ID: 1079379154

View in Genome Browser
Species Human (GRCh38)
Location 11:19921789-19921811
Sequence TGCTATAAATCCAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079379154_1079379156 24 Left 1079379154 11:19921789-19921811 CCTACCTCATTGGATTTATAGCA 0: 1
1: 0
2: 0
3: 9
4: 168
Right 1079379156 11:19921836-19921858 AAAATGCTTAGCACTGTGCCTGG 0: 2
1: 25
2: 186
3: 822
4: 2650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079379154 Original CRISPR TGCTATAAATCCAATGAGGT AGG (reversed) Intronic
900776479 1:4589404-4589426 TGCTATAAATCCGCAGATGTGGG - Intergenic
900803180 1:4750368-4750390 TGCTAAAAATAGAATGAGTTGGG + Intronic
901496748 1:9626741-9626763 TGCTAAAAATACAATTAGCTGGG + Intergenic
904630466 1:31838204-31838226 GGCTTTAAATCCAATGAAGAGGG - Intergenic
905865638 1:41374990-41375012 AGCTACAAATCAAATCAGGTAGG + Intronic
906371913 1:45261322-45261344 TTTTATAAATGCTATGAGGTAGG - Intronic
909328355 1:74381346-74381368 TCATTTAAATCCAATAAGGTAGG - Intronic
910255913 1:85247431-85247453 TTCCAAAAATCCAATTAGGTAGG - Intergenic
912965706 1:114235401-114235423 TACTAGAAAGCCAATGGGGTGGG - Intergenic
913389320 1:118292988-118293010 TGCGATAAATGCACTGATGTGGG + Intergenic
914405432 1:147366379-147366401 TACCATAAATTGAATGAGGTGGG + Intergenic
915252147 1:154598189-154598211 TTCTGTAAATCCAATTATGTTGG + Intronic
915472900 1:156136419-156136441 CGCAACAAGTCCAATGAGGTAGG + Exonic
916893817 1:169140424-169140446 CCCACTAAATCCAATGAGGTAGG - Intronic
919137484 1:193529037-193529059 TCCTAACAATCCTATGAGGTAGG - Intergenic
921882484 1:220271152-220271174 TGCTACAAACCAAATAAGGTTGG - Intronic
923653328 1:235894039-235894061 TGCTCTTAATTCAATGGGGTGGG + Intergenic
1063272662 10:4529013-4529035 TGTTATAAATCCTATAAAGTTGG + Intergenic
1075924268 10:126237423-126237445 TGCCATAGATGAAATGAGGTCGG - Intronic
1075996590 10:126881846-126881868 TACTAAAAATACAAAGAGGTTGG + Intergenic
1079379154 11:19921789-19921811 TGCTATAAATCCAATGAGGTAGG - Intronic
1079794550 11:24783868-24783890 TGCTACAAATACCTTGAGGTAGG - Intronic
1085260388 11:75201185-75201207 TGCTAAAAATACAATTAGTTGGG - Intronic
1086912308 11:92487253-92487275 TTCTATCAAACCAAGGAGGTTGG + Intronic
1088519707 11:110682350-110682372 TCCTTAAAATCCTATGAGGTAGG + Intronic
1088520866 11:110698455-110698477 TTCTAAAAAACCAATGAGGAGGG - Intronic
1089241026 11:117079602-117079624 TGATATAAACCAAATGAGATAGG - Intronic
1091524864 12:1289302-1289324 TGCTCTAAATCCAGGTAGGTAGG - Intronic
1093393582 12:18652770-18652792 TACTAGAAACCTAATGAGGTGGG + Intergenic
1093547355 12:20364879-20364901 TGCTATAAATACAATGAAACAGG + Intergenic
1093574795 12:20714232-20714254 TCCTAACAATCCTATGAGGTAGG - Intronic
1095308632 12:40668221-40668243 TGCAATAAATGCACTGAAGTGGG + Intergenic
1095617586 12:44210316-44210338 TTTTAAAAATCCAATGAGGATGG - Intronic
1096915084 12:55023044-55023066 TCCTAATAATCCTATGAGGTAGG + Intronic
1097880836 12:64685164-64685186 TGCTAAAAATCCTTTGAGGAGGG - Intronic
1098886592 12:75967104-75967126 TCACATAAATCCAATGAGGTGGG + Intergenic
1099803910 12:87493449-87493471 TGCTATAAATGCTATGAGGAAGG - Intergenic
1099806187 12:87522364-87522386 TGGAATAAATGCAATGAGGAAGG - Intergenic
1100905894 12:99298614-99298636 TTGTATCAATCCTATGAGGTAGG + Intronic
1101505292 12:105340778-105340800 GGCTCTAAATCCAATGAGAAGGG + Intronic
1101543668 12:105689140-105689162 TGATATCAATCCCATGAGGACGG + Intergenic
1102436677 12:112929614-112929636 TCATATAAATCCTATGAGGTAGG + Intronic
1102758355 12:115363409-115363431 TAATACAAATCCCATGAGGTAGG - Intronic
1102856579 12:116299556-116299578 TGCTATTAATCCCATGAGATTGG - Intergenic
1104550475 12:129752250-129752272 TGCTATACATGCATTGAGGGGGG - Intronic
1104560662 12:129840802-129840824 TGTTACAAATCCCATGAGGCGGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106493110 13:30247024-30247046 TCCTAAAAGTCCTATGAGGTAGG + Intronic
1110051481 13:70906654-70906676 TACTATCAAGACAATGAGGTAGG + Intergenic
1112668529 13:101607183-101607205 TCCTAAAAACACAATGAGGTAGG + Intronic
1117046896 14:51821955-51821977 GTCTATAAATACAATGAGATGGG + Intergenic
1118253023 14:64181311-64181333 TGCTCTAAGCCTAATGAGGTAGG - Intronic
1118794746 14:69131616-69131638 TGCTAATAATCCAAAGAGCTTGG + Intronic
1121322426 14:92999735-92999757 TAATAAAAATCCTATGAGGTAGG - Intronic
1127335247 15:57978369-57978391 TGCTAAAAATCCAATAAACTAGG - Intronic
1127876074 15:63112694-63112716 TGCTCTACCACCAATGAGGTGGG - Intergenic
1128934045 15:71730392-71730414 TGCTCTAAATCCAATAGGGAGGG + Intronic
1130194161 15:81763416-81763438 TCCTTTCAATCCATTGAGGTGGG - Intergenic
1131594247 15:93780943-93780965 TGCATTAAATCCTATGTGGTGGG + Intergenic
1135012991 16:18900713-18900735 TGCACTAAAGCCAATGAAGTAGG + Intronic
1135319912 16:21488285-21488307 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135372748 16:21919772-21919794 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135439034 16:22450929-22450951 TGCACTAAAGCCAATGAAGTAGG - Intergenic
1135501525 16:23000035-23000057 TGCTATTAGTCTAATGGGGTTGG + Intergenic
1136330143 16:29569997-29570019 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1136444768 16:30309702-30309724 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1138066932 16:53951845-53951867 TGCTAGAAATGCAATAATGTGGG + Intronic
1138150135 16:54649227-54649249 TGGTATAAATACAAAGAGCTGGG - Intergenic
1142477369 17:197112-197134 TGCTAAAAATACAATTAGCTGGG - Intergenic
1143934649 17:10470343-10470365 AGCTATAGCTCTAATGAGGTGGG + Intergenic
1143979421 17:10855258-10855280 TGCCAAAAGACCAATGAGGTAGG - Intergenic
1144830725 17:18129736-18129758 TGTTAACAATCCCATGAGGTAGG - Intronic
1145839685 17:27984107-27984129 TTCCCTAAATCCTATGAGGTAGG - Intergenic
1147587777 17:41662621-41662643 TTCTATAAATCCCATGAAGTAGG + Intergenic
1149225822 17:54469297-54469319 TACTATAAAGTCAATGAGATAGG + Intergenic
1154203399 18:12316750-12316772 TGGTATAAAGCCAGTGAGGATGG - Intronic
1155535129 18:26809118-26809140 AGATAATAATCCAATGAGGTTGG + Intergenic
1158678447 18:59544326-59544348 TGCTAAAAATCCATTGCTGTAGG + Intronic
1159546531 18:69845922-69845944 TGATAAAATTCAAATGAGGTTGG - Exonic
1160319920 18:77880652-77880674 GGCTGTAAATGCAATGAGGATGG - Intergenic
1162487662 19:10971441-10971463 TGCTATAAATCTAATCAAGCAGG - Intronic
1167048007 19:47062554-47062576 TGCTAAAAATACAATTAGCTGGG + Intergenic
1167259152 19:48448533-48448555 TGGAAAAAATCCAATGAAGTAGG + Intronic
926967621 2:18432549-18432571 TGCCATAAATGCAATGATGATGG - Intergenic
928525265 2:32133477-32133499 TTATATAAATCTAATGATGTAGG + Intronic
928717522 2:34078924-34078946 TTCTCTAAAACCAATGAGGTGGG + Intergenic
929849369 2:45569735-45569757 TCCTAGAAATGCAAAGAGGTGGG - Intronic
929948752 2:46390008-46390030 AGCTTTAAACCCTATGAGGTAGG - Intergenic
934909889 2:98241988-98242010 AGGTATACATCCCATGAGGTGGG - Intronic
938141721 2:128799949-128799971 TGCTTTATTTCCAGTGAGGTGGG + Intergenic
939052325 2:137322466-137322488 TTCAAGAAATCCCATGAGGTGGG + Intronic
939378494 2:141402159-141402181 AGCTTTAAATCAAATAAGGTTGG + Intronic
942110635 2:172679184-172679206 GCCTATAAATCCAATGACTTGGG + Intergenic
944422603 2:199547133-199547155 AGCTATATATCCAAAGAGGGGGG - Intergenic
945087010 2:206141936-206141958 TGCTAGAATTCGAAAGAGGTTGG - Exonic
946091758 2:217231930-217231952 TGCCAAAAATCCAATAAGCTTGG + Intergenic
947577562 2:231288081-231288103 TGCTTTCAATCCTATGAGTTTGG - Intronic
1169873786 20:10274261-10274283 TGCTATCACTCCAAAGAGGGTGG - Intronic
1170071436 20:12373493-12373515 TGTTCCAAATCCCATGAGGTAGG - Intergenic
1172145124 20:32752226-32752248 TGCTCAAAATCTAATGAGGGAGG + Intergenic
1172959907 20:38791549-38791571 TTTTATAAATGCAATGTGGTGGG - Intergenic
1174005243 20:47405461-47405483 TGCTAAAAATACAATTAGCTGGG + Intergenic
1174064144 20:47852649-47852671 TGCTACAAACCCAAAGATGTCGG + Intergenic
1174909964 20:54597026-54597048 GGGTACAAATGCAATGAGGTTGG + Intronic
949170324 3:988766-988788 TGCTATAGAAACAATGGGGTTGG - Intergenic
949478657 3:4472556-4472578 TGCAAGAAATCCTATGGGGTTGG + Intergenic
951896993 3:27618922-27618944 TTCTATATATCCACTCAGGTTGG - Intergenic
952423320 3:33150401-33150423 TGGTATAAATCCAATGTTCTGGG + Exonic
952877976 3:37963666-37963688 TCCTCTAAATCGAGTGAGGTTGG + Intronic
953202750 3:40792057-40792079 TCATATCAATCCTATGAGGTAGG + Intergenic
956926801 3:73998026-73998048 TGCTGTAAATCTAAAGTGGTGGG + Intergenic
958441267 3:94158791-94158813 TGTTATAAATCCCATGAGTTTGG - Intergenic
961258534 3:125580212-125580234 TACTAAAAATCGAATGAGTTAGG + Intronic
961439477 3:126944387-126944409 TTCTATAAATAAATTGAGGTAGG - Intronic
962045961 3:131759195-131759217 TGCTGAAAAGCCACTGAGGTTGG + Intronic
964096876 3:152942140-152942162 TGCTATATATGCAATAAGGAGGG - Intergenic
965736782 3:171829134-171829156 TCCTACAAACCCAATGTGGTTGG - Intergenic
966893430 3:184424881-184424903 TTCTAACAATCCTATGAGGTAGG + Intronic
969855168 4:9993357-9993379 TCAAATAAAGCCAATGAGGTTGG + Intronic
970907788 4:21237353-21237375 TGCTATAAATACAATCAAATAGG + Intronic
971360276 4:25932059-25932081 TGCTATTACTGCAATGAAGTCGG + Intergenic
973635264 4:52856472-52856494 TGCTATACATTCTATGGGGTTGG + Intergenic
973909199 4:55562432-55562454 TTCTATAATTCCAATGAATTTGG + Exonic
973993348 4:56433853-56433875 TGCTAAAAATACAATTAGCTGGG - Intronic
976911365 4:90310603-90310625 GGATATAAATCCTATGAGGTAGG + Intronic
981246427 4:142545331-142545353 TGCAATTAACCCTATGAGGTAGG + Intronic
985216179 4:187656683-187656705 TGTTAACAATCCAATGAAGTAGG - Intergenic
988956549 5:36325542-36325564 TGCTGTAAATCAACTTAGGTAGG - Intergenic
989100719 5:37820527-37820549 TGCTATACATCCCATGGGTTTGG - Intronic
990159169 5:52917493-52917515 AGCTAAATATCCAATGAGATGGG + Intronic
994047301 5:95324630-95324652 TCATAAAAACCCAATGAGGTTGG + Intergenic
997170540 5:131714858-131714880 CACTATAAATCCATTGAGGCAGG + Intronic
998387034 5:141763177-141763199 TCCTTGAAATCCTATGAGGTAGG - Intergenic
1000759213 5:165201394-165201416 TGCTCTAACTACAATGATGTGGG + Intergenic
1004059623 6:12180131-12180153 TTCTATTAATACTATGAGGTTGG + Intergenic
1004904138 6:20220487-20220509 GGCAATAACTCCAATGTGGTAGG - Intergenic
1006297237 6:33175168-33175190 TCCTATCTATCCTATGAGGTAGG - Intronic
1006859731 6:37162998-37163020 CCATATAAATCCTATGAGGTGGG - Intergenic
1007152554 6:39708455-39708477 TACAATAAGGCCAATGAGGTTGG - Intronic
1008657299 6:53629035-53629057 TGCCAAAATTCCAAGGAGGTTGG + Intergenic
1010303076 6:74283866-74283888 TGGTGAAAATACAATGAGGTTGG - Intergenic
1011078090 6:83459505-83459527 TCCCAAAAATCCTATGAGGTTGG + Intergenic
1012358453 6:98346214-98346236 TGCTATAACTTCAATGCTGTGGG - Intergenic
1015122795 6:129719365-129719387 TACTTTATACCCAATGAGGTAGG - Intergenic
1015129729 6:129795597-129795619 TGCTAGAAAGCAAATGAGCTGGG - Intergenic
1016250385 6:142034270-142034292 TTCCAGAAATCCAATGAGGCTGG + Intergenic
1020707262 7:11560990-11561012 TCTTATAAAACCCATGAGGTAGG + Intronic
1021401661 7:20216771-20216793 TGCTATTAACCTAATGAGGTAGG + Intronic
1022126815 7:27365777-27365799 TTCTAGAAGTCCAATAAGGTAGG - Intergenic
1023303177 7:38795409-38795431 TGTTATAGATCCACTGAGGGTGG - Intronic
1024365725 7:48518227-48518249 TGCTAGAGATCCGATGAGGGAGG - Intronic
1028778651 7:94708425-94708447 TGCTTTTAATCAAATGAGGGAGG + Intergenic
1030232142 7:107219970-107219992 TTCTAAAAATCCTATGAGTTAGG + Intronic
1030367470 7:108661741-108661763 TCATAGAAATCCAATGAGGGTGG - Intergenic
1032865788 7:135922908-135922930 TCCTAATAATCCTATGAGGTGGG - Intergenic
1034142620 7:148836283-148836305 TACTAGAAATACAGTGAGGTGGG - Intronic
1037076355 8:14723893-14723915 TGCTATAAAGGCAATGAAGGTGG - Intronic
1038410825 8:27358018-27358040 CCATAGAAATCCAATGAGGTTGG - Intronic
1038960501 8:32513044-32513066 TTCTATAAAGACAAAGAGGTAGG + Intronic
1042105884 8:65325932-65325954 TGCTGGAACTCCAGTGAGGTGGG + Intergenic
1043914869 8:85910757-85910779 TTCTGCTAATCCAATGAGGTAGG + Intergenic
1046998046 8:120545922-120545944 TCCTATTAAACCTATGAGGTAGG + Intronic
1047503372 8:125459611-125459633 TTATATCAAGCCAATGAGGTAGG + Intergenic
1052109610 9:24564587-24564609 TCATATAAATCCAATGAAGATGG - Intergenic
1052220853 9:26020004-26020026 TGCTCTAATTCCAATCAGGATGG - Intergenic
1058122220 9:101151793-101151815 TACTATAAATCCATTCAAGTTGG + Intronic
1058192258 9:101933149-101933171 TGCTAAAACCCCAAAGAGGTAGG + Intergenic
1059027612 9:110652498-110652520 TGGTATAATACCTATGAGGTAGG - Intergenic
1059285317 9:113167246-113167268 ATCTACTAATCCAATGAGGTAGG - Intronic
1061708568 9:132471569-132471591 TGCTATAAACATAATCAGGTAGG + Intronic
1186554258 X:10540799-10540821 TGCTTTGAATCCAATGGGGAGGG - Intronic
1188409061 X:29849106-29849128 TGCTGTTATTCCCATGAGGTTGG - Intronic
1193332480 X:80250459-80250481 TGCTTTAATTCCACTGATGTAGG - Intergenic
1193731799 X:85110907-85110929 TCATAACAATCCAATGAGGTAGG + Intergenic
1193960807 X:87923213-87923235 TGCTATAAATCCAAGAGGTTTGG + Intergenic
1194056659 X:89143368-89143390 TGCTATAGAACCATTGGGGTTGG - Intergenic
1199217129 X:145273093-145273115 TCATAACAATCCAATGAGGTAGG + Intergenic
1200032782 X:153309940-153309962 TGCTAGGAATCAAATGAGTTTGG + Intergenic