ID: 1079381112 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:19938353-19938375 |
| Sequence | TCATCTAGATGGGTGGCTCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 155 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 14, 4: 140} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1079381106_1079381112 | -3 | Left | 1079381106 | 11:19938333-19938355 | CCTAATTGGCCTCTAAATGGTCA | 0: 1 1: 0 2: 0 3: 13 4: 152 |
||
| Right | 1079381112 | 11:19938353-19938375 | TCATCTAGATGGGTGGCTCAGGG | 0: 1 1: 0 2: 0 3: 14 4: 140 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1079381112 | Original CRISPR | TCATCTAGATGGGTGGCTCA GGG | Intronic | ||