ID: 1079391424

View in Genome Browser
Species Human (GRCh38)
Location 11:20025124-20025146
Sequence GTGACCTGCCCAAGGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 11, 3: 106, 4: 544}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079391424_1079391429 18 Left 1079391424 11:20025124-20025146 CCCTGGCACCTTGGGCAGGTCAC 0: 1
1: 0
2: 11
3: 106
4: 544
Right 1079391429 11:20025165-20025187 AGTTTCCACATCTATCCAAAGGG 0: 1
1: 0
2: 9
3: 126
4: 1316
1079391424_1079391431 20 Left 1079391424 11:20025124-20025146 CCCTGGCACCTTGGGCAGGTCAC 0: 1
1: 0
2: 11
3: 106
4: 544
Right 1079391431 11:20025167-20025189 TTTCCACATCTATCCAAAGGGGG 0: 1
1: 0
2: 2
3: 30
4: 369
1079391424_1079391430 19 Left 1079391424 11:20025124-20025146 CCCTGGCACCTTGGGCAGGTCAC 0: 1
1: 0
2: 11
3: 106
4: 544
Right 1079391430 11:20025166-20025188 GTTTCCACATCTATCCAAAGGGG 0: 1
1: 0
2: 6
3: 81
4: 856
1079391424_1079391428 17 Left 1079391424 11:20025124-20025146 CCCTGGCACCTTGGGCAGGTCAC 0: 1
1: 0
2: 11
3: 106
4: 544
Right 1079391428 11:20025164-20025186 CAGTTTCCACATCTATCCAAAGG 0: 1
1: 4
2: 65
3: 858
4: 4362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079391424 Original CRISPR GTGACCTGCCCAAGGTGCCA GGG (reversed) Intronic
900032930 1:384364-384386 GTCATCTTCCCAAGGTGTCAGGG - Intergenic
900053771 1:614254-614276 GTCATCTTCCCAAGGTGTCAGGG - Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901104145 1:6742256-6742278 ATGACCTGCCCAAGGGCACATGG + Intergenic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
901152368 1:7112467-7112489 ATGAGCTGCCCAAGGTTCCATGG + Intronic
901526188 1:9824426-9824448 GCGACCTGCCCGAAGTGACAAGG - Exonic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
902732320 1:18377534-18377556 ATGACCTGCCTGAGGTGTCAGGG - Intronic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
902820507 1:18940339-18940361 GTGACTTGCCCAAAGTTGCACGG - Intronic
903010131 1:20323985-20324007 GTCACCTGCCCAAGGTCACATGG + Intronic
903049436 1:20589724-20589746 ATGACTTGCCCAAGGTCACACGG + Intronic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903268467 1:22172960-22172982 GTGACTTGGCCAAGGTTTCATGG + Intergenic
903284199 1:22266997-22267019 GTGACTTGCCCAAGGCCACAAGG + Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903378452 1:22880910-22880932 GTGAGCTGCCTGAGGTGCCGAGG - Intronic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903652930 1:24932235-24932257 GGGCCCTGCGCCAGGTGCCAGGG - Intronic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
903885624 1:26539475-26539497 ATGACTTGCCCAAGGTTACAAGG - Intronic
903925913 1:26830321-26830343 GTAATCTGCCCAAGGTCACATGG - Intronic
904046817 1:27614239-27614261 GTGACTTGCCCAAGGCCACATGG + Intronic
904172292 1:28599776-28599798 GTGACCTGTCCAAGGTCACTAGG - Intronic
904208401 1:28869952-28869974 ATGACATGCCCAAGGTCACAAGG - Intergenic
904442935 1:30543470-30543492 GTGACATGGCCATGGTGGCAGGG + Intergenic
904478054 1:30777227-30777249 GTGACTTGCTCAAGGTGGCCTGG - Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904803573 1:33115124-33115146 GTGACCTGCCCAAGGCTCTAGGG - Intronic
905536868 1:38729145-38729167 ATGACCTGTCCAGGGTGCTACGG - Intergenic
905690626 1:39940260-39940282 GTGACCTGCCTAAAGTCACATGG + Intergenic
905788909 1:40779803-40779825 GTGACTTGCCCAAGGTCCCCAGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905894264 1:41534933-41534955 GTGACTTGCCCAAGGTCACCTGG - Intronic
906216716 1:44045368-44045390 GTGTGCTGTCCAAAGTGCCAGGG - Intergenic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906776272 1:48532523-48532545 GTGACCTGGCCAAGGAAACATGG + Intergenic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907458900 1:54593738-54593760 GTGACTTGCCCAAGGTTTCCCGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907718940 1:56953717-56953739 GTGCCTTGCCCGAGGTGCCCTGG + Intronic
907775924 1:57514792-57514814 GTTCCTTGCCCAAGGTGACAGGG - Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912722013 1:112028359-112028381 GTGGCCTGACCAAGGGGCCCAGG + Intergenic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913233431 1:116760962-116760984 CTGACTTGCCCAAGGTCCCTTGG + Intronic
913961456 1:143340671-143340693 GTGACCTGCCCTGGGTGACACGG + Intergenic
914055809 1:144166244-144166266 GTGACCTGCCCTGGGTGACACGG + Intergenic
914123337 1:144800118-144800140 GTGACCTGCCCTGGGTGACACGG - Intergenic
915146589 1:153799302-153799324 ATGACCTGCCCAAAGTCCCATGG - Intergenic
915548352 1:156616665-156616687 GTGTCCTGTCCAAGGAGACAGGG + Intergenic
915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG + Exonic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917497833 1:175557495-175557517 GTGAACTGTCCAAGGTGCTGGGG - Intronic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
917922766 1:179764782-179764804 GTGATTTGCCCCAGGTGACAGGG - Intronic
918970377 1:191407680-191407702 GTGACCTACACAAGGCACCATGG + Intergenic
919777672 1:201204944-201204966 GTGACCTGTCCAAGGTAACATGG + Intronic
919954205 1:202396302-202396324 GTAACATGCCCAAGGTCACATGG - Intronic
921167976 1:212520826-212520848 ATGACTTGCCCAAGGTCACAAGG + Intergenic
921172406 1:212560976-212560998 GTGGCCTGCCCGGGGTCCCATGG + Intergenic
921396001 1:214670274-214670296 GTGAACTGCCCAAGGAGTCAGGG - Intergenic
922235689 1:223720977-223720999 GTCACCTGCCCAAGTTCCCTGGG - Intronic
923905247 1:238377176-238377198 AGGACCTGCTCAAAGTGCCAGGG - Intergenic
924181718 1:241445754-241445776 GTCACAGGCCCAAAGTGCCATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1066442897 10:35455518-35455540 GTCACTTGCCCCAGGTCCCAAGG - Intronic
1067029913 10:42873069-42873091 GTGACCTGCCCTGGGTGACACGG + Intergenic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1068605976 10:59005468-59005490 GTGATTTGCCCAAGGTTACAGGG + Intergenic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070525736 10:77294402-77294424 TTGACCAGGCCCAGGTGCCATGG + Intronic
1070758552 10:79008849-79008871 GTAACGTGCCCAAGGTCACAGGG + Intergenic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073321796 10:102620211-102620233 GTGGCCAGAACAAGGTGCCAAGG - Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1073511131 10:104043225-104043247 ATGACTTGCCCAAGGTCCCACGG - Intronic
1074082424 10:110178282-110178304 GTGACCTGTTCAAGGTCACATGG + Intergenic
1074116627 10:110461204-110461226 GCCACCTGCCCAAGATGCCTGGG - Intergenic
1074187848 10:111112698-111112720 GTAACTTGCCCAAGGTTACATGG + Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074841644 10:117358706-117358728 GTAACTTGCCAAAGGTGTCAAGG - Intronic
1075025017 10:118978108-118978130 GTGACCTGCTCCAGGTCCCTGGG - Intergenic
1075481995 10:122789851-122789873 GTGTCCTGGCAAATGTGCCATGG - Intergenic
1076108278 10:127841958-127841980 CTGACGTGCCCAAGGTTCCAGGG + Intergenic
1076171327 10:128322538-128322560 AGGACTTGCCCAAGGTTCCAAGG - Intergenic
1076300472 10:129421767-129421789 GTATCCTGCCCCAGTTGCCATGG + Intergenic
1076398602 10:130161275-130161297 GTGACTTGCCCAAGGTCACCTGG + Intronic
1076470461 10:130714628-130714650 GTCTCCTGCCCAAGGTTTCAGGG - Intergenic
1076979763 11:198181-198203 GTCACCTGGACAAGGAGCCAAGG - Exonic
1077093295 11:789127-789149 GTGACCTGGCCAGGGTCCCAGGG + Intronic
1077486877 11:2842934-2842956 GTGACTTGCCCAAGGTCACCCGG + Intronic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1077911708 11:6577858-6577880 GTAAACTGCCCAAGGTCACACGG + Intronic
1078774496 11:14381669-14381691 GTGACCTGCTCATGGTCACATGG - Intergenic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1080888421 11:36387706-36387728 GTGACTTGCCCAAGGCCACAGGG + Intronic
1081563688 11:44242549-44242571 GTAACTTGCCCAAGGACCCAGGG - Intronic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG + Intronic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1083302901 11:61748097-61748119 AAGACCTGCCCAAGGTCGCATGG + Intergenic
1083333371 11:61909363-61909385 GTGACCTTCCCAAGGTCCTGAGG - Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083870759 11:65487066-65487088 GTGACCTGCTGAAGGTCCCAGGG + Intergenic
1084901236 11:72311492-72311514 GTGACCTGCTTAAGGTTACAGGG + Intronic
1085174538 11:74474483-74474505 GTGACTTGGCCCAGGTCCCAGGG - Intergenic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1085393960 11:76196904-76196926 GTGATGTGCCCAAGGTCACATGG - Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085462065 11:76700230-76700252 GTGACGTGCCCAGGGTGGCTTGG + Intergenic
1085510035 11:77083493-77083515 GTGACCTGCCCAAGCTCCCCTGG - Intronic
1085642341 11:78200332-78200354 GTGACCTGCCCCAAGAGCCCAGG - Intronic
1085770107 11:79317625-79317647 GTGACCTGCTCAAGGTCATATGG + Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1088694530 11:112355509-112355531 GTGACTTGCCCAGGGCCCCAGGG + Intergenic
1089150575 11:116360636-116360658 GTGACCAGCCCAAGCTGCCAGGG - Intergenic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089270609 11:117299376-117299398 GTGATCTGCTCAAGGTGACAGGG - Intronic
1089655198 11:119942064-119942086 CTGACCTGGCCCAGGTGCCAGGG - Intergenic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1089795350 11:120975854-120975876 GTAACTTGCCCAAGGTTCCACGG - Intronic
1090159945 11:124482117-124482139 GTTACCTGCACAAAGTCCCAGGG + Intergenic
1090253396 11:125266271-125266293 GTCACTTGCCCAAGGTCACACGG + Intronic
1090329272 11:125917805-125917827 GTAACTTGCCCAAGGTTGCATGG - Intronic
1090615606 11:128511852-128511874 GTTACCCTCCCAAGGTTCCAGGG - Intronic
1090704380 11:129323205-129323227 GTAACTTGCCCAAGGTTACATGG - Intergenic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091561218 12:1615100-1615122 GAGACCCGCCCAAGGAGCAAAGG - Intronic
1091930232 12:4390042-4390064 GTGATTTGCCCAAGGTTACACGG + Intergenic
1092084131 12:5741813-5741835 GTAATCTGCCCAAGGTAACAGGG + Intronic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1092262834 12:6961705-6961727 GTCACTTGCCCAAGGTCACAGGG + Intergenic
1092745843 12:11671707-11671729 GTGACCTACTGAAGGTCCCAAGG + Intronic
1092963589 12:13619801-13619823 ATGACTTGCCCAAGCTCCCACGG + Intronic
1093143494 12:15537433-15537455 GTGTCCTGTCCCAGGAGCCAAGG + Intronic
1094069473 12:26397060-26397082 ATGACCTCCCAAAGCTGCCATGG + Intronic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1094838480 12:34333222-34333244 GGGTCCAGCCCAAGGTGGCAGGG + Intergenic
1094840093 12:34339238-34339260 GGGAGCTGCCCAAAGTGGCAGGG + Intergenic
1094843776 12:34352672-34352694 GGGTCCAGCCCAAGGTGGCAGGG - Intergenic
1094844617 12:34356001-34356023 GTGGCCAGCCCAAGGCGGCAGGG - Intergenic
1094844664 12:34356191-34356213 GGGGCCAGCCCAAGGTGGCAGGG - Intergenic
1096678232 12:53237298-53237320 ATGACCTGAACAAGGTGGCACGG + Intergenic
1098885695 12:75958730-75958752 GAAACCTGCCCAAGTTCCCATGG + Intergenic
1098901373 12:76115143-76115165 GTAAATTGCCCAAGGTTCCAGGG - Intergenic
1100351166 12:93784404-93784426 GTGAGTTGCCCAAGGTTGCACGG + Intronic
1100657186 12:96659756-96659778 GTGACCTGCCCAAGGGCCCCTGG + Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1101005349 12:100396333-100396355 GTGACCTACCCAGCCTGCCATGG + Exonic
1101604241 12:106235751-106235773 GTGACTTGCCCAAGGCCACATGG + Intergenic
1101613188 12:106310638-106310660 GTGACCTTCCCAAGGTCTCATGG + Intronic
1101836069 12:108296222-108296244 CTGACTTGCCCAAGGTCACAGGG - Intronic
1101854421 12:108430193-108430215 ATGACTTGCCCAAGGTCACACGG - Intergenic
1101864927 12:108513824-108513846 GTAACGTGCCCAAGGTGACACGG + Intergenic
1101985462 12:109442623-109442645 GTGACCTGCCCAGGATCTCACGG - Intronic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102544764 12:113646456-113646478 GTGACCTGTGCAAGGTGACAAGG - Intergenic
1102576082 12:113856920-113856942 GTCACTTGCCCAAGGTCACACGG + Intronic
1102577327 12:113864109-113864131 GTGACTTGCCCAAGGTTCCATGG + Intronic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102730837 12:115107850-115107872 GAGACCTGCCCAAGTTGGCAGGG + Intergenic
1102980562 12:117237734-117237756 GTGAACTGCTCAAGGTAACAAGG + Intronic
1103086942 12:118068807-118068829 GTCACCTGCCCAAGGAGCAGGGG - Intronic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103340230 12:120217011-120217033 GGGTCCTGCTCAAGGTGGCAGGG + Intronic
1103367125 12:120391372-120391394 GTGACTTGCCCAAGGCCACACGG - Intergenic
1103742958 12:123103718-123103740 GTGACTTGTCCAAAGTCCCATGG - Intronic
1103827010 12:123747064-123747086 CTGACCTCCCCACGGTGCCCCGG - Intronic
1103945477 12:124523823-124523845 GTGACTTGCCCAAGGGGACGGGG + Intronic
1105306715 13:19174097-19174119 GAGACCTGGCCAAGGTGCAGCGG - Exonic
1107388036 13:39933666-39933688 GTGACTTGCCCAAGGTTGCACGG - Intergenic
1108241772 13:48471900-48471922 GAGACCTGCCCAAGGTGAGGTGG - Intronic
1108269800 13:48748614-48748636 GTGAACTGGCCAGGGTGGCATGG - Intergenic
1109697531 13:65979424-65979446 GTGTCTTGCCCAAGGTTACACGG - Intergenic
1111919725 13:94397367-94397389 GTGAGCTGCCTAAGCTGCCTAGG - Intronic
1112749519 13:102567853-102567875 GTGACACCCCCAAGGTGGCAGGG + Intergenic
1113288222 13:108877374-108877396 GTGACAGGCCCAAGGGGACAGGG - Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113827086 13:113264192-113264214 GTGAGCTCCCTGAGGTGCCAAGG + Intronic
1114617836 14:24077618-24077640 GTGTCCTGGCTGAGGTGCCACGG + Exonic
1114666921 14:24383306-24383328 GTGAGCTACCCAAGAAGCCAGGG + Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1117042666 14:51780935-51780957 GGGAGCTGTCCAAGGTGTCACGG + Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1120102464 14:80461124-80461146 GTGACTTGCTCAGGGTGACAGGG + Intergenic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121116029 14:91343395-91343417 GCCTCCTGCCCAAGGTGCCCTGG + Intronic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121429245 14:93875060-93875082 GTGACCTCCCCAAGGTCACATGG - Intergenic
1121748062 14:96318368-96318390 GTGACCTTCCCAAAGTCACATGG + Intronic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1122089981 14:99331479-99331501 GTGACATGTCCAAGGTCACATGG - Intergenic
1122092837 14:99351474-99351496 ATGACTTGCCCAAGGTCGCAGGG - Intergenic
1122131859 14:99608836-99608858 GTCACTTGCCCAAGGTCACATGG + Intergenic
1122145254 14:99684840-99684862 GTCACCTGCCCAAGGTCACACGG + Intronic
1122935317 14:104953162-104953184 GGCACCTGCCCAAGGTGCAGAGG - Exonic
1124637569 15:31374722-31374744 GTGATCTGCCCAGGGTGTCACGG + Exonic
1124658808 15:31528650-31528672 GAGACCTGCCCAAGGAGCTGTGG - Intronic
1125536923 15:40446363-40446385 GTGTCCTGCCCCAGGTGACTTGG + Intronic
1126193477 15:45903939-45903961 GTCACCTCCCCAAGGTACCCTGG - Intergenic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1127389574 15:58494417-58494439 ATGACCTGCCCAAGGATCTATGG - Intronic
1127599540 15:60521671-60521693 ATGACTTGTCCAAGGTCCCATGG + Intronic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128260227 15:66228030-66228052 GTGACCTGCCCATAGTCACAAGG - Intronic
1128262612 15:66243123-66243145 GTGCCTTGCCCAGAGTGCCACGG - Intronic
1128416008 15:67446868-67446890 GTGACTTGCCCGAAGTCCCACGG + Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128698909 15:69789747-69789769 GTAACTTGCTCAAGGTGGCATGG + Intergenic
1129257679 15:74343376-74343398 GTCACTTGCCCAAGGTCACATGG + Intronic
1129606227 15:77026334-77026356 GTGCCCTGCACAGGGTGGCAGGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1130152701 15:81323755-81323777 GTGACTTGCCCAAGGTCACCTGG - Intronic
1130164616 15:81440623-81440645 GTGACTTTGCCAAGGTCCCAAGG - Intergenic
1130562888 15:84972355-84972377 GTGACTTGCCCATGGTCACAGGG - Intergenic
1130777345 15:86998805-86998827 TCAACCTGCCCAAGGTGACATGG + Intronic
1131036731 15:89227305-89227327 GTCACCTTCCCCAGGAGCCAGGG - Intergenic
1131793696 15:95991644-95991666 GCTACCTGCCCAAGGAGCTAGGG + Intergenic
1132918222 16:2366625-2366647 GTAATTTGCCCAAGGTGTCAAGG + Intergenic
1133030261 16:3007565-3007587 GTGACTTGCCCAGGGAGCCCTGG + Intergenic
1133101124 16:3480664-3480686 GTGATCTGCCCAAAATGCCGGGG - Intronic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135176075 16:20230460-20230482 GTGACTGGCCCAAGATCCCATGG - Intergenic
1135660323 16:24291041-24291063 GTGACATGCCCAAGGTCACCTGG - Intronic
1135752931 16:25071250-25071272 GTGACTTGCCCAAGGTTTCCTGG - Intergenic
1136500291 16:30666717-30666739 CTGCCTTGCCCAAGGTCCCATGG - Intronic
1137790023 16:51167066-51167088 ATGACCTGCCCAAGGTCACATGG - Intergenic
1137816929 16:51407118-51407140 ATGACCTGCCCAAGGTCACATGG + Intergenic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1138555911 16:57771135-57771157 TAGCCCTGCCCCAGGTGCCAGGG + Intronic
1138573301 16:57889943-57889965 GTGACGTGCCCAAGGTTACCAGG + Intronic
1138929697 16:61637581-61637603 GTGTCCTGCACAAGGTGCTTGGG - Intergenic
1138944598 16:61833043-61833065 GTGACCTGCCCACGATCACATGG - Intronic
1139239253 16:65373784-65373806 GTGAGCTGCCCAAGCTTGCAGGG + Intergenic
1139434242 16:66926916-66926938 GTGGCCTGCCCATGGTCCTAGGG + Intergenic
1140378308 16:74463268-74463290 GTGACCTGCTCAAACTCCCAGGG - Intronic
1140900065 16:79358943-79358965 GTGGCCTTCCCAAGCAGCCAGGG - Intergenic
1141219037 16:82051955-82051977 GAGACCTGCACCAGGTGCCAAGG - Intronic
1141431609 16:83973179-83973201 GTGACCTGCCCCAGGGCCCTTGG + Intronic
1141706632 16:85668772-85668794 GTGACCAGGCCTAGCTGCCAGGG - Intronic
1142152063 16:88517013-88517035 GCGACCTGCCCCAGGTCACACGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1142954826 17:3514526-3514548 TTGATCTGCCCAAGGTTACATGG + Intronic
1144051456 17:11500511-11500533 CTGACTTGCTCAAGGTTCCATGG + Intronic
1144554820 17:16272813-16272835 GTGACCGACCCAAGTGGCCAGGG - Intronic
1144772976 17:17770000-17770022 GGGCCCTGCCCAGGGTGACAGGG + Intronic
1144944441 17:18962610-18962632 TTGAAGTGCCCAAGGTGCCCAGG + Intronic
1145907082 17:28522098-28522120 GTGACTTGCCCAAGTCGCCCAGG - Intronic
1146158895 17:30548419-30548441 GTCACAGGCCCATGGTGCCAGGG - Intergenic
1146287529 17:31584314-31584336 ATGACCTGTCCAAGGTCACATGG + Intergenic
1146558677 17:33849430-33849452 GTAACCTACTCAAGGTCCCATGG + Intronic
1146679489 17:34796767-34796789 GAAACTTGCCCAAGGTGTCAGGG - Intergenic
1146944921 17:36866983-36867005 GTGACTTGCTCAAGGTCCCTTGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147595288 17:41712719-41712741 GTGACTTGCCCAAAGTCACAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147807548 17:43142536-43142558 GTGACCTGCCCAAGTGTCCAAGG - Intergenic
1148152267 17:45403860-45403882 GTGACTTGCTCAAGGTCCCTCGG - Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1148768285 17:50052165-50052187 GTAACTTGCCCAAGGTGAGAAGG + Intergenic
1148987670 17:51637738-51637760 GTGGGCTGCCCAAGGTCACAGGG + Intronic
1149568593 17:57656442-57656464 GTGACCTGCCAAAGGACTCAAGG - Intronic
1150131645 17:62672361-62672383 GTAACTTGCCCAAGGTGACTTGG - Intronic
1150283225 17:63941269-63941291 TGGACTTGCCCATGGTGCCAGGG - Exonic
1150645181 17:66973463-66973485 GTGACTTACGCAAGGTGGCATGG + Intronic
1151423874 17:74017053-74017075 GTTACCTGCCCAAAGGACCAGGG + Intergenic
1151682300 17:75628586-75628608 GTGCCCTGCTCAAGGGGTCAGGG - Intronic
1152295856 17:79466508-79466530 GTGACCCTCCCAAGGTCCCAGGG - Intronic
1152466239 17:80468255-80468277 CTGACCCACCCATGGTGCCAGGG - Exonic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1154102610 18:11489919-11489941 GTCACCTGCCCAAGATGCCTAGG + Intergenic
1154111436 18:11571899-11571921 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1155790644 18:29965342-29965364 GTGACCTGCCTAAAGAGCCCAGG - Intergenic
1156197209 18:34788501-34788523 GTGACTTGCCCAAGGTCATAGGG + Intronic
1156286096 18:35697628-35697650 ATAACCTGCCCAAGGTCTCATGG + Intronic
1156694739 18:39753211-39753233 GTGAGGTGCCAGAGGTGCCATGG - Intergenic
1157306427 18:46520884-46520906 ATGACTTGCCCAAGGTCACACGG + Intronic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158833509 18:61305225-61305247 GTGACTTGCCCAAGGTCGCCTGG - Intergenic
1158859603 18:61579504-61579526 GTGACTTGCCCAAGGTTCCTTGG - Intergenic
1159108395 18:64028641-64028663 GAGGCATGCCCAAGCTGCCAGGG - Intergenic
1160554059 18:79714777-79714799 GCGGCCTGCCCAGGGTGCCACGG + Exonic
1160752827 19:742689-742711 GTGACGTCCCCAAGGTGCATCGG + Intronic
1160890774 19:1377714-1377736 GTGACATGTCCAGGGTTCCAGGG + Exonic
1161574066 19:5046191-5046213 CCGACCTGCCACAGGTGCCAGGG + Intronic
1161668411 19:5590625-5590647 CTGAGCTGCCCCAGGAGCCAGGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161706590 19:5825040-5825062 GTGACCTGCCCCAGGGGACAGGG + Intronic
1162775249 19:12975298-12975320 GGGGCTTGCCCATGGTGCCAGGG - Intergenic
1163289606 19:16370759-16370781 GGGACCTGCTGACGGTGCCAAGG - Intronic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1165741115 19:38205913-38205935 GTGACTTGCCCAGGGTCCCTCGG + Intronic
1166203019 19:41250899-41250921 ATGACTTGCCCAAGGTTGCACGG - Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1166873849 19:45885709-45885731 GCGACCTGCCCAAGATGCCGTGG - Exonic
1166997827 19:46728176-46728198 GTGACCTGCCCACTGCCCCACGG - Intronic
1167036389 19:46997563-46997585 GTCACTTGCCCAAGGTGACACGG + Intronic
1167506161 19:49872244-49872266 GTCACTTGCCCGAGGTCCCATGG + Intronic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
1202695294 1_KI270712v1_random:118921-118943 GTGACCTGCCCTGGGTGACACGG + Intergenic
927246424 2:20960324-20960346 TGGACCTGCCAGAGGTGCCACGG - Intergenic
927684336 2:25160444-25160466 GAGACTTGCCTAAGGTCCCATGG + Intergenic
927729077 2:25454358-25454380 ATGACCCTCCCAAGGAGCCATGG + Intronic
927836144 2:26400935-26400957 GTGACTTGCCCAAGGTGGCAGGG + Intergenic
927866126 2:26588724-26588746 GAGACCTGCCAAAGGTGCTCCGG + Intronic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
927970882 2:27305918-27305940 GTGACTTGCCCAAGGTCGTAGGG - Intronic
928254069 2:29706855-29706877 GGGACTTGGCCAAGGTGGCATGG + Intronic
929053326 2:37856096-37856118 ATGACTTGGCTAAGGTGCCATGG + Intergenic
929203302 2:39261071-39261093 GTGACCAGCCCATGGTCCCCCGG + Intronic
929598612 2:43191373-43191395 GTGACCTGCCCAAGGTCACTGGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930688691 2:54336454-54336476 GTGACTTGCCCAAAGTCACATGG - Intronic
931619491 2:64195400-64195422 GTAACCTGCCCAAGGTCCCCAGG - Intergenic
931988328 2:67762900-67762922 GTAACTTGCCCAAGGTTACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932108246 2:68968922-68968944 TTGACCTGTCCAAGGTCACATGG - Intergenic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
934043351 2:88148027-88148049 GTGCCCTGCCCAGGGGTCCAAGG + Intergenic
934276461 2:91575969-91575991 GTGACCTGCCCTGGGTGACATGG + Intergenic
934579982 2:95430055-95430077 GTGACCTTCCCCAGATCCCAAGG - Intergenic
934599465 2:95646670-95646692 GTGACCTTCCCCAGATCCCAAGG + Intergenic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
935198079 2:100832291-100832313 ATGACCTGCCCAGGGTGGGAAGG - Intronic
936497470 2:113034882-113034904 CTGCCCTGGCCAAGGAGCCAAGG - Intronic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
938109917 2:128557079-128557101 TTAACCGGTCCAAGGTGCCAGGG + Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938298267 2:130192065-130192087 GAGACCTGGCCAAGGTGCAGCGG - Exonic
938458500 2:131482592-131482614 GAGACCTGGCCAAGGTGCAGCGG + Exonic
938807633 2:134821548-134821570 GTGAGCTGCTCAAGGACCCATGG - Intergenic
939816497 2:146903708-146903730 GTGGCCTGCCCTGGGTACCAAGG - Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
941751457 2:169139250-169139272 CTGCTCTGCCCAAGCTGCCAAGG - Exonic
942504465 2:176626930-176626952 GTGACCTGCTTAACGTGCCAGGG + Intergenic
942605659 2:177687862-177687884 GTGACTTGTTCAAGGTCCCAGGG + Intronic
942868593 2:180707400-180707422 GAAACCTGCCCAAGGTTACATGG + Intergenic
943619738 2:190135635-190135657 ATGATCTGCCCAAGGTAACACGG - Intronic
945379101 2:209118022-209118044 GTAACCTGTCCCAGGTTCCATGG + Intergenic
945805690 2:214487490-214487512 GTGGCATGCCCAATGTGCCATGG + Intronic
946137843 2:217662772-217662794 GTAAAGTGCCCAAGGTGACATGG - Intronic
946185215 2:217976953-217976975 GTGACTTCCCCAAGGTGTCCCGG - Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946458119 2:219845639-219845661 ATGACCTGCCCAAGGTCACATGG - Intergenic
946459621 2:219857376-219857398 GTGATTTGCCCAAGGGGTCAAGG - Intergenic
946490640 2:220146054-220146076 GTGAGCTTCCCAAGTTGCAATGG + Intergenic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
1168750481 20:278274-278296 CTGACCTCCCCAAGGTGCCAGGG + Intronic
1168796481 20:613145-613167 GTGACTTGCCCGAGGTCACACGG + Intergenic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1169304356 20:4475477-4475499 GTGAGCTGCCCAAGGTCACTAGG - Intergenic
1169555113 20:6741245-6741267 GTGACCTCCCCAAGGTCTAAAGG + Intergenic
1169757536 20:9059416-9059438 GTGACCTGCCCATAGTGGTAGGG - Intergenic
1170335893 20:15269699-15269721 GCTACCTGCCCAAGATGACAAGG - Intronic
1172030776 20:31980545-31980567 ATGACTTGCCCAAGGTCACATGG - Intronic
1172145164 20:32752424-32752446 GTGACATGCCCAAGACCCCAGGG - Intergenic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172839094 20:37891250-37891272 GTGACTTGACCAAAGTGCCCAGG - Intergenic
1172852968 20:37979891-37979913 ATGACTTGCCCAAGGTCACACGG + Intergenic
1172906995 20:38377813-38377835 GTGACCTTCCCAAGGCCACATGG - Intergenic
1172973502 20:38890042-38890064 GTGACCTGCCTGAGGTCACATGG + Intronic
1173047497 20:39526516-39526538 GTGACTTTCCTAAGGTGCTAAGG + Intergenic
1173070048 20:39755237-39755259 ATGACTTGCCCAAGGTCTCATGG - Intergenic
1173320429 20:41982559-41982581 GTTACTTGCTCAAAGTGCCATGG + Intergenic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173448126 20:43138419-43138441 GTGGCCTGCCCAGGGTCGCATGG - Intronic
1173608629 20:44350546-44350568 GTGACTTGCCCCAGGTCCCCAGG + Intronic
1173704827 20:45101925-45101947 GTGACTTGCCGGAGGTCCCATGG + Intergenic
1173913450 20:46688416-46688438 GTAACTTGCCCAAGGTTACACGG - Intronic
1174089547 20:48036161-48036183 GTGACCTACTCAAGGCCCCAGGG + Intergenic
1174177492 20:48654129-48654151 GGGACTTGCCGAAGGTTCCAGGG - Intronic
1174267840 20:49344845-49344867 GTGGCTTGCTCAAGGTCCCATGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174392453 20:50226389-50226411 GTGACTTGCCCCAGGTCACACGG - Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175060415 20:56237080-56237102 ATGGCCTGCCAAGGGTGCCAGGG - Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175797386 20:61780358-61780380 GAGGCCTTCCCAAGGGGCCAGGG + Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1176410382 21:6446601-6446623 GTGTGCTGCCCATGGTGGCAAGG - Intergenic
1178539484 21:33437339-33437361 GTGACCTGCCCAAGGGGCTCCGG - Exonic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1178960199 21:37058129-37058151 GTAACCTGCCCAAGGTACACTGG + Intergenic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1179685875 21:43054923-43054945 GTGTGCTGCCCATGGTGGCAAGG - Intronic
1180751978 22:18130883-18130905 GAGACCTGGCCAAGGTGCAGCGG + Exonic
1180927480 22:19566365-19566387 GTAAACTGCCCAAGGTCACAGGG + Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
1181935546 22:26435870-26435892 GTGACCTGCTCAAAGTCTCACGG - Intronic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182028872 22:27141844-27141866 GAGACCTGTCCAAGGTGTCCTGG + Intergenic
1182300192 22:29332867-29332889 GTGAGCTGTCCAAGGAGCCCAGG + Intronic
1182348123 22:29681275-29681297 GTGACCAGCCCAAGCTCCCATGG + Intronic
1182442974 22:30374858-30374880 GTGAGCTGTCCAAGGTCACACGG - Exonic
1182766673 22:32762575-32762597 GTGACCTCCCCAAGGTCTCATGG - Intronic
1182778618 22:32849824-32849846 GTGACTTGACCAAGGTCTCATGG - Intronic
1182869753 22:33635637-33635659 GTAACTTGCCCAAGGTCCGAGGG + Intronic
1183016927 22:34996468-34996490 ATGACTTGCCCAAGGTCACAAGG - Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183183889 22:36280646-36280668 GTGACTTGCCCAGGGTGACAGGG + Intergenic
1183215814 22:36479234-36479256 GTGGCCTGCCCAAGGCCACAGGG + Intronic
1183487854 22:38098993-38099015 GTGCCCTGCCCATGGTGCTGAGG - Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183660002 22:39214008-39214030 GACACCTGCCCCAGGTGCAAAGG - Intergenic
1183730072 22:39613557-39613579 GTGACTTGCCCAAAGTCACATGG + Intronic
1183737935 22:39654159-39654181 ATGGCTTGCCCAAGGTGCCAGGG + Intronic
1184101965 22:42345464-42345486 GTGACCTTGCCAAGGTCACAAGG + Intergenic
1184117229 22:42429284-42429306 GTAATCTGCCCAGGGTGCCTGGG + Intronic
1184271494 22:43387073-43387095 GTGACCTGCCCAAGGGCACAAGG + Intergenic
1184508398 22:44917801-44917823 GTGACCTGCCCAAGGCCACAGGG - Intronic
1184582031 22:45424409-45424431 GTGGCCTGCCCAAGGCTGCAGGG - Intronic
1184646621 22:45898803-45898825 GTGACTTGTCCAAGGTACCACGG + Intergenic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
949926783 3:9048074-9048096 GTGATTTGTCCAAGGTCCCACGG + Intronic
949953200 3:9246533-9246555 ATGACTTGCCCAAGGTCACAAGG - Intronic
950016049 3:9755876-9755898 GTGACCTGGCCAAAGTCACATGG - Intronic
950134224 3:10569378-10569400 GTGACTTGCCCTCGGTCCCACGG + Intronic
950353543 3:12381841-12381863 GTGACTTCTCCAAGGTGTCATGG + Intronic
950523676 3:13510863-13510885 GTCACCTGTCCAAGGTCACATGG - Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950695899 3:14701057-14701079 CTGGCCTGCCCCAGGTGCCTTGG - Intronic
951582706 3:24182738-24182760 GTGACTTGCCCAAGTTTCAATGG + Intronic
952307967 3:32162095-32162117 GTGACTTGCCCAAGGCCACAGGG - Intronic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953879155 3:46682680-46682702 ATAACCTGCCCAAGGTCTCAGGG - Intronic
954184750 3:48908372-48908394 GTTCCCTGCCCAAGGTCACATGG + Intergenic
954826160 3:53375259-53375281 GTGACCTGTCCAAGGTCTCCCGG - Intergenic
955150181 3:56359566-56359588 GTGACTTGCCCAAGGCCACATGG + Intronic
955259259 3:57368477-57368499 GTACTCTGCCCAAGGTCCCAAGG + Intronic
955412386 3:58664106-58664128 GTAACCTGCCCAAGGTGGCAAGG - Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956594224 3:70948762-70948784 GTGACATGCTCAAGGTTGCATGG - Intergenic
956859441 3:73307917-73307939 GTAACTTGCCCAAGGTGGCAGGG + Intergenic
957148394 3:76453694-76453716 GTGACCTGCCAAACATGTCATGG + Intronic
960915488 3:122690250-122690272 GAGACATGCCCAAGGTCACATGG + Intronic
961006881 3:123411433-123411455 GTTACCTCCCCTAGGTGCCGAGG - Intronic
961213631 3:125143617-125143639 TTGACCTGCCCAGAGGGCCAGGG + Intronic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961567372 3:127773316-127773338 GCCGCCTGCCCAAGGTGGCATGG - Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
961787580 3:129357027-129357049 CTGACCAGCCCAAGGGGCCAGGG - Intergenic
961816543 3:129553550-129553572 GTAACTTGCCCAAGGTTTCATGG - Intergenic
965533348 3:169798848-169798870 GTGATATGCCCGGGGTGCCATGG - Intronic
967108174 3:186270685-186270707 GTGACTGGCCCTAGGTTCCAAGG + Intronic
967827589 3:193890422-193890444 GTCACTTGGCCAAGGTGACATGG + Intergenic
967956181 3:194879255-194879277 GTGACTTGTCCCAGGTCCCATGG - Intergenic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968428340 4:537618-537640 GGGACCCGCCTAAGGAGCCAGGG + Intronic
968723070 4:2222000-2222022 GAGACGTGCCCAAGGTGGCTGGG - Intronic
969213575 4:5706805-5706827 GGGACGTGCTCAAGATGCCAAGG + Intronic
969292800 4:6251594-6251616 GTGACTTGCCCAAGGTCACCTGG - Intergenic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969869088 4:10093654-10093676 GTGACCTGGCCCAGGTCACATGG - Intronic
970319916 4:14864965-14864987 GTAACTTGCCCAAAGTGGCATGG + Intergenic
970445275 4:16118677-16118699 GTGAGCTGCCCAGGGTTACACGG - Intergenic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
972640087 4:40917345-40917367 GTGACTTGCCCAAGGTCTCCCGG + Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
975044360 4:69783500-69783522 CACACCTGCCCAAGGTGGCAGGG - Intronic
975101804 4:70522150-70522172 GTAACTTGCCCAAGGTGACATGG - Intronic
975391035 4:73817537-73817559 GGGAACTGTCCAAGGTGACAGGG + Intergenic
976001980 4:80385589-80385611 GTGACTTGCCCGAGGTCACAAGG + Intronic
976095921 4:81508099-81508121 GTGCCATGCACAAGGTGCTAGGG + Intronic
976138313 4:81962403-81962425 ATAACTTGCCCAAGGTCCCATGG - Intronic
978459464 4:108935039-108935061 GTGACTTGCCCAAGGTCAGACGG + Intronic
979235508 4:118395841-118395863 GTGACTTGTCTAAGGTTCCATGG + Intergenic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
980514271 4:133833579-133833601 GTGACAGGGCCAAGGGGCCAAGG - Intergenic
980878809 4:138688613-138688635 TTGACCTGCCCAAGGTTTAAAGG + Intergenic
981322214 4:143405798-143405820 TTGACCTGGCCGAGGTGACAGGG + Intronic
981491575 4:145346188-145346210 GTGACCTGGCGAAGGCGCCGGGG + Intergenic
981952413 4:150424561-150424583 GTGTCCTGTCCAAGGCACCATGG - Intronic
984711820 4:182892153-182892175 ATGACCAGCACAAGGGGCCAGGG + Intronic
985035726 4:185838340-185838362 GTGGCCTGCCCAAGCCCCCAGGG - Intronic
985931333 5:3059904-3059926 CTCACCTGTCCATGGTGCCAAGG - Intergenic
986105837 5:4658562-4658584 GTGGCTTGGCCAAGGTGCAATGG + Intergenic
986265771 5:6189217-6189239 GTGACTTGCCCAAGATCCTAAGG + Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
986772750 5:10988535-10988557 GTGACCTGCCCAAGGTGTGTGGG + Intronic
987147855 5:15010229-15010251 GAGACCTGCCCCAGGTGCCATGG + Intergenic
989710921 5:44396284-44396306 GTGAGCTGCCCAGGATGACAGGG + Intergenic
990256052 5:53970721-53970743 GTAAACTGCCCAAGGTGGGATGG - Intronic
990723712 5:58729111-58729133 GTGATCTGCAGAAAGTGCCAGGG - Intronic
994068462 5:95570489-95570511 GTAACTTGCCCAAGGTTACAAGG - Intronic
997297144 5:132775530-132775552 ATAACCTGCCCAAGGTCACATGG + Intronic
997395184 5:133553996-133554018 GTGACGTGCCTGAGGTCCCAGGG - Intronic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
997815121 5:137009769-137009791 TAGACCTGCCCAAGGTCACAGGG - Intronic
997846858 5:137294413-137294435 GTGATCTGCCCAAGGATGCAGGG + Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999182354 5:149678725-149678747 GTGACTTGCCTAATGTCCCATGG - Intergenic
999319769 5:150606675-150606697 GTGACCTGCCCACAGTCACAAGG + Intronic
999509078 5:152228715-152228737 GATACTTGCCCAAGGTTCCATGG + Intergenic
999543172 5:152597048-152597070 CTGACTTACCCAAGGTCCCATGG + Intergenic
999626260 5:153523614-153523636 CTGACCTGCACAGGGTGTCAAGG - Intronic
1000385273 5:160669396-160669418 GTAACTTGCCCAAGGTGAGATGG + Intronic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1001081002 5:168667395-168667417 TTGACCTGGCCCAGGGGCCAGGG + Intronic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001313323 5:170626430-170626452 GACACCTGCTCACGGTGCCATGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1001954189 5:175837152-175837174 GTGACCTGGTCAAGGTCACAGGG + Intronic
1002409250 5:179060980-179061002 GTGACCTGCCCAAAGTCATAAGG - Intronic
1002489366 5:179563450-179563472 GTAACTTGCCCGAGGTGCCTTGG + Intronic
1002650039 5:180684571-180684593 GTGACCATCCCAAGGGACCAGGG + Intergenic
1002740890 5:181434504-181434526 GTCATCTTCCCAAGGTGTCAGGG + Intergenic
1003467284 6:6392705-6392727 GTGACCTGCCCCTGTTCCCACGG - Intergenic
1004199912 6:13538537-13538559 GTGACTTGCCCAAGGTCATATGG - Intergenic
1004269932 6:14185954-14185976 GTGACCTGGCCAAGGTTTCCTGG + Intergenic
1004290641 6:14363835-14363857 GTGACTTGCCCAGGAAGCCAAGG - Intergenic
1005398783 6:25410460-25410482 GTTACCTGCCCAAGATTGCATGG + Intronic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006744461 6:36331497-36331519 CTGAGCTGCCCAAAGTCCCAAGG - Intronic
1007370967 6:41427021-41427043 GTAACTCGCCCAAGGTCCCACGG + Intergenic
1008003091 6:46381296-46381318 GTGACTTGCCCAAGGTTGCATGG - Intronic
1008088513 6:47269088-47269110 GTGACTTGCCCAAAGTCACATGG - Intronic
1008210190 6:48712684-48712706 GTGACTTGCCCAAAGTCACAAGG + Intergenic
1008589891 6:52983550-52983572 GTGACCTGTCCAAGGTAACATGG - Intronic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011839863 6:91483908-91483930 ATAACCTGCCCAAGATGACAGGG - Intergenic
1012006639 6:93720783-93720805 TTGCCCTGCTCTAGGTGCCAGGG - Intergenic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1017171624 6:151460980-151461002 CTAACATGCCCAAGGTGACATGG + Intronic
1017214281 6:151892132-151892154 GTGATCTGCCCAAGGTTCCTAGG - Intronic
1017804460 6:157931775-157931797 CTGACTTGCCCAAGGTCACATGG - Intronic
1018364471 6:163103873-163103895 ATGACTTGCCCAAGGTCACAGGG + Intronic
1019537474 7:1536881-1536903 GTGACCTGCCCAAGGAGGTGGGG + Intronic
1019606792 7:1913999-1914021 GAGACCTGCCCACGCTGCCCTGG - Intronic
1019648177 7:2142016-2142038 GTGCGCTGCTCAAGGTGACAGGG - Intronic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020704437 7:11526419-11526441 GAGACATGCTCAATGTGCCAAGG - Intronic
1021957472 7:25840363-25840385 GTGACCTGGACAAGGTGGCCTGG - Intergenic
1022377683 7:29829698-29829720 GTGACCTGACCAAGGCCACACGG + Intronic
1022738631 7:33100079-33100101 GCTCCCTGGCCAAGGTGCCAGGG - Intronic
1022783709 7:33613772-33613794 GTGACCTGGGCAAGAAGCCAAGG + Intergenic
1023863494 7:44228395-44228417 GGGCCCTGCCCATGGTGCCCAGG - Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027593539 7:80143630-80143652 GTAACTTGCCCAAGGTCTCATGG - Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1030924667 7:115437419-115437441 GTGAGTTGCCCAAGGTGCCATGG - Intergenic
1031526676 7:122830097-122830119 CTGGCTTGCCCAAGGTGACACGG + Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1032853577 7:135815831-135815853 GTGACCTGCCCAAGACCCTAGGG + Intergenic
1034105923 7:148489835-148489857 GTGAGCTGCCTAAGGTGGCTGGG - Intergenic
1034550887 7:151819960-151819982 GTGACGTGCCCAAGGTCACATGG + Intronic
1035502124 8:98098-98120 GTCATCTTCCCAAGGTGTCAGGG - Intergenic
1035890317 8:3336104-3336126 GAAACCTGCCCATGGTTCCATGG - Intronic
1036767042 8:11555884-11555906 GTGACTTGGCCAAAGTCCCACGG - Intronic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1043973578 8:86560451-86560473 GTCACCTGCACAAGGTGCTTGGG + Exonic
1044364373 8:91325873-91325895 GTGTCCTGCCCCAGGTGACTTGG - Intronic
1044808424 8:96032503-96032525 GTGACAAGCCCAAGGTCACATGG + Intergenic
1046857522 8:119050024-119050046 GTGACTTGTCCAAGGTTTCATGG - Intronic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1048458418 8:134599491-134599513 GTGACTTGCCCAAGGCCACAGGG + Intronic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1048871334 8:138801900-138801922 GAAACCTGCCCAAGGTCACACGG + Intronic
1048875363 8:138832995-138833017 CAGACCTGCCCAGGGTGTCATGG - Intronic
1049239594 8:141530470-141530492 GTGACTTGCCCAGGGTCCCACGG + Intergenic
1049376865 8:142293524-142293546 GAGACCTGCCCAGGGTCACATGG + Intronic
1049395310 8:142397477-142397499 GTGACATGGCCAGGGTCCCACGG + Intronic
1051680409 9:19601769-19601791 GTAACTTGCCCAAGGTCTCATGG - Intronic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1052995960 9:34551799-34551821 GGGTCCAGCCCAAGGGGCCAGGG + Exonic
1053293083 9:36894926-36894948 GTCACCTGCCCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1053615403 9:39760589-39760611 GTGACCTTCCCATTGTGTCACGG - Intergenic
1053873570 9:42519858-42519880 GTGACCTTCCCATTGTGTCACGG - Intergenic
1054238117 9:62581802-62581824 GTGACCTTCCCATTGTGTCACGG + Intergenic
1054262464 9:62881528-62881550 GTGACCTTCCCATTGTGTCACGG - Intergenic
1054268762 9:62946892-62946914 GTGACCTTCCCATTGTGTCACGG + Intergenic
1054552248 9:66616318-66616340 GTGACCTTCCCATTGTGTCACGG + Intergenic
1054924478 9:70575739-70575761 GTAACTTGCCCAAGGTCGCAGGG + Intronic
1055558261 9:77497524-77497546 GTGGTCAGCTCAAGGTGCCAAGG - Intronic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1056070535 9:82982213-82982235 GTGACATGTCCAAGGTCACAAGG + Exonic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1057802961 9:98201096-98201118 GGGACCTGCCCAAGGTCTCTGGG + Intronic
1059428761 9:114237466-114237488 GTGACTTGCCCAGGGTCCCATGG + Intronic
1059620904 9:116004304-116004326 GTGACCTGTCCCAAGTGCTAGGG - Intergenic
1059781244 9:117530357-117530379 GTGACTTGCCCAAGGGCACACGG + Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060152322 9:121296606-121296628 GTGACTTGCCCAAGGTCACCAGG + Intronic
1060204717 9:121675691-121675713 GTCACCAGCCCAAGGTCACAGGG - Intronic
1060214136 9:121728186-121728208 ATGAGTTGCCCAAGGTCCCAAGG - Intronic
1060440021 9:123629621-123629643 GTGACTTGCCCAAGATGGTAGGG + Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060730867 9:126036185-126036207 GTGACCTGCCCACGGTCACCTGG + Intergenic
1061249411 9:129417674-129417696 GTGATCTGCCCAAGGTCACCTGG - Intergenic
1061291094 9:129650739-129650761 GTGACTAGCCCAAGATGACAAGG + Intergenic
1061789891 9:133053662-133053684 GTGCCCTCACCAAGGTGACAGGG + Intronic
1061850105 9:133409893-133409915 ATGTGCTGCGCAAGGTGCCAGGG + Intronic
1061861114 9:133469258-133469280 GTGGCCTGTCCAAGGTTCCCAGG - Exonic
1203606198 Un_KI270748v1:59311-59333 GTCATCTTCCCAAGGTGTCAGGG + Intergenic
1185765606 X:2723588-2723610 GTCACCTGCCCACGATGCCCTGG + Intronic
1187670794 X:21664431-21664453 GGAACTTGTCCAAGGTGCCATGG + Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1189283249 X:39833921-39833943 GGTACCTGCCGAAGGTGTCATGG - Intergenic
1190994681 X:55594558-55594580 GTGATCCGCCCAAAGTGCCTCGG + Intergenic
1191678468 X:63816282-63816304 CTGACTTGCCCAAGGTCACACGG - Intergenic
1191975914 X:66870729-66870751 GTGACTTGCCCAAGGTCATAAGG + Intergenic
1192558512 X:72109345-72109367 TTGACTTGCCCAAGGTCACAGGG + Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1195702057 X:107712983-107713005 GTGACTTGCCCAAAGTCACATGG - Intergenic
1196069723 X:111507458-111507480 CTCACTTGCCCAAGGTCCCAAGG + Intergenic
1197332593 X:125172367-125172389 TTGACTTGCCCAAGGTCCCACGG + Intergenic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1197866724 X:131026924-131026946 GTGAACTGGGGAAGGTGCCAAGG + Intergenic
1199504239 X:148543509-148543531 GTGACTTGCCCAAGGCCACAGGG + Intronic
1199651700 X:149951407-149951429 GTGACATGCCCAAGGTGGTCAGG + Intergenic
1199716051 X:150508046-150508068 ATGACTTGCCCAAGGTGACACGG - Intronic
1200255158 X:154577449-154577471 GTGACTGGCCCAAAGTACCATGG - Intergenic
1200262611 X:154626955-154626977 GTGACTGGCCCAAAGTACCATGG + Intergenic