ID: 1079388102

View in Genome Browser
Species Human (GRCh38)
Location 11:19998529-19998551
Sequence CTCCTTGCCGTGGCCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 520}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079388094_1079388102 17 Left 1079388094 11:19998489-19998511 CCCTTAGTGCCTTTCCATTGCAC 0: 1
1: 0
2: 7
3: 39
4: 305
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520
1079388091_1079388102 28 Left 1079388091 11:19998478-19998500 CCTGAAACCCTCCCTTAGTGCCT 0: 1
1: 0
2: 0
3: 14
4: 197
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520
1079388098_1079388102 3 Left 1079388098 11:19998503-19998525 CCATTGCACCTAGAATAAAGGTC 0: 1
1: 0
2: 2
3: 44
4: 514
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520
1079388093_1079388102 20 Left 1079388093 11:19998486-19998508 CCTCCCTTAGTGCCTTTCCATTG 0: 1
1: 2
2: 0
3: 14
4: 195
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520
1079388096_1079388102 8 Left 1079388096 11:19998498-19998520 CCTTTCCATTGCACCTAGAATAA 0: 1
1: 2
2: 5
3: 32
4: 182
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520
1079388095_1079388102 16 Left 1079388095 11:19998490-19998512 CCTTAGTGCCTTTCCATTGCACC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520
1079388092_1079388102 21 Left 1079388092 11:19998485-19998507 CCCTCCCTTAGTGCCTTTCCATT 0: 1
1: 0
2: 1
3: 29
4: 361
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520
1079388099_1079388102 -5 Left 1079388099 11:19998511-19998533 CCTAGAATAAAGGTCAGACTCCT 0: 1
1: 0
2: 7
3: 24
4: 269
Right 1079388102 11:19998529-19998551 CTCCTTGCCGTGGCCTCCAAGGG 0: 1
1: 0
2: 2
3: 44
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079388102 Original CRISPR CTCCTTGCCGTGGCCTCCAA GGG Intronic