ID: 1079388346

View in Genome Browser
Species Human (GRCh38)
Location 11:20000224-20000246
Sequence CCACCGTGTAACAACATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079388341_1079388346 22 Left 1079388341 11:20000179-20000201 CCACATCCTGGCAGGAGGTCTCA 0: 1
1: 0
2: 7
3: 15
4: 265
Right 1079388346 11:20000224-20000246 CCACCGTGTAACAACATCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1079388342_1079388346 16 Left 1079388342 11:20000185-20000207 CCTGGCAGGAGGTCTCAATCTTT 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1079388346 11:20000224-20000246 CCACCGTGTAACAACATCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079388346 Original CRISPR CCACCGTGTAACAACATCAG AGG Intronic
901174301 1:7287503-7287525 ACAACGTGTAAAAATATCAGTGG - Intronic
912114535 1:106388865-106388887 CCACCTTTTAAAAACCTCAGTGG + Intergenic
919405943 1:197184035-197184057 CTACCTTGTAGAAACATCAGAGG - Intronic
919769970 1:201151797-201151819 CCACCTTATAGAAACATCAGTGG - Exonic
1075410413 10:122223793-122223815 CCACTGTGAAAAAGCATCAGTGG - Intronic
1076428212 10:130382263-130382285 CCACCCTGCCACAGCATCAGAGG + Intergenic
1079326604 11:19498220-19498242 CCCACGTGTAATAAGATCAGGGG - Intronic
1079388346 11:20000224-20000246 CCACCGTGTAACAACATCAGAGG + Intronic
1079521407 11:21331447-21331469 CCTCTGAGGAACAACATCAGAGG - Intronic
1094222675 12:28011088-28011110 CCACTCTGTAACAGCATCGGGGG + Intergenic
1110226204 13:73122273-73122295 CCACCTTGTCACCACCTCAGGGG - Intergenic
1112450124 13:99500679-99500701 ACACCGTCTCACATCATCAGTGG + Intergenic
1142600584 17:1051678-1051700 GCAGCGTGAAACAACGTCAGAGG + Intronic
1149335426 17:55630572-55630594 CCACCCAGTCACAGCATCAGTGG + Intergenic
1152361917 17:79836793-79836815 CCACCCTGTAACCATGTCAGCGG - Intronic
1160049151 18:75415461-75415483 CCGACGTGTGACAACATCTGCGG + Intronic
1160742551 19:694117-694139 CCACCGTGTCCCAACGTGAGGGG + Intronic
1164708351 19:30336775-30336797 CCACCTTAAAATAACATCAGGGG - Intronic
929655366 2:43725763-43725785 CCACAGTGTAACAAAAGTAGTGG - Intronic
935135355 2:100295694-100295716 CCAGCCTGTAACAAGAGCAGGGG + Intronic
938162074 2:128994978-128995000 CCATCCTGTAACAACATAACAGG + Intergenic
939888198 2:147704519-147704541 GCACAGTGTAACAAAAGCAGGGG - Intergenic
940512271 2:154631764-154631786 CCTTCCTGTAACAGCATCAGTGG + Intergenic
1178767776 21:35470738-35470760 CCACCTTGTGACAAGTTCAGTGG - Intronic
1185122731 22:48982202-48982224 CCTCCCTGTGAGAACATCAGGGG - Intergenic
954295236 3:49670813-49670835 CCACAGTGAAAGAACAGCAGTGG + Exonic
955640156 3:61073853-61073875 CCACAGTTTATCAACATCACTGG + Intronic
959926870 3:111931987-111932009 CCACCATGTTACAAAAGCAGGGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
968460258 4:721210-721232 CCACCGTGGAACAGCCTCACTGG - Intronic
969584328 4:8083374-8083396 CCACCTGGCAACAACAGCAGTGG - Intronic
971539005 4:27791801-27791823 CCTCTGTGTAACCACAACAGGGG + Intergenic
972864741 4:43217075-43217097 CCACATTTTAACAAAATCAGGGG - Intergenic
998081497 5:139278816-139278838 CAACAGTGTAACACCATCACAGG - Intronic
999716089 5:154361389-154361411 CCACCTTGTAAAATCATCAAGGG + Intronic
1003850551 6:10218140-10218162 CCACTGTGGAACAACCACAGAGG + Intergenic
1011556663 6:88576548-88576570 CCACAGTGTAATAGCATCTGTGG + Intergenic
1012676698 6:102122719-102122741 TCACCTTGTTACAACCTCAGTGG - Intergenic
1014748341 6:125226617-125226639 CCACTGTGTAAAAAAATAAGGGG - Intronic
1019857087 7:3620173-3620195 CCACCGTATCACAACCTCAGAGG - Intronic
1032514518 7:132496726-132496748 CCACCCTCTAACAACCCCAGAGG - Intronic
1032594479 7:133225720-133225742 CAACCCTGGAACAACATGAGAGG - Intergenic
1035416325 7:158691033-158691055 CCTCAGTGTAACAACACCAATGG + Intronic
1042791599 8:72613724-72613746 GCACTGTTTAACCACATCAGGGG - Intronic
1051834531 9:21320514-21320536 CCACTTTGTGACAACATCTGTGG - Intergenic
1059795282 9:117687838-117687860 CCACTAAGAAACAACATCAGAGG + Intergenic
1062285784 9:135771925-135771947 CCACCGTGTAACAACACCCCAGG - Intronic
1190481786 X:50884551-50884573 CCACCCTTCAACAACATCTGTGG + Intergenic
1190840023 X:54135171-54135193 CCACTGTGTCACAACTTCTGAGG - Intronic