ID: 1079390721

View in Genome Browser
Species Human (GRCh38)
Location 11:20019687-20019709
Sequence ATTGAGAAGCGCAGTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079390712_1079390721 20 Left 1079390712 11:20019644-20019666 CCCTGGAGTTCTGGAGAGGTGAA 0: 1
1: 0
2: 2
3: 27
4: 217
Right 1079390721 11:20019687-20019709 ATTGAGAAGCGCAGTTAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 80
1079390713_1079390721 19 Left 1079390713 11:20019645-20019667 CCTGGAGTTCTGGAGAGGTGAAG 0: 1
1: 0
2: 1
3: 23
4: 224
Right 1079390721 11:20019687-20019709 ATTGAGAAGCGCAGTTAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079390721 Original CRISPR ATTGAGAAGCGCAGTTAGGG AGG Intronic
905388733 1:37622791-37622813 CTTGAGAAGGGCAGTTTTGGTGG + Intronic
915978694 1:160407213-160407235 AGTGAGAATCTCAGGTAGGGGGG + Intronic
922950730 1:229557102-229557124 GTGGAGGAGAGCAGTTAGGGTGG - Intronic
1066490030 10:35885340-35885362 AATGAGAAACCAAGTTAGGGAGG - Intergenic
1067744366 10:48924193-48924215 AGGGAGAAGCGCAGAAAGGGTGG - Intronic
1071342058 10:84658416-84658438 GTTGAAAAGCACAGGTAGGGTGG - Intergenic
1074123044 10:110507486-110507508 ACGTAGAAGCACAGTTAGGGAGG - Intronic
1076535374 10:131173773-131173795 CTGGAGAAGGGCATTTAGGGAGG - Intronic
1079390721 11:20019687-20019709 ATTGAGAAGCGCAGTTAGGGAGG + Intronic
1081003682 11:37706388-37706410 ACTGAGAAGCGTAGTTCGTGGGG + Intergenic
1081743188 11:45455232-45455254 AATGAGAAGGGGAGTAAGGGAGG - Intergenic
1087258155 11:95980011-95980033 ATTGAAAAGTGCAGTTACAGAGG - Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1105638516 13:22239544-22239566 CTTGACCAGCCCAGTTAGGGTGG + Intergenic
1108132731 13:47320542-47320564 ATTGGGATGGGCAGTTAGGAGGG + Intergenic
1110561561 13:76915425-76915447 ACTGAGAAGCACAGTTAGAGAGG + Intergenic
1117243992 14:53865216-53865238 ATTGAGAAGAGCAGCCAGAGAGG + Intergenic
1117461837 14:55952970-55952992 AGTGAGAGGCTCATTTAGGGTGG + Intergenic
1122861190 14:104583052-104583074 AGCGTGAAGCCCAGTTAGGGAGG + Intronic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1130380082 15:83364103-83364125 ATGAAGAAGCACAGTTAGCGAGG + Intergenic
1134688466 16:16175184-16175206 ATTGAGAAGTGCCCTCAGGGTGG + Intronic
1138338059 16:56268364-56268386 ATTGAGAAGCTCTGGAAGGGAGG + Intronic
1140512640 16:75519114-75519136 TTTGAGAAGCTCAGGCAGGGAGG - Intergenic
1140671583 16:77284797-77284819 ATTGAGAAGGGCTGTCAGAGGGG + Intronic
1141953105 16:87351939-87351961 ATTCTGACGCGCAGTCAGGGTGG - Intronic
1148911672 17:50946337-50946359 TTTGAGGAGCGCATTGAGGGCGG + Intergenic
1149694022 17:58602197-58602219 ATTGAGGAGGGGAGCTAGGGAGG - Intronic
1150989420 17:70238661-70238683 AATGATAAGAGCAGTTTGGGTGG + Intergenic
1151282652 17:73088367-73088389 AGTGAGAAGCCCAGTTATTGAGG - Intronic
1152020863 17:77779635-77779657 TTAGAGGAGGGCAGTTAGGGTGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153369914 18:4303638-4303660 ATTGAGATGATGAGTTAGGGAGG - Intronic
1153582988 18:6594152-6594174 ATACAGAAGCACAGTTGGGGAGG + Intergenic
1155727463 18:29105972-29105994 AGTCAGAAGAGTAGTTAGGGAGG - Intergenic
1162742887 19:12783308-12783330 ATTCAGAGGCGGAGTTGGGGGGG - Intronic
925577444 2:5375052-5375074 AGTGAGAAGCTCAGTTGGAGAGG - Intergenic
926550167 2:14291828-14291850 ATTGAGATGGGCAGTGGGGGAGG + Intergenic
927447994 2:23182522-23182544 ATTTAGAAGTGCAGCTATGGTGG - Intergenic
928651534 2:33409176-33409198 ATTGAGAAGAGCATTTAGCAAGG - Intergenic
929214859 2:39401484-39401506 ATTTCGAAGCTCAGTTAGGTGGG - Intronic
933071749 2:77866886-77866908 TTTGAGAAGCTCAGTTAGCCAGG + Intergenic
940000777 2:148964673-148964695 TGTGAGAAGCGCAGTTAGCCAGG + Intronic
942437804 2:176000060-176000082 ATTGAAAAGCACATTTAGGTCGG - Intronic
944779193 2:203000251-203000273 ATTGAGATGAGCAGGTACGGTGG + Intronic
1170121664 20:12919088-12919110 TTTGAGAAGGGGAGTTAGGTGGG + Intergenic
1175146758 20:56902537-56902559 AGGGAGAAGAGCAGCTAGGGAGG + Intergenic
1184943901 22:47787557-47787579 ATGGAGAACCGCTGCTAGGGTGG + Intergenic
957110906 3:75955832-75955854 AGTGAGAAGCACAGTCTGGGTGG - Intronic
960553224 3:119000144-119000166 ATTGAGAAGAGCAGCCAGAGAGG - Intronic
963296668 3:143554401-143554423 AGTGAGAGGTGCACTTAGGGTGG - Intronic
967364344 3:188669099-188669121 ATTGAGAAGGGAAGTGAGTGGGG + Intronic
968792993 4:2681414-2681436 ATTAAGATGTGAAGTTAGGGAGG + Intronic
968814499 4:2814989-2815011 ACTGAGAAGCACAGCCAGGGAGG + Intronic
975760921 4:77618867-77618889 ATTGAAGAGGGCAGTGAGGGCGG + Intergenic
977557758 4:98502133-98502155 ATTGGGAAGAGCAGGTTGGGAGG + Intronic
977643545 4:99385243-99385265 ATTGAGAAGCACAGTTTTTGAGG + Intergenic
978657597 4:111083273-111083295 ATGGAGAAGCGTAGAGAGGGAGG + Intergenic
979262983 4:118669421-118669443 ATTGTGAAGCACAGTTAGAGCGG + Intergenic
981453239 4:144923490-144923512 CTTGAGATGCAGAGTTAGGGAGG - Intergenic
984862807 4:184255310-184255332 ATTGAGAACCGCAGTTGGTCAGG - Intergenic
991442903 5:66669765-66669787 AGTGAGAAGTACAGTGAGGGTGG + Intronic
993135611 5:83957811-83957833 AATGAGAAGCTCAGTAAAGGTGG - Intronic
994368168 5:98939597-98939619 CATGGGAAGAGCAGTTAGGGTGG + Intergenic
997523581 5:134538640-134538662 ACTGAGAAGCGCACTGGGGGTGG + Intronic
1000684174 5:164226385-164226407 CTTGAGAAATGCAGTTAAGGAGG - Intergenic
1004114265 6:12750436-12750458 AATGAGAAGGGAAGATAGGGAGG + Intronic
1008436216 6:51479431-51479453 ATTGAGAAACCCAGTTTGGCTGG + Intergenic
1009504678 6:64461440-64461462 ATGGAGATGAGCAGTCAGGGAGG + Intronic
1010269106 6:73901147-73901169 ATTGAGAAGCAAAGCTAGGCTGG - Intergenic
1033890777 7:146010766-146010788 GTTCAGAAGAGCAGTTTGGGAGG - Intergenic
1036654749 8:10670979-10671001 ATTTAGAAGTGCATTTAGGGAGG + Intronic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1040639352 8:49314593-49314615 ATTAAGAAGCTTAGTTAGGTAGG - Intergenic
1046027615 8:108744487-108744509 ATGAAGAAGGGCAGGTAGGGTGG + Intronic
1048028459 8:130608473-130608495 ATTGGGGAGTGAAGTTAGGGTGG + Intergenic
1048425470 8:134319359-134319381 ATTGAGATGGGCTGGTAGGGTGG - Intergenic
1055352161 9:75400527-75400549 AATGAGAAGTGGGGTTAGGGGGG + Intergenic
1057142866 9:92738152-92738174 ATTGACAGGCACAGTGAGGGCGG - Intronic
1059983267 9:119796573-119796595 ATTGAGAAACCCAGTTTGGCTGG + Intergenic
1188436371 X:30163857-30163879 ATGGAGAAGAGAAGGTAGGGTGG + Intergenic
1195545254 X:106106283-106106305 ATGGAGAACCTCTGTTAGGGTGG + Intergenic
1198425996 X:136520737-136520759 ATTGATCAACGCAATTAGGGAGG + Intergenic
1199488162 X:148370736-148370758 ATTTACAAGCTCAGTTACGGGGG - Intergenic