ID: 1079385159

View in Genome Browser
Species Human (GRCh38)
Location 11:19972272-19972294
Sequence CACCTTCAGAAACTGTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079385159_1079385161 -2 Left 1079385159 11:19972272-19972294 CCTGTGTACAGTTTCTGAAGGTG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1079385161 11:19972293-19972315 TGACATCTGGACGAGTGACCAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1079385159_1079385162 -1 Left 1079385159 11:19972272-19972294 CCTGTGTACAGTTTCTGAAGGTG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1079385162 11:19972294-19972316 GACATCTGGACGAGTGACCAGGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079385159 Original CRISPR CACCTTCAGAAACTGTACAC AGG (reversed) Intronic
900125132 1:1065482-1065504 CACCTTCAGACTCTGTCCCCTGG + Intergenic
901798898 1:11695928-11695950 CACCTTAAAAACCTGTACAGGGG - Intronic
911419808 1:97626564-97626586 CACATTCAGAAACTATAGATGGG - Intronic
912221188 1:107677818-107677840 CACCTTCAGAATCAGAACAAAGG - Intronic
912249108 1:107992517-107992539 CCCCTTCAGAAATGGTCCACAGG + Intergenic
913522513 1:119659035-119659057 CACTTGCAGAATCTATACACAGG - Intergenic
916200517 1:162266929-162266951 TATCTTCAGAAACTGTACAAAGG - Intronic
916885126 1:169060049-169060071 CAGCTCCAGAAAATGAACACAGG + Intergenic
917134397 1:171775175-171775197 CACCATCTAAAAGTGTACACTGG - Intergenic
917185554 1:172350853-172350875 CAACATCAGAAAATGTAGACAGG + Intronic
917611217 1:176690835-176690857 CAACTTCAAAAACAGTACAATGG - Intronic
918977294 1:191506542-191506564 CAACTTCAGAAATTATACTCAGG - Intergenic
920440375 1:205976776-205976798 CACCTTTAGAAATGGTCCACAGG + Exonic
921272949 1:213489202-213489224 CTCCTTAAGCAACTGTACTCAGG - Intergenic
1065795533 10:29304059-29304081 CAGCTTCAGAAAATGGTCACGGG - Intronic
1068030043 10:51695122-51695144 CACTTCCACAAACTGAACACAGG - Intronic
1071286333 10:84150172-84150194 CATGTTCAGAAACTTTTCACTGG - Exonic
1071896510 10:90073682-90073704 CACCTTCATAAACGGAAGACAGG - Intergenic
1073661109 10:105477202-105477224 ACCCTTCATAAACTGTACAGAGG - Intergenic
1073770073 10:106726327-106726349 CATCTTCAGAAACTATCCAAGGG - Intronic
1076529351 10:131134159-131134181 GCACTTCAGACACTGTACACAGG - Intronic
1077234926 11:1476794-1476816 AACTTTAACAAACTGTACACAGG - Intronic
1078020217 11:7650850-7650872 CTCCTTCAGAAGTTGTACAGTGG + Exonic
1079385159 11:19972272-19972294 CACCTTCAGAAACTGTACACAGG - Intronic
1080859081 11:36137464-36137486 CACCTTCAGAATCTTTCCCCTGG - Intronic
1085805735 11:79634214-79634236 GACCTTCAGAAACCCTACACAGG - Intergenic
1087435817 11:98116081-98116103 CACCTTCAGAAAGGTCACACAGG + Intergenic
1088200009 11:107321770-107321792 CACCTTAAGAATCTATTCACTGG - Intergenic
1093175302 12:15906638-15906660 CACCGGCTGAAGCTGTACACGGG - Intergenic
1095090264 12:38098131-38098153 CACCATCAGAAAGTGGACAAGGG + Intergenic
1097444642 12:59654846-59654868 CACCTTGAGAAATTGTACTTGGG + Intronic
1097608940 12:61793187-61793209 CATCTTAAGAAACTGTAAAAAGG + Intronic
1100102988 12:91132336-91132358 TAGCTTCAGAAACAGTACAGAGG - Intergenic
1101019635 12:100540385-100540407 AACCCTCAGAAACTAGACACAGG - Intronic
1105475901 13:20728025-20728047 CACAATCAGAAAATGGACACTGG + Intergenic
1106589174 13:31084540-31084562 AACCTTCAGACACTGCATACTGG + Intergenic
1110058183 13:71004750-71004772 TACATTCAGAAACCTTACACTGG + Intergenic
1115142827 14:30193487-30193509 CACATTCAGAAAATGTCCAGTGG + Intergenic
1115733945 14:36303070-36303092 CATGTTCAGAATGTGTACACTGG - Intronic
1117164630 14:53021143-53021165 CAGCTGCAGTAACTGCACACAGG - Intergenic
1117960330 14:61155824-61155846 CTCTTTCAGAAACTGTCCAGGGG - Intergenic
1118131230 14:62966171-62966193 CATCTTCTGAAAGTGCACACTGG + Intronic
1119071618 14:71591015-71591037 CACCTGCAGAAAATTTGCACAGG - Intronic
1120558964 14:85967474-85967496 CTCCTTCACAAACTCTACAGGGG - Intergenic
1121757812 14:96417826-96417848 TACCTCCAGAATCTGTACAAGGG + Intronic
1124222076 15:27859104-27859126 CACCTTAAGAAACTATAAAAAGG + Intronic
1127605484 15:60583248-60583270 CACCTCCAGAGCCTGGACACTGG + Intronic
1128231068 15:66035733-66035755 CACATTCAGGAAGTGAACACAGG - Intronic
1130149254 15:81298850-81298872 CCCCATCAGAAGCTGTGCACAGG + Intronic
1130979119 15:88800962-88800984 CAGCTTCAGAAATATTACACTGG + Intergenic
1132258937 15:100403906-100403928 CATCTGCAAAAACTTTACACAGG - Intronic
1133182029 16:4063740-4063762 CACCTTAAGAAACTATAAAAAGG + Intronic
1144123277 17:12177784-12177806 CACCGTCAGAATCTGTAAACAGG + Intergenic
1148828710 17:50414638-50414660 CACCTTCAGAAAGGGAAAACTGG - Intergenic
1159227911 18:65564584-65564606 CACCTTCAGAAATTGTTCTGGGG + Intergenic
1167099981 19:47398855-47398877 CACATTCAGCAACAGGACACGGG + Intergenic
925857417 2:8143362-8143384 TACCTTCCGAAACTCCACACTGG + Intergenic
926094803 2:10074112-10074134 CTCCCTCAGCAACTGTACTCTGG + Intronic
931804924 2:65794966-65794988 CACCTTCACAAACACTACTCTGG - Intergenic
933037586 2:77419946-77419968 CACCTTCAGAAACTGTCCCCAGG - Intronic
938319751 2:130355290-130355312 CATCTTCAGAAAGTGTGCAGAGG - Intergenic
943402934 2:187438933-187438955 CACCTTCAGTAATTTTACTCTGG + Intronic
943541884 2:189225901-189225923 CAACTTCAGAGTCTGTACCCAGG - Intergenic
944403504 2:199355488-199355510 AACCTTCAGAAACTATACTTTGG - Intronic
947088999 2:226489183-226489205 CAACTGCAGAAAATGTACAATGG + Intergenic
948830149 2:240594688-240594710 CACCTGCAGAGCCTCTACACAGG + Exonic
1169588335 20:7112563-7112585 CACCTGCTGAAACTCTAAACAGG - Intergenic
1171015941 20:21542001-21542023 AACCTTCAAAAACTGTGAACAGG - Intergenic
1174684595 20:52441566-52441588 CACCTTCTGGAACTGTCCATGGG + Intergenic
1178681523 21:34676169-34676191 AACCTTCAGAAATACTACACTGG + Intronic
1179838351 21:44052890-44052912 CCCCTTCAGAAACTGTGAAAGGG + Intronic
1181140349 22:20800039-20800061 GACCTTAAGAAACAGTACAAGGG - Intronic
1182088121 22:27575388-27575410 CACCTTCAGAAGGTGAGCACTGG - Intergenic
950506072 3:13395328-13395350 CACCTTCACACACTGCACCCAGG + Intronic
953620455 3:44528343-44528365 CAGCATCAGAAACTCCACACTGG + Intergenic
955796245 3:62640120-62640142 TTCCTTCAGCAAGTGTACACAGG - Intronic
956035180 3:65082994-65083016 CATCTTCAGAAACATTAAACAGG + Intergenic
957026957 3:75193089-75193111 CCCCTTCAGAAACTAGTCACAGG + Intergenic
957108853 3:75926622-75926644 CACCTTAAGAACCTTTAAACAGG - Intronic
958466075 3:94460322-94460344 CACATTCAAAAACTGTGCACAGG - Intergenic
959638375 3:108602137-108602159 CACCTTCCTAAACTGTATATAGG - Intronic
961110035 3:124276203-124276225 CACCATGAGAAAATCTACACTGG + Intronic
962960318 3:140305321-140305343 TACTTTCAGAAACTGAATACAGG + Intronic
963247574 3:143076923-143076945 CACATTTAGAAACTGTGCAAAGG + Intergenic
965763650 3:172107744-172107766 GAACTTCTGAAACTGTACTCAGG + Intronic
966811520 3:183849580-183849602 CACCTTAAGAAAGTGTAGAGAGG + Intronic
966879923 3:184344524-184344546 CACCTCCAGGACCTGTTCACCGG + Exonic
967327845 3:188259962-188259984 AAAATTCAGAAACTGTAAACAGG + Intronic
967767688 3:193299647-193299669 CACTTTCACAAACTGAACAAAGG + Intronic
968414308 4:416922-416944 CACCTGCAGAAAATGTTCCCAGG - Intergenic
969058821 4:4419191-4419213 GACCTCCAGGAACTGTAAACAGG - Exonic
969877109 4:10143857-10143879 CACCTTCTGACGCTGCACACGGG - Intergenic
970075584 4:12215965-12215987 CAGTTTCAGAAGCTGTCCACGGG - Intergenic
972128394 4:35800103-35800125 CGACTTCACAAACTGAACACAGG + Intergenic
972715073 4:41637577-41637599 CACCTTCCGAAACGATACTCTGG + Intronic
973577261 4:52302857-52302879 TACCCACAGAAACTGCACACAGG - Intergenic
977043300 4:92040374-92040396 CACCTTCAGAAAGTGAAAAGTGG - Intergenic
979941329 4:126767023-126767045 CAGCTTCACAAACTGAACTCTGG + Intergenic
984135296 4:175929671-175929693 CCCCCTCAAAAAATGTACACAGG + Intronic
985371724 4:189292288-189292310 CACCTTCTGAAGCTGTACCTGGG - Intergenic
985754697 5:1706470-1706492 CACCTACTGAAACTGTTCATGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
990851915 5:60214690-60214712 GTCCTTCAGAAACTGAACAGAGG + Intronic
993866814 5:93205628-93205650 CACCTTCATAAATTGTCAACTGG - Intergenic
996995915 5:129696593-129696615 CACCTTCAGCAAATGTTCTCAGG - Intronic
997075422 5:130669212-130669234 CTCCTTCAGAAAGAGTACAAGGG + Intergenic
997175859 5:131776866-131776888 CACTTTCAGAAACTGTACTGAGG + Intronic
997806240 5:136920998-136921020 CACCTTCAGAAACTTCTCTCTGG + Intergenic
999173157 5:149612637-149612659 AACATTCAGAAACTGAACAAAGG - Intronic
999701991 5:154236755-154236777 CACATTTAGAAAATGTACCCTGG + Intronic
1000059505 5:157641086-157641108 CACTTTCAGAAACTAGAAACAGG + Intronic
1002340038 5:178509786-178509808 CCCCTTAAACAACTGTACACTGG + Intronic
1004197897 6:13521796-13521818 CACCTTCAGTCACCATACACAGG - Intergenic
1007476285 6:42122051-42122073 CTCCTTTATAAACTGTTCACTGG - Intronic
1008475107 6:51927912-51927934 CACATTGAGAAACTGTGCAGTGG + Intronic
1008528681 6:52434145-52434167 CACCTGTGGAATCTGTACACTGG + Intronic
1011767085 6:90633815-90633837 CACCTTTTGAATCTGTACATGGG + Intergenic
1014028572 6:116676246-116676268 CCACTTCAGAAACTGCACTCTGG + Intergenic
1016051378 6:139533940-139533962 CACATTTTTAAACTGTACACTGG - Intergenic
1017258224 6:152358411-152358433 CACCTTCAAGAACTGAATACTGG + Exonic
1023506919 7:40909437-40909459 CACCTTCAGGAACTAAACATTGG - Intergenic
1024481608 7:49868984-49869006 TCCCTTCAGAAACCGTACTCTGG - Intronic
1030671478 7:112342594-112342616 CACTGTCAGATAGTGTACACAGG - Exonic
1033143256 7:138847022-138847044 CTCCTTCAAGAACTGTAAACCGG + Intronic
1037801662 8:22039238-22039260 CGACTTCATAAACTGTGCACCGG - Intergenic
1039314037 8:36352120-36352142 CTGCTCCAGAAAATGTACACAGG - Intergenic
1042584080 8:70316122-70316144 CACCTTCAGAAACAATACAGAGG + Intronic
1045894091 8:107193638-107193660 CACCTTCTGAAAGTGAAGACAGG - Intergenic
1046511457 8:115209616-115209638 CATCTTCAGCAACTGTACTTTGG + Intergenic
1058227777 9:102387880-102387902 CATCTTCAGAAAATATAAACAGG - Intergenic
1059419246 9:114180862-114180884 CACCTTCAGAAGCTGCAGATGGG + Intronic
1060401208 9:123350568-123350590 TACCTTCAGGAACTGCAGACAGG - Intergenic
1188282905 X:28292290-28292312 CATCTTCAGTAAGTGTACACAGG - Intergenic
1188390136 X:29609617-29609639 AACCTTAAGAAACAGTAAACTGG - Intronic
1188772769 X:34174728-34174750 AACCTTCAGAAACAGGAAACAGG - Intergenic
1190036440 X:47029379-47029401 AGCCTTCAGAAACTGTAAAGTGG + Intronic
1190561452 X:51689901-51689923 AACCTTCAGAAACTCTGCTCTGG - Intergenic
1190562839 X:51703416-51703438 AACCTTCAGAAACTCTGCTCTGG + Intergenic
1191906415 X:66095811-66095833 CACATTCAGAAAATGGAAACTGG + Intergenic
1193946868 X:87748448-87748470 CAGCTTTACAAACTGTACATCGG - Intergenic
1195321539 X:103725384-103725406 TACCTTCAGAAAGAGAACACTGG - Intronic
1195529093 X:105931426-105931448 CACCTTCCCAAACTGAACTCAGG + Intronic
1195754343 X:108186531-108186553 CACCTTCATAAACTATAAGCAGG + Intronic
1196377440 X:115049127-115049149 CACCTTGAAAATCTGTACACAGG + Intergenic
1201072940 Y:10165895-10165917 CAGCTTCACAAACAGCACACAGG - Intergenic