ID: 1079382092

View in Genome Browser
Species Human (GRCh38)
Location 11:19947283-19947305
Sequence TCAGATTGGACCCCTTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079382092_1079382099 28 Left 1079382092 11:19947283-19947305 CCAAAACAAGGGGTCCAATCTGA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1079382099 11:19947334-19947356 GGAAAACAAAAACAGCTTAAGGG 0: 1
1: 1
2: 3
3: 60
4: 679
1079382092_1079382095 7 Left 1079382092 11:19947283-19947305 CCAAAACAAGGGGTCCAATCTGA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1079382095 11:19947313-19947335 AAGGCCACTTCCAAGATCAGAGG 0: 1
1: 0
2: 1
3: 5
4: 177
1079382092_1079382098 27 Left 1079382092 11:19947283-19947305 CCAAAACAAGGGGTCCAATCTGA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1079382098 11:19947333-19947355 AGGAAAACAAAAACAGCTTAAGG 0: 1
1: 1
2: 7
3: 117
4: 887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079382092 Original CRISPR TCAGATTGGACCCCTTGTTT TGG (reversed) Intronic
900839072 1:5032521-5032543 ACAGATTGAAACCCTGGTTTCGG - Intergenic
907971202 1:59383450-59383472 TCTGAATGGACCCCTTCTCTTGG + Intronic
909080576 1:71106653-71106675 TCAGGTTGGTACCTTTGTTTAGG - Intergenic
912329698 1:108807437-108807459 TCAGCTTTGACCCATTTTTTCGG - Exonic
918373404 1:183883699-183883721 TCAGACTTTACTCCTTGTTTAGG - Intronic
923301218 1:232642553-232642575 TCAGATTAGAGTCCTTCTTTGGG - Intergenic
1063003533 10:1946597-1946619 TCAGTTTGGACCCCTTGGCTGGG - Intergenic
1067134809 10:43598513-43598535 TCAGTTTGGACTTCTTGATTAGG + Intergenic
1068499741 10:57829524-57829546 TGAGATTGGACCCATGGATTTGG - Intergenic
1074744652 10:116520037-116520059 TCAGATTGGACACTTTGAATAGG - Intergenic
1075350100 10:121716313-121716335 TCTGAATGGACCCCTTCTCTTGG - Intergenic
1075382372 10:122029815-122029837 TCAGGTTCAACCCCTTCTTTGGG + Intronic
1075409744 10:122218681-122218703 TCAGGTTGGCCCTCTGGTTTGGG + Intronic
1075658846 10:124179637-124179659 TGAGATTGGGCCACTGGTTTTGG - Intergenic
1076797535 10:132805551-132805573 CCAGATTGGACAGCTTGTTGGGG + Intergenic
1079225217 11:18599165-18599187 TGAGTATGGACCACTTGTTTAGG + Intergenic
1079382092 11:19947283-19947305 TCAGATTGGACCCCTTGTTTTGG - Intronic
1083355135 11:62060610-62060632 TGAGGTTGGACCCCTTCTTTAGG - Intergenic
1085605515 11:77894331-77894353 ACAGACTTGACCCCTTATTTGGG - Exonic
1087926350 11:103923038-103923060 TCAGGTTGAACCACTTTTTTGGG + Intronic
1088425343 11:109696113-109696135 AGAGATTGGAGCACTTGTTTTGG + Intergenic
1094094363 12:26687330-26687352 TTATATTGCATCCCTTGTTTTGG - Intronic
1105419175 13:20237737-20237759 TCAGCTTGGACCCCTTGCTGAGG + Intergenic
1112714775 13:102171236-102171258 TGACAGTGGACTCCTTGTTTAGG - Intronic
1112791268 13:103004883-103004905 TCAGTTTGGACTTCGTGTTTTGG + Intergenic
1122433215 14:101671250-101671272 TCTTCTTTGACCCCTTGTTTAGG - Intergenic
1128380137 15:67106286-67106308 TGAGATTTGAACCCTTGTTTGGG - Intronic
1128740908 15:70083091-70083113 TCAGATTGGACTTCTTTATTCGG - Intronic
1129175067 15:73833896-73833918 TGGCATTGGACCCTTTGTTTCGG - Intergenic
1129437438 15:75553359-75553381 TCTGATAGGACTCCTTGTTTTGG - Intronic
1130017828 15:80201325-80201347 TCAGGTGGGACCTCTTGGTTGGG + Intergenic
1132103096 15:99041720-99041742 TCAGATTTGATCCCTTGGTTTGG - Intergenic
1133000049 16:2845724-2845746 TCTGAATGGACCCCTCCTTTGGG + Intergenic
1135982255 16:27157015-27157037 TCTGAATGGACCCCTTCTCTCGG + Intergenic
1137385628 16:48040150-48040172 ACAGATTGGGTCCCTTGTTCTGG + Intergenic
1141857232 16:86691652-86691674 TCAGATTGGAGCCCTGGACTTGG - Intergenic
1142701153 17:1661777-1661799 TCTGTTTGGACCACCTGTTTGGG + Exonic
1145412497 17:22681941-22681963 ACAGAGTTGAACCCTTGTTTTGG - Intergenic
1146419358 17:32668593-32668615 TGAAATTGGAACCCTTTTTTCGG - Intronic
1149300199 17:55298167-55298189 TCAGATTAGATCCCCTGTTCAGG + Intronic
1153141265 18:1975037-1975059 AAAGATTGGACACCCTGTTTTGG - Intergenic
1154024978 18:10698467-10698489 TCTGATTGTACTCGTTGTTTGGG + Intronic
1157689132 18:49666644-49666666 GTAGATTGGACCCGTTGGTTTGG + Intergenic
1157933139 18:51845241-51845263 TCAGCTTGGTCCCCTTCTTGCGG + Intergenic
1158860096 18:61583232-61583254 TGAGCCTGGACCCATTGTTTGGG + Intergenic
1159989793 18:74891182-74891204 TGAGATTGGACCCCATGTGATGG + Intronic
1160159497 18:76460432-76460454 TTAGATTGTACCCCTTTTATTGG - Intronic
1160910923 19:1473485-1473507 CCAGGTTGGACCCCCTGTCTGGG - Exonic
1166373356 19:42314250-42314272 TCAGACTGGGCCCCTTTTTCAGG + Exonic
925423314 2:3728954-3728976 TCAGATTGAAGCCCTGGTTCTGG + Intronic
930171230 2:48253624-48253646 TGAGATTGGACCACTGGATTTGG + Intergenic
932317567 2:70796051-70796073 TCAGTTTGGACCCCTGGATTTGG + Intergenic
937544735 2:123003346-123003368 TTAGCTTGGATCCCTTGCTTAGG - Intergenic
938259761 2:129887174-129887196 TCTAAGTGGACCCCTTGTCTTGG - Intergenic
948679267 2:239621638-239621660 TCAAATTGAACCCCAAGTTTTGG + Intergenic
1173611780 20:44373610-44373632 TCATGTTGGACCCCACGTTTAGG - Intronic
1181045149 22:20210842-20210864 TCAGACTGGACCCCATGTGCTGG + Intergenic
1185013566 22:48330766-48330788 TCAGAATGGACGTCTTGTTCAGG - Intergenic
949403350 3:3688542-3688564 TCAGAATGGACCCCTCCTCTCGG - Intergenic
949605761 3:5651681-5651703 TCTGGTTAGACCCCATGTTTGGG - Intergenic
953454052 3:43028371-43028393 TCTGAATGGACCCCTCCTTTTGG - Intronic
957209005 3:77236511-77236533 TCTGGTTGGACCCCTTCTCTTGG - Intronic
959856648 3:111166501-111166523 TCAGATAGGACCCTGAGTTTAGG + Intronic
961123128 3:124391037-124391059 TCAAATTGGACCCATTCTTTTGG + Intronic
963273049 3:143304117-143304139 TCAAATTGTATCCATTGTTTTGG + Intronic
963446975 3:145424706-145424728 TAACATTGTACCCCTTCTTTTGG - Intergenic
971547707 4:27908454-27908476 TCAGTTTGGAGCCCTTCTATTGG - Intergenic
971949944 4:33332185-33332207 AGAGATTGGACCACTTGTTCTGG + Intergenic
975370720 4:73583943-73583965 TCAGATTGGATCACTTGTGCTGG - Intronic
979678702 4:123435974-123435996 TCAGACTGGACTCCTTGAGTGGG - Intergenic
980070677 4:128240517-128240539 TGATATAGGACCCCTTCTTTGGG - Intergenic
981997959 4:150994988-150995010 TCAGATTTCCCACCTTGTTTAGG - Intronic
984299700 4:177899380-177899402 TGAGATTGGACCCCTAGCCTTGG - Intronic
985504229 5:269779-269801 TCTGAATGGACCCCTTCTCTGGG - Intergenic
985804483 5:2032114-2032136 CCAGATGGGACCCCTAGTATCGG + Intergenic
988637747 5:33005426-33005448 TCTGAATGGACCCCTTCTCTTGG + Intergenic
989740905 5:44770681-44770703 TCAGGTTAGAGCCCTTATTTAGG - Intergenic
990232317 5:53727003-53727025 TCAGGTTAGATTCCTTGTTTGGG - Intergenic
992000770 5:72434141-72434163 TCTGCTTGGACTCATTGTTTGGG + Intergenic
994113669 5:96037757-96037779 TCAGCTTGGAGTTCTTGTTTGGG + Intergenic
994486677 5:100391139-100391161 TCACATTGAACCCCATGTTGGGG + Intergenic
998907748 5:146924626-146924648 TCAGAAGGGCCTCCTTGTTTAGG + Intronic
999541980 5:152584338-152584360 TCAGGCTGGACCCCTGGCTTGGG - Intergenic
1002774190 6:314866-314888 TTAGATTGGACCCCATTATTTGG + Intronic
1005687779 6:28271889-28271911 TCAGACTGTTCTCCTTGTTTTGG - Exonic
1011567463 6:88691833-88691855 TAATATTATACCCCTTGTTTAGG - Intronic
1014815365 6:125929917-125929939 TCAAATTGGACCAATTGTCTTGG + Exonic
1019833354 7:3356234-3356256 TTAGATTTGACCTCTTTTTTGGG + Intronic
1024280945 7:47719285-47719307 AGAGATTGGAGCCCTTGTGTTGG + Intronic
1033635444 7:143207776-143207798 TCTGAATGGACCCCTTCTCTTGG - Intergenic
1036948476 8:13118487-13118509 TCAGAGTGGACTCTTTGTGTTGG - Intronic
1037138297 8:15490188-15490210 TCAGATTGGTCCTAATGTTTAGG - Intronic
1040549474 8:48427490-48427512 CCCTCTTGGACCCCTTGTTTTGG + Intergenic
1048971806 8:139649345-139649367 TGAGCTTGGACCCGTTGATTTGG + Intronic
1050576180 9:6998017-6998039 TCAGATTAAAGCCCTGGTTTTGG + Intronic
1185539799 X:893829-893851 ACAACTTGGACCCCTTGTTCTGG - Intergenic
1186729771 X:12397145-12397167 TCAGATCTTACCCCTTCTTTAGG - Intronic
1188375462 X:29422850-29422872 ACAGAATGGACCCCTCCTTTCGG + Intronic
1192471379 X:71401910-71401932 TTAGGTTGTACCACTTGTTTTGG + Intronic
1196487844 X:116234344-116234366 TGAGACTGGACCCCTTCCTTAGG - Intergenic
1200129577 X:153833680-153833702 TCAGAGTGGAGCCCTTCTGTGGG - Intergenic
1200968331 Y:9122046-9122068 TCTGAATGGACCCCTCTTTTTGG - Intergenic
1200979143 Y:9245860-9245882 TCTGAATGGACCCCTCCTTTTGG + Intergenic
1202132223 Y:21623282-21623304 TCTGAATGGACCCCTCCTTTTGG - Intergenic