721 TAAAGAATAAAGCAGAAAGAAGG + Intergenic
1064229461 10:13517297-13517319 CACAGCCTAAAACATAAGGAAGG + Intronic
1065177107 10:23088353-23088375 CAGAGTATAGTTCAGAAGGAAGG + Intergenic
1065641605 10:27787933-27787955 CAGAGGCTGAAGCAGAAGGATGG + Intergenic
1065651446 10:27896614-27896636 TAGAGCACCAAGCAAAAGGATGG - Intronic
1065867337 10:29925514-29925536 TGGAGCATAAAGCGGGAGGAAGG + Intergenic
1066319337 10:34285470-34285492 CAGAGGCTGAGGCAGAAGGATGG + Intronic
1067060318 10:43075015-43075037 CAGAACATCAGGCAGCAGGAAGG - Intergenic
1068168991 10:53369507-53369529 CAGTTAATAAAGCAGAAGGTTGG + Intergenic
1070249793 10:74763995-74764017 CAGAGCCTTAAGCAGAGTGAGGG + Intergenic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1071178719 10:82958014-82958036 CAGTGCCTACACCAGAAGGATGG - Intronic
1073592944 10:104773581-104773603 CAGAGCAGAAGGCAGCAGGGTGG + Intronic
1074088961 10:110228693-110228715 CAGGGTATAAAGCAGAATCAAGG + Intronic
1074233946 10:111565956-111565978 CACAGAGCAAAGCAGAAGGACGG + Intergenic
1074609016 10:115003701-115003723 CATAGCAAAAACTAGAAGGAAGG + Intergenic
1074674468 10:115832385-115832407 CAGAGCATAATGCTAAGGGAAGG + Intronic
1074889117 10:117720539-117720561 AAGGGGAGAAAGCAGAAGGAAGG + Intergenic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075390954 10:122091521-122091543 AAGAGCCTAAAGCACAGGGAAGG - Intronic
1076174908 10:128360936-128360958 AGGAGCATATAGCAGAAGCAGGG - Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078633875 11:13030833-13030855 CAGATCATAAAGGATAAGTAGGG - Intergenic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1081508141 11:43739551-43739573 CAGAGCAGAAGGCAGAAAGTTGG + Intronic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1082828103 11:57596010-57596032 CAGAGAATAAAGCACAAAGCTGG + Intergenic
1082837805 11:57664287-57664309 CATAGCAAAACTCAGAAGGAGGG - Intergenic
1083146973 11:60767278-60767300 CAGAGCAGAAAACAGGAGGCAGG + Intronic
1083429971 11:62609216-62609238 CAGGGCCTAGAGCAGAATGATGG + Intronic
1083489839 11:63008198-63008220 CAGAGCATGAGGCAGAAAGTGGG + Intronic
1083576156 11:63793294-63793316 TGGCCCATAAAGCAGAAGGAGGG + Intergenic
1085270149 11:75265373-75265395 CAGAGAGAAAAGCAGAGGGAGGG - Exonic
1085763762 11:79264488-79264510 CAGAGCTTAGAGCAGGGGGACGG - Intronic
1085782942 11:79425729-79425751 CAGAGCTTATACCAGAGGGATGG - Intronic
1085821522 11:79798717-79798739 CAGAGTATAAACCAGAAGTGGGG + Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086560580 11:88163940-88163962 CAGTGGATAAAGCAGGGGGAAGG + Intronic
1086560835 11:88167239-88167261 CACAGCATAAAGGGGAAGGTAGG + Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1089340186 11:117752071-117752093 CAGAGTATACTGCAGAAGGCAGG + Intronic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089832400 11:121340131-121340153 CAGAGCAAAAAAGAGAAGGGAGG + Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1092906499 12:13104572-13104594 CAGGGCAGCAAGGAGAAGGAAGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1094737686 12:33253745-33253767 AGGGGCATAAAGCAGAAGAAGGG + Intergenic
1095055114 12:37589242-37589264 CAGAGGCTTGAGCAGAAGGAAGG - Intergenic
1095737120 12:45569671-45569693 GAGAGATTAAAGCTGAAGGAGGG + Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097975643 12:65683762-65683784 GACTGGATAAAGCAGAAGGAAGG - Intergenic
1098763222 12:74451361-74451383 AAGAGGATAAAGGAGAAGAAAGG + Intergenic
1100040510 12:90311821-90311843 CAGAGAATAAAGAAGACAGAGGG + Intergenic
1100086353 12:90915089-90915111 CAGAAGGTAAAGCAGAAGCAAGG + Intronic
1100211450 12:92402583-92402605 AAGAACATGAAGAAGAAGGAGGG - Intergenic
1100643443 12:96504884-96504906 AAAAGCAAAAAGCAGAAGGTAGG - Intronic
1103324070 12:120108772-120108794 CAGACGACAAAGCAGAATGAAGG + Intronic
1103562241 12:121798782-121798804 CAAAGCAGAAATCACAAGGAGGG + Intronic
1104020962 12:124992136-124992158 CAGAGCCTGAGGCAGAAGAATGG - Intergenic
1104336619 12:127901819-127901841 CCTAGCATAAAACAGAAGCAAGG + Intergenic
1105323160 13:19346415-19346437 AAGAGCATAAACCAGCCGGAGGG + Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1105989428 13:25603522-25603544 CAGAGACTAAAGCTGAAGGGAGG + Intronic
1106850470 13:33784744-33784766 CAGAACATAATGTAGAATGATGG - Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1108009679 13:45992790-45992812 CAGAACAAAAAGGTGAAGGAAGG + Intronic
1108950245 13:56083614-56083636 CCGAGAAAATAGCAGAAGGAGGG + Intergenic
1109298896 13:60569624-60569646 CTGAGCATAAAGAAGAAAGCTGG + Intronic
1109596080 13:64555648-64555670 CAGAACAGAAAGTAGAATGAAGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110186580 13:72682040-72682062 CACAGCATAAAGAATGAGGAAGG + Intergenic
1110664168 13:78096397-78096419 TAGAACAAAAAGGAGAAGGAAGG + Intergenic
1111137073 13:84061577-84061599 CTGAGCAAAAAGCACAAGGCTGG - Intergenic
1112264258 13:97908318-97908340 AACAGACTAAAGCAGAAGGATGG + Intergenic
1113255267 13:108498526-108498548 CAGAGCAGAATGTAGAAGAAAGG - Intergenic
1113437170 13:110302165-110302187 CAGAGGATAAAGAAGAGGAAAGG + Intronic
1114100145 14:19372852-19372874 CCAAGGAAAAAGCAGAAGGACGG - Intergenic
1114517586 14:23309720-23309742 AAGTGCATAATGCACAAGGAAGG - Exonic
1114802266 14:25790647-25790669 CAGAGCAGAAAGTAGATTGAAGG - Intergenic
1115742503 14:36403341-36403363 CAGAACAAAAAGGTGAAGGAGGG + Intergenic
1115859257 14:37666250-37666272 CAGTGTATAAAGCAGATCGATGG - Intronic
1115968039 14:38913954-38913976 AAGACCATAAAGGACAAGGAAGG + Intergenic
1116133289 14:40889145-40889167 CACAGAAAAAAGAAGAAGGAAGG + Intergenic
1116402806 14:44529542-44529564 CAGAACACAAACCAGAAGGGTGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1119187398 14:72652434-72652456 CACAGCAGAGACCAGAAGGATGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1121821548 14:96972148-96972170 TAGGGCATAGGGCAGAAGGAAGG - Intergenic
1122566232 14:102658589-102658611 CATAGCATACAGGAAAAGGATGG - Intronic
1122753080 14:103953806-103953828 CAGAACAAAAAGGATAAGGAAGG - Intronic
1122780365 14:104140900-104140922 GAGACCACAAAGCAGAAGAAGGG - Intronic
1122879738 14:104685435-104685457 CAGAGCAAAAAGCCAAGGGAGGG + Intergenic
1123176513 14:106424036-106424058 CAGAGAATAAAACACAATGACGG - Intergenic
1124991042 15:34674021-34674043 AAGAGTATAAAGCAGAAGACAGG - Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125516156 15:40322587-40322609 GAGAGCAGAGAGCGGAAGGAGGG + Intergenic
1125766739 15:42141407-42141429 GAGACCAGAAGGCAGAAGGAGGG + Exonic
1127840661 15:62828731-62828753 CAGAGCACAACGCACAAGGTAGG - Intronic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129337137 15:74859398-74859420 CAGAGCAAAAAACAGGAAGAAGG + Intronic
1130064577 15:80593449-80593471 CAGAGCATCCCGCAGAAGGCTGG + Intronic
1130283531 15:82537464-82537486 CAAGGCATCAAGCAGAAGGGAGG + Intronic
1130786403 15:87101323-87101345 CAGAGTATCAAGGAAAAGGATGG + Intergenic
1130792466 15:87170113-87170135 AGGGGCATAAGGCAGAAGGAAGG - Intergenic
1130826696 15:87555415-87555437 CAGTGCACAAAGAAGAGGGAAGG - Intergenic
1131531196 15:93193557-93193579 CAGAGCAGAAGGAAGAAGAAAGG - Intergenic
1131886130 15:96915122-96915144 CAGAGACTAAAGCGGGAGGATGG + Intergenic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133142989 16:3761795-3761817 CTGTGCATAAAACAGAAGAAAGG - Intronic
1135947939 16:26881977-26881999 CAAAGCAGAGAGCAGAAGGGTGG - Intergenic
1137891381 16:52166322-52166344 CAGAGCATCAAGCCTCAGGAGGG + Intergenic
1138107998 16:54300841-54300863 CAGAGCATTAAACCAAAGGAAGG - Intergenic
1139684172 16:68589933-68589955 CAGAGGCTGAGGCAGAAGGATGG - Intergenic
1140433133 16:74921946-74921968 CAGTGGAGGAAGCAGAAGGAAGG - Exonic
1140480254 16:75258559-75258581 CAAAGCAGACAGCAGAGGGATGG + Intronic
1142638111 17:1270354-1270376 CCGATAATAAAGCAGGAGGAGGG + Intergenic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1143801195 17:9382844-9382866 GAAAGCAGAAAGCAGAAAGAAGG + Intronic
1144073868 17:11699903-11699925 GAGAGAGAAAAGCAGAAGGAGGG - Intronic
1144246640 17:13372658-13372680 CAGAGCACAATGAAGAAAGAAGG + Intergenic
1146535984 17:33652617-33652639 GAAAGCAAATAGCAGAAGGAGGG - Intronic
1146699261 17:34940543-34940565 CAGAGCAAAAAGAAGAAATATGG - Exonic
1147551162 17:41442929-41442951 CAGAGGATAAAGCCAAAAGATGG - Intergenic
1149162233 17:53708123-53708145 CATAGCATAAGCAAGAAGGAAGG + Intergenic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150323231 17:64234050-64234072 CAGAGCAGAAGGCAGAAATAAGG + Intronic
1150444608 17:65219034-65219056 CAGAGGCTAAAGCAGAGGGGTGG + Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152715218 17:81896513-81896535 ATGAGCGTAAAGCAGAAGCAAGG + Intronic
1203168922 17_GL000205v2_random:128709-128731 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1153676963 18:7464405-7464427 CAGAGCAATAAGCAGAAGACAGG + Intergenic
1154122025 18:11659656-11659678 CAAAGCCTGATGCAGAAGGAAGG - Intergenic
1154144534 18:11856058-11856080 CACACTATAAAGCAGAAGGGAGG + Intronic
1154205805 18:12335702-12335724 CAGGTCATAGAGCTGAAGGAAGG - Intronic
1154957836 18:21276667-21276689 CTTACAATAAAGCAGAAGGAAGG - Intronic
1155083604 18:22433972-22433994 CAGAGCATCAAGTAACAGGATGG - Intergenic
1155315384 18:24566201-24566223 CACATCATAAAGCAGAGAGAGGG + Intergenic
1155588615 18:27398652-27398674 GAGAGGATTAATCAGAAGGAAGG - Intergenic
1156588093 18:38455090-38455112 CAGAGCATATGTCAGAAGTATGG - Intergenic
1157394438 18:47330158-47330180 CAGAGAACAAGCCAGAAGGAAGG - Intergenic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158632860 18:59131574-59131596 CAAAGCAGAATGAAGAAGGATGG + Intergenic
1159817295 18:73091164-73091186 CAGAGAATAAAGAAGAAAAAAGG - Intergenic
1160031723 18:75267563-75267585 GAGAGGATAAAGGAGAGGGAAGG + Intronic
1160080668 18:75724271-75724293 CAAAGCATAAATGAGGAGGAGGG + Intergenic
1161131550 19:2592718-2592740 CAGAGCAACAAGGAGAGGGAAGG + Intronic
1162370428 19:10275626-10275648 CAGAGGCTGAGGCAGAAGGATGG + Intronic
1162535617 19:11261796-11261818 GAGAGCCTGAAGCAGAAGGTGGG + Intronic
1164709584 19:30345858-30345880 CAGAGCTGGAGGCAGAAGGAAGG + Intronic
1164792972 19:31003639-31003661 CAGAGCTTACAGCAGAAGCTGGG + Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165880027 19:39035885-39035907 CAGAGGCTAAGGCAGGAGGATGG - Intergenic
1166351636 19:42201627-42201649 CAGAGCAGAAAGGAGAATGCAGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167316429 19:48765996-48766018 CAGAGAGTAAAACAGAGGGAAGG - Intergenic
1167316795 19:48768378-48768400 CAGAGAGTAAAGCAGAGGGAAGG - Intergenic
1167504406 19:49863556-49863578 CACAGCAAAAAACAGAAGGAGGG + Intronic
1167664541 19:50816489-50816511 CAGAGACTAGAGCAGAAGTAGGG + Intergenic
1167961465 19:53107595-53107617 CAGAGAATAATGCAAAATGATGG - Intergenic
925208955 2:2031356-2031378 CAGAGCAGATTGTAGAAGGAGGG + Intronic
925209347 2:2033350-2033372 CAGAGCAGATTCCAGAAGGAGGG + Intronic
926314057 2:11696793-11696815 CAGAGCATGAAGCAGCAGGAAGG - Intronic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926860550 2:17304320-17304342 TAGAACATAAGGCAGAAGAATGG + Intergenic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
927045687 2:19275955-19275977 CAGGGCAGAGAGCAGAAAGAAGG - Intergenic
927392978 2:22616314-22616336 CAGAGCAGATTGGAGAAGGATGG + Intergenic
927976829 2:27345042-27345064 GAGAGGACAAGGCAGAAGGATGG + Intronic
929959182 2:46483635-46483657 CAGACCATAAAGAGAAAGGAAGG + Intronic
929992657 2:46802827-46802849 TAGAGCAGAAAGCAGGAGGTCGG - Intergenic
930686102 2:54309965-54309987 CAGAGAATAAAGCATAAGTCAGG - Intergenic
931705392 2:64942659-64942681 AAGAGAATAAAGCAGCATGAGGG + Intergenic
931732425 2:65165132-65165154 CAGAGCAGAAAGGAGGAGCAAGG - Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932163110 2:69480971-69480993 CAGAGCATTAAGAAGAGGAAAGG + Intronic
932766873 2:74476102-74476124 CAGAGCATATGCCAGAAAGAGGG + Intronic
933525942 2:83438936-83438958 AAAAGGACAAAGCAGAAGGAGGG - Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934146680 2:89101529-89101551 CAGCTTATAAAGCAGCAGGAAGG - Intergenic
934222587 2:90099063-90099085 CAGCTTATAAAGCAGCAGGAAGG + Intergenic
935279510 2:101505449-101505471 CTGAGGATAATGCAGAAGTAAGG - Intergenic
935874821 2:107494866-107494888 CAGAGGAAAAAGGGGAAGGATGG + Intergenic
935921042 2:108015436-108015458 AAGAGAATACAGTAGAAGGATGG + Intergenic
935953554 2:108352541-108352563 CAGAGGAGAAAGCACCAGGAGGG + Intergenic
937153351 2:119701190-119701212 GAGAGCAGAAAGCAGAAAAAAGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937503708 2:122512392-122512414 CAAATCATTAAGCAGAAAGAAGG - Intergenic
938576099 2:132606046-132606068 CAGAGCAGCAAGCGGGAGGAGGG + Intronic
938659789 2:133473884-133473906 AAATGCATAAAGCAGGAGGAAGG + Intronic
939384053 2:141473750-141473772 CTGAGCTTAAAGCACAGGGAGGG - Intronic
940138490 2:150465839-150465861 CAGAGGGTCAGGCAGAAGGATGG - Intergenic
940828642 2:158442693-158442715 GAGAGGATAAAGCTGAAGCAGGG - Intronic
941145254 2:161835945-161835967 CAGGACTCAAAGCAGAAGGATGG - Intronic
941322766 2:164075783-164075805 CAAAGGATAAAGGAGAAGAAAGG - Intergenic
941354209 2:164468695-164468717 CAGCTCCTAAAGCAGATGGAAGG - Intergenic
941628384 2:167856261-167856283 AAGAGCAAAAAGCAGAAGGAAGG + Intergenic
941994182 2:171585980-171586002 TAGAGCAGAGAACAGAAGGAGGG - Intergenic
943395263 2:187325619-187325641 CAGAACACAAAGACGAAGGATGG - Intergenic
943484763 2:188465414-188465436 CTGATCCTCAAGCAGAAGGAAGG + Intronic
944302551 2:198140152-198140174 CAGAGCTTAAAAAAGAAGTATGG - Intronic
944334469 2:198514271-198514293 CAAATCATAAAACATAAGGAAGG - Intronic
944488297 2:200230430-200230452 AAGACCATGAAGGAGAAGGAGGG + Intergenic
944586170 2:201175754-201175776 AGGGGCATAAGGCAGAAGGAGGG + Exonic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946287097 2:218711943-218711965 CAGTGCAAGAAACAGAAGGATGG - Intronic
946755897 2:222947128-222947150 CAGAGCATCTAGCAGAATAAGGG - Intergenic
947375413 2:229490194-229490216 CAGGGAATATAGCAGAAAGAGGG + Intronic
947502169 2:230679107-230679129 CAAAGAATAAAGAAGAAGGTAGG + Intergenic
947597583 2:231423178-231423200 CAGAGCATAAAGCTCAGGGCAGG + Intergenic
948573751 2:238936542-238936564 AAGAGCATAGAGAAGAAGCATGG - Intergenic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168956611 20:1838682-1838704 CAGGTCATAAAGCAGGGGGATGG - Intergenic
1169735558 20:8833894-8833916 CAGAGAATATTCCAGAAGGATGG - Intronic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170512972 20:17098012-17098034 CAAAGCAAAAAGCAGATGCAAGG + Intergenic
1171241236 20:23568667-23568689 GAGAGTATAGGGCAGAAGGATGG - Exonic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1173241124 20:41298147-41298169 CAGAGCATTACCCAGCAGGAAGG + Intronic
1173604822 20:44324531-44324553 CAGAGGAGAACTCAGAAGGAAGG - Intergenic
1175237271 20:57523886-57523908 CTGAGCATACAGCAGCAAGAAGG - Exonic
1175446336 20:59022827-59022849 CAGAACTGAAAGCAGGAGGAAGG - Exonic
1175539557 20:59739828-59739850 CAAAGCAGAACACAGAAGGATGG - Intronic
1175663849 20:60841434-60841456 AAGAGCAGAATGCAGAAGAAAGG - Intergenic
1176402832 21:6330445-6330467 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1176434325 21:6658659-6658681 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1176458587 21:6985729-6985751 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1176904016 21:14478452-14478474 CATATGATAAAGCAGAATGAAGG - Intergenic
1176909215 21:14542342-14542364 TAGAGCCTAAGGCATAAGGAAGG - Intronic
1177030550 21:15978371-15978393 GGGAGCTTAGAGCAGAAGGAAGG + Intergenic
1178018410 21:28379021-28379043 CAGATCAGAAAGCAGAAAGTTGG + Intergenic
1179376867 21:40857465-40857487 TAGAACAAAAAGAAGAAGGAAGG - Intergenic
1180207873 21:46273443-46273465 CAGATCATGGACCAGAAGGAGGG - Exonic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180561931 22:16623363-16623385 AAGAGCATAAAGGTGGAGGAGGG + Intergenic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1181085768 22:20438670-20438692 AACAGCACAGAGCAGAAGGAAGG + Intronic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181863821 22:25839966-25839988 CTGAGCAGAGAGCTGAAGGAGGG - Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182095694 22:27623848-27623870 CAGGGCATAAAGGGGAAGGGAGG - Intergenic
1182148250 22:28010743-28010765 AAGAGGATGAAGCAGAAGGAAGG - Intronic
1182767673 22:32770331-32770353 CAGAGCATTGAGCAGAAGAGTGG - Intronic
1184662844 22:45973342-45973364 CACAGCACAAAGCAGGAAGATGG + Intronic
949276859 3:2294107-2294129 AAGAGCAAAGAGCAGAAGCAAGG + Intronic
949634979 3:5973029-5973051 CAGAGCCTAAGGCAGGAGCATGG - Intergenic
951479741 3:23147638-23147660 AAGAGCAGAAAGCACAAAGAAGG - Intergenic
952811952 3:37411933-37411955 CTGCTCCTAAAGCAGAAGGAAGG + Intronic
952820261 3:37480440-37480462 CTGAGGAGAAAGCTGAAGGAAGG - Intronic
952845040 3:37681245-37681267 CAGAGCATAGACAAGAAGGCTGG + Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954564640 3:51588934-51588956 CTGAGCAGAAACCAAAAGGAAGG - Intronic
954625020 3:52017724-52017746 CAGAGCCCACAGCAGAGGGAAGG - Intergenic
954648239 3:52144290-52144312 CAGAGCAGAAGGCTGAAGGAAGG + Intronic
955027952 3:55188639-55188661 CATGGCAGAAAGCAGAAGAAAGG - Intergenic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955880456 3:63539085-63539107 CAGAGGTGAAAGCAGAAGAAGGG - Intronic
955929682 3:64044212-64044234 CATAGAATAAAGAACAAGGAAGG - Intergenic
956013239 3:64854039-64854061 CTGAACATTGAGCAGAAGGAAGG + Intergenic
956360894 3:68445818-68445840 CACAGCCTAAAGCAGAAGTTGGG + Intronic
956514028 3:70026368-70026390 CAGAGGAAAAAGTAGAAAGAAGG - Intergenic
956833625 3:73077491-73077513 CAGAACATAAAGCCTGAGGAAGG - Intergenic
957408047 3:79797408-79797430 CAGTACAAAAAGTAGAAGGAGGG - Intergenic
958162955 3:89840258-89840280 CAAAGCATAAGGTGGAAGGAAGG + Intergenic
958636085 3:96749368-96749390 CAGAGCAGATATCAGAAAGAGGG + Intergenic
959321898 3:104887170-104887192 CAGAGCCCATAGCAGGAGGAGGG + Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960954536 3:123022615-123022637 CAGGAGAGAAAGCAGAAGGAGGG - Intronic
961127243 3:124430802-124430824 CAGAGCAGAAAGGCGAAGGGAGG - Intronic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
962267993 3:133957081-133957103 TAGAGCCTAGAGCAGAAAGAAGG - Intronic
962308763 3:134311481-134311503 CAGAGGCTGAAGCAGGAGGATGG + Intergenic
962403811 3:135083293-135083315 CAGAGGAGAAAGCAGCAGGGGGG + Intronic
962679519 3:137783945-137783967 AAGAGCATAAAGGGGAAGAATGG - Intergenic
963326883 3:143873172-143873194 CAGTGCAGAAGTCAGAAGGAAGG + Intergenic
964050098 3:152380974-152380996 CAGTTAATAAAACAGAAGGAGGG + Intronic
964538110 3:157747826-157747848 CACAACTTAAAGCAAAAGGAAGG - Intergenic
966592028 3:181694928-181694950 CAGAGCATAAAACAGACTGAGGG + Intergenic
968394786 4:224879-224901 CATAGCAGAAAGCAAAGGGACGG - Intergenic
969192800 4:5535816-5535838 CAGAGCAGAAATCATTAGGAGGG + Intergenic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
970036320 4:11739306-11739328 CATAGCACAAAGGAGAAGCAAGG - Intergenic
970593926 4:17582854-17582876 CTTAGCATTAAGCAGCAGGACGG + Intronic
971013027 4:22459988-22460010 CAGAGCAGAAAGTAGAAAGAGGG - Intronic
971178095 4:24300952-24300974 CAGATGAGAGAGCAGAAGGATGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971217302 4:24673262-24673284 TAGGGCACAAAGCACAAGGAAGG - Intergenic
971640082 4:29119932-29119954 CAGTACTCAAAGCAGAAGGAGGG + Intergenic
971913071 4:32821790-32821812 CATAGCACAAGGCAGAAAGAGGG - Intergenic
972034995 4:34508801-34508823 CATAGCAGAACACAGAAGGATGG - Intergenic
972354756 4:38269813-38269835 AGGAGCGTAAAGCAGAAGCAAGG - Intergenic
972374661 4:38459225-38459247 GGGAGCAAAAAGGAGAAGGAAGG + Intergenic
972776096 4:42242017-42242039 TAGAACAAAAGGCAGAAGGAGGG + Intergenic
973220357 4:47719236-47719258 AAGAGCAAAAGGTAGAAGGAAGG - Intronic
973652337 4:53008363-53008385 CAGAGCATCATGGAGAAGCATGG + Intronic
973709789 4:53617527-53617549 CATGTCATGAAGCAGAAGGATGG - Intronic
974247499 4:59339578-59339600 CAGAGGATAAAGAAGAGAGAAGG + Intergenic
975128738 4:70811213-70811235 CAAAGCATAAAGTAAAATGATGG + Intergenic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976088660 4:81432117-81432139 AAGACAATAAAGCAGAATGATGG + Intronic
976854786 4:89590839-89590861 CAGAACATAAATCAGAAGGGAGG + Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
978478148 4:109155886-109155908 AAGAGAACAAAGCAGAAGTAAGG + Intronic
979549926 4:121979228-121979250 CAGAGAAAAAAGTAGAGGGAAGG + Intergenic
980095975 4:128491260-128491282 TAGAGCATAAAGCGGAAAAAAGG - Intergenic
980463754 4:133149321-133149343 CAGAGGCTGAAGCAGGAGGAAGG + Exonic
980487180 4:133473866-133473888 CAGAGGAGAAAGCATAAGCATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981170546 4:141617665-141617687 CACAACTTAAAGCAAAAGGAAGG - Intergenic
981226617 4:142302618-142302640 CAGAGCACAAAGCACATGGTTGG + Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981744835 4:148042686-148042708 CAGAGTATAATGCAGAAGACAGG - Intronic
982157481 4:152536154-152536176 CAGAGCGGAAAGAAGAGGGAGGG - Intergenic
983454338 4:167943590-167943612 CAAAGCAGAAAACAGCAGGAAGG - Intergenic
983713194 4:170745306-170745328 CACAACAGAAAACAGAAGGATGG + Intergenic
984051739 4:174872888-174872910 CAGAACAAAAAGGTGAAGGAAGG + Intronic
984074926 4:175164498-175164520 AATAACCTAAAGCAGAAGGAAGG - Intergenic
984189579 4:176589354-176589376 AAGAGTACAGAGCAGAAGGAAGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984455229 4:179957972-179957994 CACAGCCAAAAGCAGAAGGGAGG + Intergenic
984703347 4:182832403-182832425 CAGAACATCATACAGAAGGAGGG - Intergenic
984749582 4:183258800-183258822 CAGAGCAGTAAGCAGCAGAATGG - Intronic
984891750 4:184500147-184500169 TAGAACATAAAGCCAAAGGAAGG - Intergenic
984960290 4:185090712-185090734 CAGGGCATCAAGTAGAAGGAAGG + Intergenic
985913855 5:2903131-2903153 CAGGGCAGAAAGCAGATGGCAGG - Intergenic
986468589 5:8051345-8051367 CAGGGCAGAATGCAGAAGGCGGG - Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
988229259 5:28452744-28452766 CAGAGAATAAAGGAAAATGAAGG + Intergenic
988458769 5:31413222-31413244 CAGGTCTTAAAGCAGAAGGGTGG + Intronic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
990114283 5:52369295-52369317 AGGGGCATAAGGCAGAAGGAGGG + Intergenic
990142890 5:52725902-52725924 CAGAACATTAAGTAAAAGGAAGG + Intergenic
990269739 5:54123755-54123777 CAGAGCATAAGATAGAAGGTTGG - Intronic
990524938 5:56615945-56615967 CAGTGCTTAAAACAGAAGGTTGG - Intergenic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992270650 5:75059494-75059516 GTTAGCATAAGGCAGAAGGATGG + Intergenic
994839450 5:104904235-104904257 TAAGGCATAAAGCAAAAGGAGGG - Intergenic
994862173 5:105210955-105210977 CAGTTCATAAAGCAGCAGCAGGG - Intergenic
995789056 5:115863763-115863785 GATAACATAAAGCATAAGGAAGG + Intronic
996308058 5:122073502-122073524 TTCAGCATAAAACAGAAGGAAGG + Intronic
996336028 5:122385063-122385085 CAAAGCTGAAAGCCGAAGGATGG - Intronic
998198346 5:140096426-140096448 CAGAGCTAAAAGGAGCAGGAGGG + Intergenic
998460991 5:142309897-142309919 CAAAACAAAAAACAGAAGGAAGG + Intergenic
998796097 5:145820714-145820736 AGGGGCATAAGGCAGAAGGAGGG + Intronic
999543354 5:152598795-152598817 CACAACATAAATCAGAAGAAGGG + Intergenic
999790008 5:154930651-154930673 TAGAGCTGAAAGCAGAATGATGG + Intronic
1000010021 5:157222298-157222320 TAGAGCCTACAGGAGAAGGAAGG + Intronic
1000633213 5:163614645-163614667 TAGAGAATAAGGCAGAAGAACGG - Intergenic
1000674923 5:164108861-164108883 TAGAGAATGAAGCAGAATGAAGG + Intergenic
1000876604 5:166646889-166646911 CATAGGAGAAAGCAGAAGGCAGG - Intergenic
1001033372 5:168278931-168278953 CAGACCTTAAAGCAGTGGGATGG - Intergenic
1001415017 5:171539610-171539632 CAAAGCAGACAGTAGAAGGAAGG - Intergenic
1001563719 5:172686413-172686435 CTGAGCATACAGCTGAGGGAAGG - Intronic
1001646692 5:173287353-173287375 CAAAGCATAAAGGAGGTGGAGGG + Intergenic
1002613606 5:180436887-180436909 TAGAGCACAAGGCAGCAGGAAGG + Intergenic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1002915117 6:1522779-1522801 AAGACCAGAAAGCAGCAGGAAGG + Intergenic
1002918228 6:1546161-1546183 CAGAGCAGGAGGAAGAAGGAGGG + Intergenic
1002992409 6:2250055-2250077 TGGACCAGAAAGCAGAAGGATGG - Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1005449868 6:25962171-25962193 CAAAGCACAAAGCAGAGTGATGG + Intergenic
1005506176 6:26470641-26470663 CAGAGCAAAAGGCAGAGGAAAGG + Intronic
1006093611 6:31642529-31642551 CACTGCTTAAAGCAGAAGTATGG + Intronic
1006429524 6:33986827-33986849 CAGAGTATAAGACAGACGGATGG - Intergenic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007287226 6:40756294-40756316 CAGAGCATTAAGAAGATGGGAGG + Intergenic
1007476287 6:42122059-42122081 CAGTTTATAAAGGAGAAGGATGG + Intronic
1008219224 6:48835495-48835517 AGGGGCGTAAAGCAGAAGGAGGG + Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009901634 6:69813956-69813978 CAGAGCAGAGTGGAGAAGGATGG + Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011073638 6:83413867-83413889 GGGAGGGTAAAGCAGAAGGATGG + Intronic
1011272138 6:85590661-85590683 AACAGCTTAAAGCAGAAGGAAGG - Intronic
1011809818 6:91118057-91118079 CACAGCATAAAACAAAAGGGTGG - Intergenic
1011910234 6:92426732-92426754 AAAAGCATAAAGAAGAAGCACGG + Intergenic
1012296100 6:97525861-97525883 CAAAGAATAAAGCTGAAGTAAGG + Intergenic
1012355160 6:98305433-98305455 CACAGCTTAATGCAGAAGTAAGG + Intergenic
1013175107 6:107669868-107669890 CAGTCCATAAAGCAGAAGGAAGG + Intergenic
1013459985 6:110365524-110365546 CAGAGCAAATAGGGGAAGGAAGG - Intergenic
1013760064 6:113507784-113507806 CAGAGCATAAAGCCAACGGTGGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015535831 6:134266508-134266530 CAGAGGCTGAAGCAGAAGAACGG + Intronic
1015703910 6:136066764-136066786 CAGAGCACAAAGCTGAAGCTAGG + Intronic
1016149948 6:140728360-140728382 CAGAGCATGAGGAAGAAAGAGGG + Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016631710 6:146240654-146240676 CAGAGCAGGATGAAGAAGGATGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017350665 6:153438186-153438208 CAGAACAGAAACAAGAAGGAAGG + Intergenic
1017578922 6:155838866-155838888 AAGAGAAGAAAACAGAAGGAAGG + Intergenic
1018711006 6:166498242-166498264 AAGAGCACAAAGCATAAAGAGGG + Intronic
1020164368 7:5796495-5796517 AAGAGAAAAAAGCGGAAGGAGGG - Intergenic
1021803584 7:24332772-24332794 CAAAGCACAAAGGAGAAGTAGGG + Intergenic
1022129813 7:27394707-27394729 CAGAGGATCAGGCAGAAGCAAGG - Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022710322 7:32843027-32843049 TGGAGCAAAGAGCAGAAGGAGGG + Intergenic
1023361919 7:39426061-39426083 CACAGCAGCAAGCAGCAGGAAGG - Intronic
1023761904 7:43472181-43472203 CAGCCTCTAAAGCAGAAGGAAGG + Intronic
1024263924 7:47592347-47592369 CAGATTATAAAGCGCAAGGAAGG + Intergenic
1024343577 7:48291106-48291128 CAAAGCAGAAAGAAAAAGGATGG - Intronic
1024363974 7:48500330-48500352 CTGAGCAAAAAGCAGCAGGTAGG - Intronic
1024428576 7:49259891-49259913 TACAGCATAAAGAAGATGGAAGG + Intergenic
1024871684 7:53970640-53970662 TAGAACAAAAAGCAGGAGGAAGG - Intergenic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1026017149 7:66680542-66680564 CAGAGTATAAAACAAAAGTATGG - Intronic
1026025226 7:66739248-66739270 CAGAGTATAAAACAAAAGTAAGG - Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1028855244 7:95584723-95584745 CAGAGCCTAATTCAGTAGGAAGG - Exonic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031090797 7:117351424-117351446 AGGAGCATAAAGCAGAAAAAGGG + Intergenic
1031390059 7:121202971-121202993 AAGAGCCTAAGCCAGAAGGAGGG - Intronic
1031399639 7:121315869-121315891 CGGAGCAAAGAGCAGAAGGACGG - Intergenic
1031564809 7:123282547-123282569 AAAAGCAGAAAACAGAAGGATGG - Intergenic
1032371422 7:131356875-131356897 AGGGGCATAAGGCAGAAGGAGGG + Intronic
1033603359 7:142906702-142906724 AAGAGAATAAAGAAGAATGATGG + Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1033801615 7:144908607-144908629 CAGGGCAAAAAGCAAAGGGAGGG + Intergenic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034738003 7:153446804-153446826 CAGGGAATAAAACAGAAGGAAGG - Intergenic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1036536050 8:9653774-9653796 CAGAGAATGAAGCAGAAAGAAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036693724 8:10961098-10961120 CAGAGCATGAGGCAGAGAGAGGG + Intronic
1037171132 8:15893613-15893635 CATGGCAGAAAGCAGAAGGAAGG - Intergenic
1037173328 8:15919533-15919555 CAGAACACAAAGGAGAAGCAAGG + Intergenic
1037410650 8:18592418-18592440 AAGAGCAGAAAGAAGAAAGAGGG + Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1038488113 8:27950583-27950605 CAGAGCATGACCCAGAAGGAGGG + Intronic
1038488328 8:27951858-27951880 CAGAGCATGACCCAGAAGGAGGG + Intronic
1039080940 8:33733430-33733452 CAGAGCAAGACGCTGAAGGAAGG - Intergenic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039742409 8:40394711-40394733 CAGGTCACAAAGCAGAAGTAGGG + Intergenic
1040440776 8:47439500-47439522 CCCAGCATAAATCAGAAAGATGG - Intronic
1041085301 8:54251215-54251237 CATAGCAAAAAGCAGAAGGGTGG - Intergenic
1042058395 8:64790497-64790519 CAAAGCCTAAAGCTAAAGGAAGG + Intronic
1042419123 8:68564641-68564663 CAGATCACAAACCAGGAGGAAGG - Intronic
1044055444 8:87564254-87564276 CAGGGCATAAGGCAGGAGGCAGG - Intronic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045077929 8:98590550-98590572 AGGAGCAAAAAGCAGGAGGACGG + Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1046317828 8:112530476-112530498 CAGACCATAAAGGAGAGTGATGG + Intronic
1046513041 8:115222642-115222664 GGGTGCATAAGGCAGAAGGAGGG - Intergenic
1046886622 8:119374715-119374737 CACACCATAAAGCTGAGGGATGG + Intergenic
1048774433 8:137930153-137930175 CAGAGCAGAAAACAGAATGAAGG - Intergenic
1049061463 8:140279326-140279348 CAGAGCCTAAAGCACATGGTAGG + Intronic
1049945826 9:594416-594438 CAAATCATATACCAGAAGGATGG + Intronic
1050051236 9:1603830-1603852 CAGAGCATAAAGCAGATGGTAGG - Intergenic
1051030153 9:12664937-12664959 ATGAACATAAAGTAGAAGGATGG + Intergenic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1051616140 9:19008762-19008784 CAAATCAGAAAGGAGAAGGAGGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052579579 9:30337943-30337965 ATGAGCATAGAGTAGAAGGATGG - Intergenic
1054795944 9:69302143-69302165 CAGAGCAGTAGGAAGAAGGATGG - Intergenic
1055358266 9:75460527-75460549 CAGAGCAGCAAGGTGAAGGAAGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056522096 9:87411198-87411220 CGGAGCAAAAAGCAGGAGGACGG - Intergenic
1056971569 9:91209167-91209189 CAGAGCAACAAGCAGAAGTGGGG + Intergenic
1057254083 9:93529327-93529349 CAGTGCAGAGAGCAGAAGGGAGG - Intronic
1057317233 9:93977470-93977492 CAGGGCGCAGAGCAGAAGGAAGG - Intergenic
1058425050 9:104868955-104868977 CTGAGCATAGAGGACAAGGAAGG + Intronic
1058761542 9:108138543-108138565 GAGAGAGGAAAGCAGAAGGATGG - Intergenic
1058855142 9:109054237-109054259 AGGAGGATGAAGCAGAAGGATGG + Intronic
1059081152 9:111251723-111251745 CAGAGCATAGAGGGAAAGGATGG + Intergenic
1059365183 9:113781341-113781363 AAGAGCATAATGTGGAAGGATGG - Intergenic
1059370737 9:113831529-113831551 CATGGCAGAAGGCAGAAGGAAGG - Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1062542530 9:137047970-137047992 CAGAGCAGAAGGCAGTAGGGAGG + Intergenic
1203437211 Un_GL000195v1:149983-150005 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1185892131 X:3831150-3831172 CAGACCTTAGAGCAGAAGGTTGG - Intronic
1185897238 X:3869564-3869586 CAGACCTTAGAGCAGAAGGTTGG - Intergenic
1185902357 X:3907996-3908018 CAGACCTTAGAGCAGAAGGTTGG - Intergenic
1186688112 X:11946745-11946767 TAGAGCAAAAAGGTGAAGGAAGG + Intergenic
1186754243 X:12653483-12653505 CAGTGCATAAAGCAGTAGAGGGG + Intronic
1187521655 X:20019721-20019743 GAGAGAAAAAGGCAGAAGGATGG - Intronic
1188896277 X:35672278-35672300 AAGAAGATAAAGAAGAAGGAAGG - Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189737010 X:44081492-44081514 CAAATCTTAAAGCAGAAAGAGGG + Intergenic
1190043797 X:47095686-47095708 ATCAGAATAAAGCAGAAGGAAGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193861212 X:86670758-86670780 CAGAGCATATTTCAGAAGAAAGG - Intronic
1193979817 X:88168716-88168738 CAGAGGAAAAAGCAGAAGCCTGG - Intergenic
1194640055 X:96392915-96392937 CTGAGTATGAAGCAGTAGGAGGG + Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1196727785 X:118912786-118912808 TAGACCATAAAGCACAAGGAAGG - Intergenic
1196750450 X:119112141-119112163 CAGAGGATAAAGGGGAAGCAAGG - Intronic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1199215303 X:145254794-145254816 CAGCGCAGAAAGGGGAAGGAAGG + Intronic
1201897451 Y:19007293-19007315 CAGAGGATAAAGAAGAGGCATGG + Intergenic
1201944505 Y:19497248-19497270 AAGAGCATCAAGCAGATGTAAGG + Intergenic