ID: 1079385970

View in Genome Browser
Species Human (GRCh38)
Location 11:19980074-19980096
Sequence AGAAGGCATTTGAACAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079385966_1079385970 -2 Left 1079385966 11:19980053-19980075 CCTTCAGCCAGCAAGGGGCAGAG 0: 1
1: 1
2: 13
3: 63
4: 504
Right 1079385970 11:19980074-19980096 AGAAGGCATTTGAACAACTTGGG 0: 1
1: 0
2: 0
3: 18
4: 203
1079385968_1079385970 -9 Left 1079385968 11:19980060-19980082 CCAGCAAGGGGCAGAGAAGGCAT 0: 1
1: 0
2: 2
3: 32
4: 289
Right 1079385970 11:19980074-19980096 AGAAGGCATTTGAACAACTTGGG 0: 1
1: 0
2: 0
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079385970 Original CRISPR AGAAGGCATTTGAACAACTT GGG Intronic
901748463 1:11390391-11390413 AGAAGGCACTTGCATAACTTTGG - Intergenic
902164875 1:14561979-14562001 AGAAGGCCTTTGAAAAACCCAGG + Intergenic
903087226 1:20872669-20872691 AGGAGGCTTTTGTATAACTTTGG - Intronic
904291591 1:29489406-29489428 AGAATGAATTTGAAAAATTTTGG + Intergenic
904578938 1:31525295-31525317 AGAAGGCATTTGCAGGACTGGGG + Intergenic
906235547 1:44206112-44206134 AGAAGGCATTTAGATAACTCAGG + Intergenic
908060401 1:60342138-60342160 GGAAGGCATTAGAACTACTTGGG + Intergenic
909914528 1:81300846-81300868 AGAATCCTTTTGAAAAACTTTGG - Intergenic
912894136 1:113567947-113567969 AAAAAGAATTTGAACAACATGGG + Intronic
913707831 1:121445198-121445220 AGAAGGAATATAAACAAATTGGG - Intergenic
916267073 1:162901247-162901269 ACTATGCATTTAAACAACTTTGG + Intergenic
918762506 1:188429931-188429953 AGAAGATAATTGAATAACTTAGG + Intergenic
919477718 1:198049866-198049888 ATAAGGCATTCAAACAACTATGG - Intergenic
924502715 1:244652549-244652571 AGGAAGCATTTGGAAAACTTAGG + Intergenic
924750497 1:246883349-246883371 TGTAGGTATTTGAACAAATTAGG + Intronic
1063199103 10:3770476-3770498 AGATGGCATTCAAATAACTTGGG - Intergenic
1067366395 10:45633748-45633770 AGATGGAATTTGAACATTTTTGG - Intronic
1067924111 10:50490374-50490396 AGAAGGCATTAGAACTATGTGGG + Intronic
1068054525 10:51995180-51995202 ACAAAGCATTTTAGCAACTTTGG + Intronic
1069270891 10:66526109-66526131 AGCAGGCATTTGTACAACAATGG - Intronic
1071348467 10:84715788-84715810 AGAACGCATTTGCACAACATTGG + Intergenic
1072875417 10:99168036-99168058 AGAAAGCATTTGATAAAATTCGG - Intronic
1072913644 10:99523759-99523781 GCAAGGAATTTTAACAACTTTGG + Intergenic
1075182166 10:120221240-120221262 AGAAGCCACTTGAAAAACTGTGG - Intergenic
1077933569 11:6758869-6758891 AGTAGGAATGTGAACATCTTTGG + Intergenic
1078309322 11:10223249-10223271 AGATGACCCTTGAACAACTTGGG + Intronic
1078361483 11:10671833-10671855 AGATGGCATTCCAACAATTTAGG - Intronic
1079385970 11:19980074-19980096 AGAAGGCATTTGAACAACTTGGG + Intronic
1080631849 11:34084648-34084670 AGCTGACATTTGAACAACATGGG - Intronic
1081592325 11:44433042-44433064 AGGAGGGGTTTGTACAACTTTGG - Intergenic
1083873603 11:65507776-65507798 AGAAGACACTTAAGCAACTTAGG - Intergenic
1084455669 11:69266833-69266855 AGAAAGCATTTAATCAACGTTGG + Intergenic
1084823300 11:71709374-71709396 ATCAGGCCTTTGGACAACTTCGG - Intergenic
1087010572 11:93510328-93510350 AGAAGGAATTTGAATGGCTTTGG + Intronic
1088968403 11:114749396-114749418 ATAAGGGATTTGAACATCTGTGG - Intergenic
1090342925 11:126041351-126041373 AAAAGGCATATGACCAACTGTGG + Intronic
1093154052 12:15659018-15659040 AGATGGGATTTGAAAAAGTTTGG + Intronic
1095849515 12:46787112-46787134 AGGCAGCATTTGAACAAGTTTGG + Intronic
1096765228 12:53882172-53882194 AGTATGCATTTGAAAAACCTGGG - Intergenic
1097658581 12:62400302-62400324 ATAAGGAATTTGAACATCTGTGG - Intronic
1099317746 12:81105897-81105919 ACAGGGCTTTTGAACTACTTGGG + Intronic
1099908076 12:88795539-88795561 AGAAAACATTTAAACAATTTTGG + Intergenic
1102724582 12:115049808-115049830 AGAAGACATTTGTAAAACCTGGG - Intergenic
1104779749 12:131412510-131412532 AGAAGCCACTTGACCAACCTCGG + Intergenic
1107315775 13:39130145-39130167 TGAAGGCAGTTGAATAAGTTAGG - Intergenic
1107539181 13:41370137-41370159 AGTTGGCCTTTGAACAACATAGG + Intronic
1107703708 13:43077267-43077289 TGAAGTCATTTGCACAGCTTGGG + Intronic
1108437866 13:50418330-50418352 AGGAGTCATTTAAAGAACTTAGG + Intronic
1108441092 13:50453547-50453569 AGAAGGCACTGGAAATACTTAGG - Intronic
1108746641 13:53402140-53402162 AGACATCATTTGATCAACTTAGG - Intergenic
1108874771 13:55032365-55032387 AGAAGATATTTGAACAACTCTGG + Intergenic
1110189338 13:72713416-72713438 ATAAGGCATTTGAGCATCTGTGG - Intronic
1110848306 13:80215155-80215177 ACAAAGTATTTGAACAACATAGG + Intergenic
1110893780 13:80723518-80723540 AGCAGGCACTTTAACGACTTTGG + Intergenic
1110982275 13:81916086-81916108 AGGAGGCATTTCATCCACTTTGG - Intergenic
1111306307 13:86417320-86417342 TGATGGCATTTGTACAATTTAGG + Intergenic
1111310346 13:86475901-86475923 AGAAGGCATTTGAAACATTGAGG - Intergenic
1113159726 13:107366333-107366355 AGAAGGCATTATAATCACTTTGG + Intronic
1113526692 13:110984678-110984700 AGAAGACAAGTGAACAACCTGGG - Intergenic
1114357856 14:21933146-21933168 ACCAGGCATTAGAACATCTTTGG - Intergenic
1117125994 14:52626419-52626441 AAAAGGCATTTGACTAAATTTGG + Intronic
1117490088 14:56238109-56238131 GGTAGGCTTTTAAACAACTTAGG - Intronic
1118070301 14:62239396-62239418 AGAAGAAATTTGAACAGCTCAGG + Intergenic
1120235074 14:81881442-81881464 AGAAGGCATAAGAGCAACCTAGG - Intergenic
1122199922 14:100116274-100116296 AGGAGGCCTTAGAAGAACTTGGG + Intronic
1124397735 15:29319395-29319417 AGATGGCACTTGAACAACCCAGG - Intronic
1124823768 15:33073327-33073349 TGAAGCTATTTGAACTACTTTGG - Intronic
1124931685 15:34126052-34126074 ATAAAGTATTTGAACAAATTTGG + Intergenic
1125528660 15:40396188-40396210 AGAAGGAAGTTGAATAACTGAGG - Intergenic
1128995886 15:72294221-72294243 ACAAGAAACTTGAACAACTTAGG - Intronic
1131700068 15:94925610-94925632 AAAAGGCATCTAAAAAACTTAGG - Intergenic
1132020738 15:98359848-98359870 AGCATGCATTTGAACAGCATGGG - Intergenic
1132271265 15:100528011-100528033 AGAAGGCACTTGAACATTGTGGG + Intronic
1133761129 16:8798965-8798987 AAAAAGCCTTTGAAGAACTTGGG - Intronic
1135471876 16:22738393-22738415 AGAAGCCATGTCAACACCTTTGG + Intergenic
1135712317 16:24728480-24728502 AAAAGCCAGTTGAAGAACTTAGG + Intergenic
1135941052 16:26822264-26822286 AGAAGGGATTGGAAGAACTCAGG + Intergenic
1141848770 16:86629874-86629896 AGGAGGCATTTGAGCAAGGTCGG + Intergenic
1147544369 17:41389114-41389136 AGCAGGGATTTGAACAATTCAGG + Intronic
1149119785 17:53148665-53148687 AGAAGGTATTAGAACAAAGTAGG + Intergenic
1149312014 17:55403994-55404016 AGCAGGCATTTGGGCAATTTAGG + Intronic
1152007060 17:77688895-77688917 AAAAGGCATTTGAAGTTCTTAGG + Intergenic
1153533920 18:6079907-6079929 AGAGGGCAGTTGAATTACTTTGG - Intronic
1156609469 18:38709227-38709249 AAAAGGAAATTGCACAACTTCGG - Intergenic
1156850575 18:41721055-41721077 AGAAGGTATTAGAGCAATTTGGG + Intergenic
1158224066 18:55182310-55182332 TGAAGACATTTGAAAAAGTTTGG + Intergenic
1159347569 18:67226725-67226747 AGTAGGCTTTTGCCCAACTTTGG + Intergenic
1159386578 18:67733553-67733575 AAAATGCATTTAAACAATTTAGG - Intergenic
1163231694 19:16007361-16007383 AAAAGGCATTTGCTAAACTTAGG + Intergenic
1164451382 19:28368559-28368581 AGAAGGCATTTGAATAAAAATGG - Intergenic
1168344030 19:55641763-55641785 GGAAGGCATTTGAGCCATTTTGG + Exonic
925609138 2:5690225-5690247 AGAATGCATTTGAAAATCTTTGG - Intergenic
926536365 2:14118266-14118288 ATAAGGGATTTGAGCACCTTTGG + Intergenic
927568267 2:24134563-24134585 AAAAGACATTTGAACATTTTGGG + Intronic
930904391 2:56548764-56548786 AAAAGGGATTTGAAAAACTATGG + Intergenic
935526701 2:104180157-104180179 ACAAGGCATATGAAAAACTAAGG - Intergenic
936773631 2:115945469-115945491 AGAAGTCACATAAACAACTTTGG + Intergenic
939962811 2:148580763-148580785 AGAATTCCTTTGAACAATTTGGG - Intergenic
940626482 2:156181547-156181569 AACAGGCATTTGGACAACTCAGG + Intergenic
941803069 2:169682694-169682716 GAAAGGCATTTGAACAACGATGG + Intronic
942525617 2:176849725-176849747 AGATGGCTTTTGAACCACTTTGG + Intergenic
943720305 2:191197131-191197153 AAACGGCATTTGAATAACTGAGG + Intergenic
945474819 2:210268818-210268840 AGAAGGCAGTTCAGTAACTTTGG + Intergenic
946826095 2:223679505-223679527 AGCAGCCATTTGAACACTTTTGG - Intergenic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1171048045 20:21829521-21829543 AGCAGACATTTGAAAAACATTGG - Intergenic
1171114055 20:22509213-22509235 AGAAGGCAGGTGGACAACATAGG - Intergenic
1173396174 20:42682154-42682176 AGAAGGCATAAGAAAAATTTGGG + Intronic
1175430082 20:58895558-58895580 AGGAGGCATTTTAACACTTTGGG - Intronic
1178208500 21:30499566-30499588 ATAACGCATTTGAAAAACTCTGG - Intergenic
1181973331 22:26710449-26710471 AGTGGGCATTTGTCCAACTTGGG + Intergenic
1182277286 22:29198494-29198516 AGTTGGCATTTGAACAATATGGG + Intergenic
949411323 3:3767815-3767837 AAAAGGCATTTAAAAAACTAGGG - Intronic
951613770 3:24520712-24520734 AGAAGGCATTTGCTCAGCTTTGG - Intergenic
952037965 3:29226339-29226361 AGAAGGAATGTAAAGAACTTAGG + Intergenic
953168999 3:40490494-40490516 AGGAGGTCCTTGAACAACTTGGG + Intergenic
955141539 3:56274556-56274578 AGTTGGCCTTTGAACAACATGGG - Intronic
957732558 3:84158909-84158931 AATAGGCAGTTGAATAACTTAGG + Intergenic
961055270 3:123782515-123782537 AGAAGGAATCTGAACATCCTGGG + Intronic
961958991 3:130834236-130834258 AACAGACATTTGAACAAATTTGG - Intergenic
962618189 3:137149627-137149649 AGTAGGCATTTAAAGAACTGAGG - Intergenic
964116585 3:153142199-153142221 AGAAGGCATTTTCACAAAATAGG - Intergenic
965417481 3:168414885-168414907 AGAAGGCATTTGGAGCACTGTGG - Intergenic
966304909 3:178520723-178520745 AGGTGGCATTTGACCAAATTAGG - Intronic
966549650 3:181190457-181190479 GGAAGTCATTAGAACAACTTTGG - Intergenic
968384137 4:121659-121681 AGAAGGGATTTTTTCAACTTAGG + Intergenic
970273038 4:14367811-14367833 AGAAGCCATTACAACAACCTAGG - Intergenic
970376541 4:15463505-15463527 AGGAGGCAACTAAACAACTTGGG + Intergenic
971501357 4:27321573-27321595 AGAAGACAGTTGAACAACCAGGG - Intergenic
974672567 4:65051695-65051717 ACAAGGCATATCAACCACTTTGG - Intergenic
974703224 4:65478520-65478542 AGAATGCAGTGGCACAACTTTGG + Intronic
975266610 4:72376540-72376562 AGAATGCATTTGAAGCACCTGGG + Intronic
976842872 4:89452190-89452212 AGAATGGATTTGAACAAATAGGG + Intergenic
977020818 4:91756774-91756796 TGAAGTCCTTTCAACAACTTCGG - Intergenic
977802056 4:101246375-101246397 TGAAGTCATATGAACAACTATGG + Intronic
978548698 4:109900930-109900952 AATAGGCATATGAACCACTTGGG + Intergenic
979141944 4:117187490-117187512 AAAAAGCATTTGAAAAGCTTAGG + Intergenic
979323839 4:119355791-119355813 GTAAGGCATTTGAAAAACCTTGG + Intergenic
980005143 4:127533171-127533193 AGAACCCATTTGAGCAACTCCGG - Intergenic
980487708 4:133480753-133480775 AGTGGACCTTTGAACAACTTGGG - Intergenic
980510220 4:133775678-133775700 TTAAGGCATTTAAAAAACTTTGG + Intergenic
980715288 4:136619285-136619307 AGCATTCATTTGAACAACTTTGG + Intergenic
983241677 4:165240465-165240487 GTAAGGCATTTGAAAAACCTTGG + Intronic
983589277 4:169389817-169389839 AGATGACCCTTGAACAACTTGGG + Intergenic
986268916 5:6214616-6214638 ACAAGGCCTTAGAACAATTTCGG + Intergenic
986833532 5:11608806-11608828 GGAAGGCATTTGAACATTTTAGG - Intronic
987031776 5:13983003-13983025 GGCAGGCATTTGAACTACCTGGG + Intergenic
988896350 5:35678646-35678668 AGAAGGCCTCAGAACAACTTTGG - Intronic
989776347 5:45212500-45212522 AGACTGCCCTTGAACAACTTTGG + Intergenic
990453096 5:55955471-55955493 CGAAAGCATTTGAAGAATTTAGG - Intronic
991426083 5:66493363-66493385 AAAAGGCATTTGACCAAATCTGG - Intergenic
991612314 5:68462275-68462297 ATAGGCCATGTGAACAACTTTGG + Intergenic
992355958 5:75983659-75983681 AGAAGGCATGTGAACAATGGCGG + Intergenic
996557590 5:124795118-124795140 AGTTGACACTTGAACAACTTGGG + Intergenic
999086897 5:148900632-148900654 AGACTTGATTTGAACAACTTAGG + Intergenic
1000714938 5:164630359-164630381 TGAAGGTAATTGAACAACTTAGG - Intergenic
1002857288 6:1049582-1049604 AACAGTCATTTGAAGAACTTTGG - Intergenic
1004928372 6:20437596-20437618 AAAATGCATTTTACCAACTTTGG - Intronic
1005352713 6:24952151-24952173 AGAAGGAAATAGAACAACTGAGG + Intronic
1005709352 6:28488847-28488869 AGGATGCAGTTAAACAACTTGGG + Intergenic
1008775942 6:55038294-55038316 TGAAGGACTTTGAACATCTTTGG - Intergenic
1009352022 6:62692060-62692082 AAAAGATATTTGAACATCTTAGG + Intergenic
1009778552 6:68238156-68238178 ATAAGGCATTTGACTAATTTGGG - Intergenic
1010701604 6:79055633-79055655 GGAAGGCAGGTGAACCACTTTGG + Intronic
1011226360 6:85111771-85111793 AGAAGGCTTTTGGACAAAATAGG - Intergenic
1011952388 6:92982915-92982937 AGAAGGCCTTTGATAAACTATGG + Intergenic
1013375300 6:109508919-109508941 TGAAGGCTTTTGGACAACTCAGG + Intronic
1014436758 6:121429063-121429085 GAAAGGCATTTTAACGACTTTGG + Intergenic
1015329250 6:131958005-131958027 AGAAGGCATATAAACACCTGTGG + Intergenic
1016647574 6:146427504-146427526 AGCAGACATTTGAACAAATTGGG - Intronic
1018001569 6:159583163-159583185 AGAACGCCTGTGAAAAACTTTGG + Intergenic
1018715087 6:166525876-166525898 AGGAGATACTTGAACAACTTGGG + Intronic
1019852729 7:3575499-3575521 AGAATGCATTTTAACATTTTCGG + Intronic
1020100400 7:5391129-5391151 AGAAGGCAGGTGACCAGCTTGGG - Intronic
1023499790 7:40835396-40835418 AGAAGAAATTTGAAGAATTTGGG - Intronic
1023580092 7:41672444-41672466 AGAAGGCTTTTGAACAACAGAGG - Intergenic
1024452996 7:49570144-49570166 AGAAGGCATATGAAGAAATGGGG + Intergenic
1024785907 7:52907562-52907584 AGAAGGCATTTGATAGAGTTTGG - Intergenic
1026086232 7:67265489-67265511 AAAAGGCATTTTAAAAACTCTGG - Intergenic
1026690920 7:72549331-72549353 AAAAGGCATTTTAAAAACTCTGG + Intergenic
1028050941 7:86185374-86185396 AGAAGCCATGTGAACATCTGGGG - Intergenic
1028616449 7:92773304-92773326 AGACGGCACTTGAAAAATTTAGG + Intronic
1029117474 7:98244730-98244752 GGAAGGCATTTGAAGAGCTGGGG + Intronic
1030292030 7:107882472-107882494 AGAAAGGATTTGAACAAGTTGGG - Intergenic
1030311163 7:108070811-108070833 AGATGACTTTTGAACAATTTGGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032757247 7:134902688-134902710 AGAAGGCATCTGAAAAAGTCAGG + Intronic
1033469449 7:141631797-141631819 TGAAGGCCTTTGAATGACTTTGG - Intronic
1036483349 8:9156872-9156894 ACAATGACTTTGAACAACTTGGG - Intronic
1040141094 8:43914710-43914732 AGCAGGCATTTGGACCGCTTTGG + Intergenic
1040743674 8:50613193-50613215 AGAATGCATATGAAAGACTTGGG + Intronic
1041430926 8:57779877-57779899 AGGCTGCATTTGAACATCTTGGG + Intergenic
1041668602 8:60469874-60469896 AGATAGCACATGAACAACTTGGG + Intergenic
1042068083 8:64900867-64900889 AGAAGTCACTAGAACTACTTAGG + Intergenic
1042168783 8:65972858-65972880 TGAAGGCATTTGGAGATCTTTGG + Intergenic
1042296781 8:67227945-67227967 ATAAGGTATTTGAATAACTATGG - Exonic
1042736775 8:71998577-71998599 ATAATGCATTTGGAGAACTTGGG + Intronic
1043157525 8:76802720-76802742 AGAAGGCTTTTGCAGTACTTTGG + Intronic
1046837839 8:118822609-118822631 AGTTGGCACTTGAACAACATAGG - Intergenic
1048571586 8:135661293-135661315 TGAAGGCATTTGAAGATCTTGGG - Intergenic
1048667815 8:136683762-136683784 AGAAGGCATTTGACCAGACTGGG + Intergenic
1049837044 8:144742952-144742974 AGTTGGCCTTTGAACAACATGGG - Intronic
1051580729 9:18670895-18670917 GGAAGGCATTTGAGCATCTGTGG - Intronic
1051816524 9:21113591-21113613 TGAAGGCATATAAAGAACTTTGG + Intergenic
1055893828 9:81152595-81152617 AGAAGCAATCTGAAGAACTTTGG + Intergenic
1057436536 9:95045481-95045503 AGAAGGCTTTAGAAAAACTCAGG - Intronic
1057462106 9:95272370-95272392 AGAAAGTATTTGGACATCTTAGG + Intronic
1058009687 9:99963253-99963275 AGAGGGCACTTGAACAACAAAGG - Intronic
1059165848 9:112075851-112075873 AGCAGGCACCTGAACAACTATGG + Intronic
1060132405 9:121116580-121116602 AGATGGCTTATGAACAATTTAGG - Intronic
1186080436 X:5925076-5925098 AGAAGGCAGTGAAAGAACTTGGG - Intronic
1186142460 X:6590389-6590411 AGGAGCCATTTGAAGAACCTGGG - Intergenic
1186197523 X:7124633-7124655 AGAAGGCATTTAAGAAACTTTGG + Intronic
1186241988 X:7578590-7578612 AGAAGGAATTTGGACATGTTAGG + Intergenic
1188902067 X:35746041-35746063 AGTTGGCCTTTGAACAACATAGG + Intergenic
1190801074 X:53789527-53789549 AGAATGCATTTGAAAATCTCTGG + Intergenic
1193947220 X:87753759-87753781 AGCAGGGATCTGAACCACTTGGG - Intergenic
1194877411 X:99207334-99207356 GGAAGGCTTTTGAAGAACTTGGG + Intergenic
1197024312 X:121728964-121728986 AGGAGGCTTTTGAAGATCTTGGG + Intergenic
1199370222 X:147039111-147039133 AGATGGCATTGTAACAAGTTTGG - Intergenic
1199481836 X:148306290-148306312 AGTTGACACTTGAACAACTTAGG - Intergenic
1200878181 Y:8181571-8181593 AGATGGTAAGTGAACAACTTTGG - Intergenic