ID: 1079388177

View in Genome Browser
Species Human (GRCh38)
Location 11:19999094-19999116
Sequence GGTGCCAACCAACCAGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079388175_1079388177 -10 Left 1079388175 11:19999081-19999103 CCAGTGTGCTTCTGGTGCCAACC 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1079388177 11:19999094-19999116 GGTGCCAACCAACCAGAATAGGG 0: 1
1: 0
2: 1
3: 2
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079388177 Original CRISPR GGTGCCAACCAACCAGAATA GGG Intronic
901199981 1:7461228-7461250 GGTGCCAACCTTCAAGCATACGG + Intronic
901412577 1:9094787-9094809 GGTGCCACACAAAAAGAATAAGG - Intergenic
902970558 1:20045066-20045088 GGTTCCAAATAACCAGAAAATGG - Intronic
906455867 1:45996468-45996490 GGTGCCCACTAGCCAGAAGATGG + Intronic
910104804 1:83620218-83620240 GATGCAAACCAATCAAAATAGGG - Intergenic
912636487 1:111299096-111299118 AGAGCCTACCAACCAGAAAAAGG + Intronic
912686757 1:111774128-111774150 GGTGGCACCTAACCAGAATGTGG - Intronic
913590093 1:120316179-120316201 AGGGGCAACTAACCAGAATAGGG - Intergenic
913618092 1:120582185-120582207 AGGGGCAACTAACCAGAATAGGG + Intergenic
914572122 1:148928038-148928060 AGGGGCAACTAACCAGAATAGGG - Intronic
914600716 1:149202227-149202249 AGGGGCAACTAACCAGAATAGGG + Intergenic
923016642 1:230131570-230131592 GGTGCCAAGCAAGGAGAATTGGG - Intronic
923868384 1:237964278-237964300 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
924720436 1:246617778-246617800 AATTCCAAGCAACCAGAATATGG + Intronic
924796278 1:247294749-247294771 GATGCCAAGCAAGGAGAATAAGG + Intergenic
1065220358 10:23490458-23490480 GGTGCCAACCAAACAGAACAAGG + Intergenic
1066112167 10:32207124-32207146 GGTGCCAGCAGACCAGGATATGG - Intergenic
1072281756 10:93871874-93871896 GGTGCCAAGCAAGGAGAATTGGG - Intergenic
1074868117 10:117556623-117556645 GGTGCCTTCCACCCAGAAGAAGG - Intergenic
1079388177 11:19999094-19999116 GGTGCCAACCAACCAGAATAGGG + Intronic
1080231228 11:30018698-30018720 GGCGCCAACCAACCAGCCCAAGG - Intergenic
1080352662 11:31403306-31403328 GGTGCCAAGCAAGGAGAATTGGG + Intronic
1087126908 11:94637419-94637441 ACTGCGAACCAAACAGAATATGG - Intergenic
1094400537 12:30057366-30057388 GGTTCCAAACAGCCAGAAAATGG + Intergenic
1097432959 12:59530730-59530752 GGTGTACACCCACCAGAATATGG - Intergenic
1098048558 12:66428029-66428051 GGTGCCAAGCAAGGAGAATTGGG - Intronic
1103298272 12:119906787-119906809 GGTGCCAAGCAAGGAGAATTGGG - Intergenic
1103408761 12:120695477-120695499 GATGTCAAACAAACAGAATAAGG - Intronic
1109343454 13:61089730-61089752 GGTTCCAAATAACCAGAAAACGG + Intergenic
1113287888 13:108873651-108873673 CATGCCAACCAACCAGGACAGGG + Intronic
1113287901 13:108873700-108873722 CATGCCAACCAACCAGGACAGGG + Intronic
1113287924 13:108873774-108873796 CATGCCAACCAACCAGGACAGGG + Intronic
1113287931 13:108873799-108873821 CATGCCAACCAACCAGGACAGGG + Intronic
1113991796 14:16033763-16033785 GGTTCCAGACAACCACAATAAGG - Intergenic
1116233062 14:42242386-42242408 GGAGCCATCCTAGCAGAATAAGG + Intergenic
1116976082 14:51117505-51117527 TGTGCCAAGCATCCAGAATGTGG + Intergenic
1119295849 14:73532559-73532581 GCTGCTGACCAACCTGAATATGG + Intronic
1119299488 14:73560269-73560291 GCTGCTGACCAACCTGAATATGG + Intergenic
1126504767 15:49391890-49391912 GGTGCCAAGCAAGGAGAATTGGG - Intronic
1126790136 15:52213363-52213385 CGTGCAAACCAGCCAGAATGGGG - Intronic
1129340742 15:74884750-74884772 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
1129925835 15:79363864-79363886 GGTGCCAAGCAAGGAGAATCGGG + Intronic
1130991505 15:88878485-88878507 GGTGCCCACCCACCTAAATAGGG - Intronic
1135672948 16:24390558-24390580 GGTGCCAAGCAAGGAGAATCGGG - Intergenic
1136911112 16:34145330-34145352 GGTTCCAGACAACCACAATAAGG - Intergenic
1144061786 17:11589480-11589502 GGTGCCAAGCAAGCAGAACCAGG - Intergenic
1144690477 17:17259156-17259178 CGAGCCAAGGAACCAGAATAGGG - Intronic
1147317924 17:39629632-39629654 AGTGACAACCAACCAGTATGGGG + Intronic
1149537900 17:57446520-57446542 GGTGCCAAGCACGTAGAATAGGG + Intronic
1152021970 17:77784551-77784573 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
1155395017 18:25377895-25377917 GCTCCCAACCAATGAGAATAGGG - Intergenic
1155598660 18:27517478-27517500 GGTGCCAAGCAAGGAAAATAGGG - Intergenic
1156537938 18:37881754-37881776 GATGGCACCCAACCAGATTAAGG - Intergenic
1156716697 18:40020983-40021005 GGTGCCAACCAAGCAGGACCAGG - Intergenic
1163821989 19:19501239-19501261 CATGACAACCAACCAGAAGAAGG + Exonic
925041328 2:733557-733579 GCTGCCAACCATCCAGAGAAGGG - Intergenic
925848208 2:8052673-8052695 GGTTCCAACCCACCACAAAAGGG - Intergenic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
931962512 2:67497974-67497996 TTTGCCAACCAACCTGAATTTGG + Intergenic
946888430 2:224248124-224248146 GAAGCCAACCTAGCAGAATAGGG + Intergenic
947990975 2:234487345-234487367 GGTGCCATCCAAGCAAAATCAGG + Intergenic
1170718875 20:18857616-18857638 GGTTCCATCCAACCAGTAAAAGG - Intergenic
1171770078 20:29316025-29316047 GGTTCCAGACAACCACAATAAGG + Intergenic
1171906457 20:30903606-30903628 GGTTCCAGACAACCACAATAAGG - Intergenic
1176841452 21:13846397-13846419 GGTGCCACCCAGCCAGCATTTGG - Intergenic
1176876094 21:14130689-14130711 GCTGCCAACCAGCCAGAGGAGGG + Intronic
1180315476 22:11273764-11273786 GGTTCCAGACAACCACAATAAGG + Intergenic
1180339870 22:11609727-11609749 GGTTCCAGACAACCACAATAAGG - Intergenic
1184938195 22:47740234-47740256 GGTTCCACACAGCCAGAATAGGG - Intergenic
949864223 3:8533921-8533943 GGTCCCTAGCAACCAGAAGACGG - Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
954972697 3:54664423-54664445 GCTGCCAAGCAGCCAAAATAGGG - Intronic
956520126 3:70094795-70094817 GGTGCCAACCAAGGAGAATCAGG + Intergenic
956587485 3:70879719-70879741 GGTGCCAACCATACAGAGGAAGG - Intergenic
957985563 3:87570731-87570753 GGTTCCAAATAACCAGAAAATGG + Intergenic
962015890 3:131440566-131440588 GGTGCCAAGCAAGGAGAATCAGG + Intergenic
962669366 3:137689555-137689577 TGAGCCATCCAGCCAGAATAAGG + Intergenic
962720814 3:138173519-138173541 GGTGCCACCCAGCCACCATAGGG + Exonic
962863428 3:139425683-139425705 GCTTCCCACCTACCAGAATAGGG + Intergenic
962890869 3:139671963-139671985 GATGCAAACCAACCCGAATTTGG - Intronic
963319602 3:143798653-143798675 GGTTCCAAACAGCCAGAAAACGG + Intronic
965105357 3:164346460-164346482 GGTTCCAAATAACCAGAAAACGG - Intergenic
967834674 3:193950888-193950910 GGTGCCAACCAGAGAAAATATGG + Intergenic
969571296 4:8010184-8010206 GGTGACAACCCCCCAGAAAAAGG - Intronic
970854173 4:20634579-20634601 GGTTCCAAACAGCCAGAAAATGG - Intergenic
971809286 4:31403031-31403053 GTTGCCAGGCAAGCAGAATAAGG - Intergenic
976428908 4:84939338-84939360 GGTGCGATCCAACAACAATATGG - Intronic
977684084 4:99827696-99827718 TGTGCCCAGCAGCCAGAATAAGG + Intronic
982964693 4:161890205-161890227 GGTGCCAACCAAGCAAATTATGG - Intronic
985763620 5:1764923-1764945 TGTGCCAACCAGCCAGCACAGGG - Intergenic
992945184 5:81802825-81802847 GATGCCAACCACCCACATTATGG + Intergenic
999896173 5:156036243-156036265 GGTGCCAAGCAAGGAGAATCAGG + Intronic
1000879789 5:166683957-166683979 GTTACCAAACAACCAGAAAAGGG - Intergenic
1001292037 5:170470530-170470552 GGCGCCAAGCAAGCAGAATTGGG + Intronic
1004225112 6:13777920-13777942 GGTGCCAAGCAAGGAGAATCAGG - Intergenic
1006732212 6:36244879-36244901 GGTGCCAAGCAAGGAGAATCGGG + Intronic
1015801504 6:137065662-137065684 GGTTCCAAACAGCCAGAAAATGG - Intergenic
1016553499 6:145309230-145309252 GGTGCCAAGCAAGGAGAATCGGG - Intergenic
1018364407 6:163103278-163103300 GCTGCCAACCAGCCAGGAAATGG - Intronic
1028077917 7:86537485-86537507 GGTGCCAAGCAAAGAGAATCGGG + Intergenic
1038200029 8:25403414-25403436 GGCACCAACCAATCAGAATGGGG + Intronic
1039142823 8:34412310-34412332 GGTGCCAACTGACCAGGATCAGG - Intergenic
1040973117 8:53159081-53159103 GGTGCCAAGAAAACAGAATGGGG - Intergenic
1041453122 8:58028589-58028611 AGTGCCAAACAACCATATTAAGG - Intronic
1042916946 8:73884768-73884790 GGTGCCAACCATTCAGAACGAGG + Intergenic
1043837599 8:85064345-85064367 GGTTCCAAACAGCCAGAAAATGG + Intergenic
1046830099 8:118735869-118735891 GGCCCCATCCAACCAGGATAGGG - Intergenic
1047260084 8:123248491-123248513 GGTCACAATCAACCAGAAGAGGG + Exonic
1050624762 9:7491110-7491132 GGTCCCCAACAACCAGAAGAAGG + Intergenic
1056540720 9:87568652-87568674 GGTGACAACCCACTAGGATATGG + Intronic
1058009848 9:99964931-99964953 GTTGCAAACCAAGCAAAATACGG + Intronic
1058479846 9:105380841-105380863 GGATCCAACCAACCAGACTCTGG + Intronic
1060448878 9:123718324-123718346 GTTGCCAAGCAACCAAAAGAAGG + Intronic
1060767190 9:126303941-126303963 GGTGCCAAGCAAGGAGAATTGGG - Intergenic
1185931797 X:4211763-4211785 GGTGACGTCCAAACAGAATACGG + Intergenic
1193156071 X:78175756-78175778 GCTGCCCACCACCCAGATTAAGG + Intergenic
1196314820 X:114210359-114210381 GGTGCCAAGCAAAGAGAATTGGG - Intergenic
1197947424 X:131854748-131854770 TCTGCCAACCAAACAGAAGAGGG + Intergenic
1199453873 X:148005411-148005433 GGTGTCAAACACCCAGAAAATGG - Intronic