ID: 1079381112

View in Genome Browser
Species Human (GRCh38)
Location 11:19938353-19938375
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079381106_1079381112 -3 Left 1079381106 11:19938333-19938355 CCTAATTGGCCTCTAAATGGTCA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1079381112 11:19938353-19938375 TCATCTAGATGGGTGGCTCAGGG 0: 1
1: 0
2: 0
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type