ID: 1079395297

View in Genome Browser
Species Human (GRCh38)
Location 11:20057095-20057117
Sequence TTGAAAAAGCAGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 620}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079395290_1079395297 19 Left 1079395290 11:20057053-20057075 CCTAGTCTGAGGACTATACATCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG 0: 1
1: 0
2: 6
3: 56
4: 620
1079395292_1079395297 -10 Left 1079395292 11:20057082-20057104 CCCTTTGTTGCCATTGAAAAAGC 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG 0: 1
1: 0
2: 6
3: 56
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079395297 Original CRISPR TTGAAAAAGCAGAATGTGGA GGG Intronic
901819210 1:11815689-11815711 TTCAAAATGCAGAATCTGGCTGG - Intronic
902096735 1:13951812-13951834 TTATAAAAGCAGAAAGTGGGTGG - Intergenic
902129718 1:14249121-14249143 TAGAAACAGCAGAGTGGGGATGG - Intergenic
903090965 1:20916659-20916681 TTGAAAAAGAAGAATGAAGTTGG + Intronic
903200114 1:21730025-21730047 TTTAAAAAATAGAATGTGGCAGG - Intronic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904367729 1:30026286-30026308 TTGAAAAAGAAGAATGAAGCTGG + Intergenic
906542021 1:46594282-46594304 TTGAAAAAGCAGAAATAGAAAGG + Intronic
907340847 1:53735231-53735253 TTTAAAATGCTGAATGTGAAGGG - Intergenic
907356060 1:53874810-53874832 TTTAAAAAGCATGTTGTGGAAGG - Intronic
907695461 1:56722689-56722711 TTGCCAAAGCAGAAAGTGCAAGG + Intronic
909759237 1:79268713-79268735 ATCACAAAGCAGAATATGGAAGG - Intergenic
910524196 1:88158548-88158570 TTGAAAAAGCAGAAAATTGCAGG - Intergenic
910978980 1:92939614-92939636 TTGACAGAGAAGAATGTGGGAGG - Intronic
911082028 1:93942839-93942861 TTGAAAAACCAAAAGGTGGCCGG + Intergenic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
912946015 1:114084972-114084994 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
913074855 1:115333288-115333310 TTGAAATTGCCCAATGTGGAAGG + Intronic
914726031 1:150328506-150328528 TTGAAGAAGCAAAAGGTGCATGG + Intronic
915377141 1:155406354-155406376 TTGAAAAAGAACAAAGTTGAAGG + Intronic
915415294 1:155737338-155737360 TTCAATAAGGAGAATGTGGCAGG - Intronic
916061787 1:161103814-161103836 CTGAAAAATCAGAGTGTGGGGGG + Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916433226 1:164752444-164752466 GGGAGAATGCAGAATGTGGAAGG + Intronic
917105921 1:171491960-171491982 TTGAAGAAGCACAATAGGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
920415669 1:205797839-205797861 TTTAAAAAGAAGTCTGTGGAAGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921372104 1:214434611-214434633 TAGAAAAAGCAAAGTGTGGTTGG + Intronic
921535100 1:216339468-216339490 ATGTAAATGCAGAATGTGGGAGG + Intronic
921812767 1:219533291-219533313 TGGAAAAAGAAGAATCTGAAGGG - Intergenic
922095495 1:222439800-222439822 TTGAAAAAGCAGAAAGTGAAAGG + Intergenic
923138236 1:231137549-231137571 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924196957 1:241618121-241618143 TTGAAATAGTAGAATGTGAATGG - Intronic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924292958 1:242556691-242556713 TAGAAAAAGCAGATTTTGGAGGG + Intergenic
924796625 1:247297366-247297388 TTTAAAAAGTAAAATGTGGCTGG - Intergenic
1062900404 10:1140929-1140951 TTGAAAAAAGAGAATGGGGCTGG + Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1064170435 10:13027287-13027309 TTGAAAGAGTTGGATGTGGAGGG - Intronic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1067040253 10:42948461-42948483 TTGAAAAAGGATAAAGTGGGAGG + Intergenic
1067111434 10:43403990-43404012 TCGAAAAAAAAAAATGTGGAGGG + Intronic
1067557423 10:47282618-47282640 TTGACACAGCAGGAGGTGGAAGG + Intergenic
1068249440 10:54418091-54418113 TTGAAAAAGCTGACTGTGGCTGG - Intronic
1068884234 10:62082008-62082030 TTAAGAAAGAAGAATGAGGAGGG + Intronic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070404709 10:76084509-76084531 TTGAAAAAACATAATATGGCTGG - Intronic
1071311709 10:84349092-84349114 TTTAAAAAGCAGTCTGTGGAAGG - Intronic
1071318984 10:84433151-84433173 TTGAAGAAGAAGAAAGTCGAAGG - Intronic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1073497158 10:103903112-103903134 TTTAAAAAACAGGCTGTGGATGG - Intronic
1073736993 10:106359999-106360021 ATGCAAAAGCAGACTGTGGGGGG - Intergenic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1074486154 10:113883102-113883124 TTGAAAAAGAAGAAAGTGGGAGG - Intronic
1074605965 10:114966419-114966441 TTGAAAAAGAACAAGTTGGAGGG - Intronic
1074835262 10:117286027-117286049 TTGAAAAAGATGAATGTGATGGG - Intronic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1075326662 10:121538129-121538151 TGGAAAAAGGTGAATGTTGAGGG - Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075896494 10:126000301-126000323 TTGTCAAGGAAGAATGTGGAAGG + Intronic
1077347349 11:2069255-2069277 TAGAAAACGCAGAATGGTGATGG - Intergenic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1080305747 11:30833196-30833218 TTGAAAAAGAACAATTTGCAAGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080726829 11:34906390-34906412 CTGAAAGAGCAGACTGGGGAGGG + Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081920974 11:46776063-46776085 TTGATAAAGAAGCATGTGAAAGG + Intronic
1082285659 11:50315472-50315494 GTGAATGAGCTGAATGTGGAAGG + Intergenic
1083048802 11:59758651-59758673 CTGAAAAAGCAGGCTGTCGAGGG - Intronic
1083201209 11:61122161-61122183 TTGCAAAAGTAGAAGGTAGAAGG - Intronic
1083655694 11:64228366-64228388 TTGAAAAAGGAGTAAGTGGCCGG + Intronic
1083855278 11:65390173-65390195 TTGAAAGGGCAGGATGTGGGTGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1087042254 11:93813018-93813040 TTGAAAAAGCAGAGAGCTGATGG - Exonic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087973791 11:104518768-104518790 TTAAAAAAGCATGATGTGGCCGG + Intergenic
1088200744 11:107330930-107330952 TTAAAAAGGCACAATGTAGAAGG + Intronic
1088409832 11:109522115-109522137 TTGGAAAAGTAGAATATTGAAGG - Intergenic
1088482810 11:110311220-110311242 TTGAAATAACATAATTTGGAAGG - Intergenic
1088763479 11:112954074-112954096 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1088836748 11:113584021-113584043 TTGAGAAAGAGGTATGTGGACGG + Intergenic
1088863610 11:113825086-113825108 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1088996489 11:115003759-115003781 TTGAAAAAGCAGAATAAAGCTGG + Intergenic
1089122840 11:116151498-116151520 TTGAAAAAAAATAAAGTGGAAGG + Intergenic
1089362318 11:117899181-117899203 GAGAAAAAGCAGGATCTGGATGG - Intergenic
1090502812 11:127278317-127278339 TTGTGAAAGCAGAAAGTGGTAGG + Intergenic
1090611009 11:128470767-128470789 TTGAAAAAGTAGAAAGTTGGAGG + Intronic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1091192333 11:133706447-133706469 TGGAGAGAGCAGATTGTGGAGGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1094534771 12:31311292-31311314 TAGAAAAAGCACAGTGTGGTTGG - Intronic
1094700387 12:32864726-32864748 TTGAAAAAGAATAAAATGGATGG + Intronic
1095135446 12:38595722-38595744 TTGAAATAGCAAAATGTGATTGG - Intergenic
1095443796 12:42265104-42265126 TTGAAAAAGAAGGAAGTCGAAGG - Intronic
1095662856 12:44757936-44757958 TTGAAAAAGCAGAAGGGATATGG + Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1099416583 12:82394963-82394985 TTGAACAAGCAGAAAGTAGTAGG + Intronic
1100107882 12:91199510-91199532 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
1100223715 12:92534929-92534951 TGAATAAAGCAGAATGTAGAGGG - Intergenic
1100899125 12:99218170-99218192 TTCAAAAAGCAGAAGTTAGAAGG - Intronic
1101644047 12:106612045-106612067 TTGAAAAAGAAGAACATGAAAGG - Intronic
1101665612 12:106810518-106810540 TTAGAAAAGAAGAATGTTGAGGG + Intronic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1103533065 12:121615889-121615911 CTCAAAAAGAAGAATGTGGCCGG - Intergenic
1104116611 12:125755092-125755114 ATCAAAAAGGAGAATGTAGAAGG - Intergenic
1104134001 12:125920140-125920162 TTTAAACACCAGAATGTGGAAGG - Intergenic
1104740818 12:131172094-131172116 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1105716355 13:23069099-23069121 TTTAAAAAGAACAAGGTGGAGGG + Intergenic
1105937012 13:25110696-25110718 TTGAAAAAGAAGAATAAAGATGG - Intergenic
1106143561 13:27032336-27032358 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1106223362 13:27765993-27766015 TTGAGATGGCAGAATTTGGATGG - Intergenic
1106527943 13:30559805-30559827 TGGAAACAGCAGATTGTGAAAGG + Intronic
1107078511 13:36348915-36348937 TTGAAAAAGAAGAATGAAGTTGG + Intronic
1107415545 13:40196632-40196654 ATGAAAAAGCAAAATATAGATGG + Intergenic
1107717064 13:43210764-43210786 TAGAATAAGCAGAATATTGAAGG - Intergenic
1108102533 13:46972177-46972199 CTGAAGAAGCATAATGTGTAAGG - Intergenic
1108106604 13:47017274-47017296 TTGAGATGGCAGGATGTGGAGGG + Intergenic
1108269463 13:48745321-48745343 TTGAAAAAGAATAAATTGGAAGG - Intergenic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1108453786 13:50593275-50593297 CTGAAAAAGAAGAATGTTGGGGG - Intronic
1108533827 13:51352049-51352071 TTGAAAAAGAAGAAAGTTGAAGG - Intronic
1108572460 13:51764991-51765013 TTGCAAGAGCAGGAAGTGGAGGG - Exonic
1109634821 13:65101285-65101307 TTGAAAATGCAGAATGTATTAGG + Intergenic
1109637548 13:65142607-65142629 TTAAAAAAGCAAAAAGTGAAAGG - Intergenic
1109820642 13:67648081-67648103 TTGAAAAAAAAGAAAGGGGAAGG + Intergenic
1110386142 13:74913035-74913057 TTGAAAAAGCTGCATATGGCTGG - Intergenic
1110660260 13:78052563-78052585 TTTAAAAAGTAGAATGAGGGAGG - Intergenic
1110675379 13:78236852-78236874 ATGAAACAGCAGAAAGTGGCTGG + Intergenic
1110781239 13:79467472-79467494 TTGAAAAATGAGAATGTTAATGG - Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1112264101 13:97906734-97906756 TTCAAAGAGTACAATGTGGAAGG + Intergenic
1112514678 13:100043087-100043109 TTGACAAATTGGAATGTGGATGG - Intergenic
1112523295 13:100118281-100118303 TGGAAAAACCTGAATGTGGTAGG - Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1112763019 13:102711666-102711688 TGGAAAAAGCGCAATGTGGGAGG + Intergenic
1113683809 13:112263816-112263838 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
1113712490 13:112477535-112477557 TTGAAAAAGCACCATCTGGCCGG + Intergenic
1114331612 14:21642675-21642697 TTGAAAAAGCATAATGTATAAGG - Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1115023219 14:28708418-28708440 TTGCAGAAGAAGCATGTGGATGG + Intergenic
1116403310 14:44535947-44535969 TTGAAAAACAAGAAAGGGGAGGG + Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1118902339 14:69997105-69997127 TTGAAATAGAAGCATTTGGATGG + Intronic
1119089620 14:71769426-71769448 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1119371317 14:74146730-74146752 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1119501161 14:75128392-75128414 CTGAAAAAGCAGGATGTGATGGG + Intergenic
1119944946 14:78683525-78683547 TTCACAAAGCAGAATATGGAAGG + Intronic
1120344319 14:83265843-83265865 TTTAAAAAGCAGATTGAGGCTGG + Intergenic
1120540888 14:85748969-85748991 TTGAAAATGAAGAAGGTGAAGGG + Intergenic
1120991311 14:90379919-90379941 CTGAAAAGGCAGATTATGGAGGG + Intergenic
1121553873 14:94821847-94821869 TTTAAAAAGCAGATTCTGGCTGG - Intergenic
1121839329 14:97119605-97119627 TTGAAATTGCAGACTTTGGAGGG - Intergenic
1122502391 14:102209472-102209494 TTGAGACTGCTGAATGTGGAAGG - Exonic
1122648573 14:103211445-103211467 TTGAAAAAGAACAATGTGGCCGG - Intergenic
1125153389 15:36559766-36559788 ATTAAAAACCAGAATATGGAAGG - Intergenic
1125254908 15:37752433-37752455 TTAATAAAACAGAATGTGGCCGG + Intergenic
1125753407 15:42045788-42045810 ATCATAAAGCAGAATGTAGAAGG - Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126368858 15:47924727-47924749 TTTAAAAAGCAAACTATGGAAGG + Intergenic
1127171610 15:56308985-56309007 TTGAAAAAGAACAAAGTTGAAGG - Intronic
1127305039 15:57697200-57697222 TTAAAAATTCAGAATGTGGCTGG + Intronic
1127502152 15:59564059-59564081 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
1127708592 15:61572327-61572349 TGGAAAAAGCAGTGTGTAGAGGG - Intergenic
1127731284 15:61804359-61804381 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1129773779 15:78220040-78220062 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130433447 15:83873006-83873028 TTTAAAAGGAAGAATGTGGCTGG + Intronic
1130963902 15:88683092-88683114 TTTAAAAAGCAAGATATGGAAGG - Intergenic
1131959687 15:97775865-97775887 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1132082235 15:98876160-98876182 TGGAAAAAGCAGAAGGTTGCTGG + Intronic
1132168725 15:99624611-99624633 TTGAAAAAGAACAAAGTTGAAGG - Intronic
1132853996 16:2036728-2036750 GTGAACGGGCAGAATGTGGAGGG + Exonic
1133140668 16:3741506-3741528 TTTAAAAAGAAAAATGTGGCCGG + Intronic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1133635181 16:7658176-7658198 TTGAGAAAGAAGACTGTGGGTGG - Intronic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1135165939 16:20139200-20139222 GTGAAAAAACAGAGTGTAGAGGG - Intergenic
1135431849 16:22391133-22391155 TTGAAAAAGAAGAACGAGGCTGG - Intronic
1135770301 16:25213156-25213178 TGGGAAAAAGAGAATGTGGAGGG - Intergenic
1135797167 16:25456857-25456879 TTGAAAATGCAGTTTGTGGCTGG + Intergenic
1136078411 16:27833435-27833457 TTGAAAAAGAAGAATAAGGCAGG - Intronic
1136521613 16:30800252-30800274 TTTAGAAAGCAGAAAATGGATGG - Intergenic
1137280341 16:46971814-46971836 TTGAAAAAGAGGAATGTTGCAGG - Intronic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1138165759 16:54800217-54800239 TTGAGAGTGCAGAGTGTGGAAGG - Intergenic
1139209636 16:65064787-65064809 TTTAAATAGCAGAAAGTAGAAGG + Intronic
1139723609 16:68877483-68877505 AGGAAAAAGAAAAATGTGGAGGG + Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140331782 16:74064689-74064711 TTAAAAAAACAGAAGGTGAAGGG + Intergenic
1140413428 16:74755713-74755735 AAGAAAAAGTAGAATGTGAATGG - Intronic
1140633668 16:76885191-76885213 TTTAAAAAGCAGAATATGATGGG + Intergenic
1140794068 16:78419339-78419361 TTGAAAAAGAAGAGTGTTGGAGG + Intronic
1141230951 16:82167247-82167269 AAGAAAAAGAAGGATGTGGATGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143567433 17:7732714-7732736 TGGAAAAAGCAGAAAGGAGAAGG - Intronic
1146479171 17:33190584-33190606 TTGAAAAAGAACAATGTTGACGG + Intronic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149597177 17:57871173-57871195 GTGAAAAAACAGATTGTGGGAGG - Intronic
1149977054 17:61276757-61276779 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1150012739 17:61521082-61521104 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150268162 17:63844125-63844147 TTAAAAATGCAGATTGTGGCAGG + Intergenic
1150555047 17:66246882-66246904 TTCAAAAACCATTATGTGGAAGG + Intronic
1150645339 17:66974395-66974417 TTGAAAAGGCAGCATGGGGTAGG + Intronic
1151068989 17:71186657-71186679 TTAAAAAAACAGAGTGGGGAAGG + Intergenic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1152224193 17:79085190-79085212 TTGAAAAAGGAGAATCTCAAAGG - Intronic
1153272002 18:3331743-3331765 TTAAAAAAACAGAATTTGTAAGG - Intergenic
1153716580 18:7855920-7855942 TAGAAAAAGCAGAAGGTGCCTGG + Intronic
1154222570 18:12469490-12469512 TTAAAAAATCAGAATGTGGCTGG - Intronic
1154349904 18:13574265-13574287 GGGAAAAAGCAGAATGTGGCTGG + Intronic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1157000401 18:43515785-43515807 GAGAAAATGCAGAATGTGAAAGG - Intergenic
1157313875 18:46572500-46572522 TTGAAACAGGACCATGTGGATGG + Intronic
1157497907 18:48169615-48169637 TTGATAAAGAAGAAAGTGGACGG - Intronic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1158545040 18:58389042-58389064 ATGTAAAAGCAGGATGTGAAAGG - Intronic
1159517804 18:69480643-69480665 TTCAAAAAGCAGAACGCAGAGGG - Intronic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159979279 18:74756259-74756281 TTGAAAAAGAATAAGGTTGAAGG - Intronic
1160486536 18:79298636-79298658 TTGACAAAGAAGAAAGTTGAAGG + Intronic
1160515912 18:79479109-79479131 TACAAAGAGCAGAGTGTGGAAGG - Intronic
1160964286 19:1739210-1739232 GTGAAAATGCAGAAACTGGATGG + Intergenic
1161950092 19:7463128-7463150 TTGAAAGAGCAGATTGAGGCAGG - Intronic
1163257291 19:16164484-16164506 TTCAGCAAGCAGAATGTGGCTGG - Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164399700 19:27894126-27894148 TAGAAGGAACAGAATGTGGAAGG - Intergenic
1164851482 19:31487905-31487927 TTGCAATAGCTGAAGGTGGAAGG - Intergenic
1165046839 19:33111535-33111557 TTAAAAAAGCACAATTTTGAAGG + Intronic
1165298831 19:34954136-34954158 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166405247 19:42516697-42516719 TTGAAAAAGAACAAAGTTGAAGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167978287 19:53251116-53251138 TTGAAAAAGAAGACTGTTGGGGG - Intronic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926477542 2:13344664-13344686 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
926576810 2:14591589-14591611 TTTAAAATGCTGAGTGTGGAAGG - Intergenic
926714577 2:15914092-15914114 TTGAGGAAGCAGACTGTGTATGG - Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927407131 2:22783647-22783669 GTGAAGAAGCAGAATTTGAATGG - Intergenic
927817547 2:26232675-26232697 TTGATTAACCAGAATATGGAGGG - Intronic
928611082 2:32993123-32993145 TGGAAAATGCAGCATGAGGAGGG + Intronic
928711719 2:34014669-34014691 ATGAAAAAGCAGAAGTTGCATGG - Intergenic
928790986 2:34952831-34952853 TTGTAAAAGAACAATGTTGAAGG + Intergenic
929018136 2:37522340-37522362 TTGAATCAGATGAATGTGGATGG + Intergenic
929193360 2:39161172-39161194 TTGACAAAGAAGAATGTGCATGG - Intergenic
929453754 2:42052450-42052472 TAGAAAAAACAGATTGTGGCCGG + Intronic
929679204 2:43972078-43972100 TTACAAAAGCTGAATATGGAAGG + Intronic
930425978 2:51213041-51213063 TTGAAAGAAGAGAATGTGGCCGG - Intergenic
930630358 2:53746779-53746801 TTGTAAAAACATAATGTGGAAGG - Intronic
931222771 2:60303155-60303177 ACCAAATAGCAGAATGTGGAGGG + Intergenic
931395814 2:61887583-61887605 TTGAAATAGAAAAATCTGGAAGG - Intronic
932560788 2:72866858-72866880 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
932914696 2:75844096-75844118 TTGCCAAAGCATAATCTGGATGG + Intergenic
933059358 2:77717334-77717356 TTGATAAAGGAGACTATGGAAGG + Intergenic
933060220 2:77727340-77727362 GTGAATAATCAGAATGTTGAGGG - Intergenic
933123287 2:78570313-78570335 ATGATAAAGCAGAATGTTCAAGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
934537804 2:95150722-95150744 TTGGAAAAGAAGAAAGTGAAGGG - Intronic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
935488848 2:103692395-103692417 GAGAAAAAGCAGAATCTGAAGGG + Intergenic
935517853 2:104065670-104065692 TTGAAAAAGAATAAAGTTGAAGG + Intergenic
935662199 2:105476699-105476721 TTGAAAAAACAGAATGATAATGG + Intergenic
935710501 2:105893821-105893843 AGGAAAAAGCACTATGTGGATGG - Exonic
935723616 2:106001842-106001864 TTGAAAAAGAAAAATGTTGGGGG - Intergenic
936044828 2:109179358-109179380 ATGAAAAAGCAGAACGTGAGAGG + Intronic
936088421 2:109485627-109485649 TTTAAAAAGGAGAATTTTGAAGG - Intronic
936272923 2:111065057-111065079 TTGAAAAAGAATAAAGTGGGAGG + Intronic
937431315 2:121841012-121841034 ATGAAAAAGCAAAATTTGGTTGG - Intergenic
937611785 2:123870382-123870404 TTGAAACAGCAGAATGTAGGAGG + Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938587085 2:132701795-132701817 TTGAATAATCACATTGTGGAGGG - Intronic
938644766 2:133319161-133319183 TTGAAAATGCAGGGGGTGGAAGG - Intronic
938857146 2:135325199-135325221 TTGAAAAAGAACAAAGTTGAAGG + Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939692796 2:145286437-145286459 TTTAAAGAGCAGAATGTGAGTGG - Intergenic
939712188 2:145536326-145536348 ATCAGAAAGCAGAATGTAGAAGG - Intergenic
939778716 2:146417758-146417780 TTGAAACAGCAAAATATGGGGGG + Intergenic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943233433 2:185287709-185287731 TTGAAAAAGAACAAAGTTGAAGG + Intergenic
943696019 2:190931909-190931931 TTAAAATAGCAGAAAATGGAAGG - Intronic
943797084 2:192010015-192010037 TTGAAAAAGAAATATGTGCATGG + Intronic
943934377 2:193896386-193896408 TGAAAAAAGAAGAATGTGTAAGG - Intergenic
944086948 2:195860079-195860101 TTGAAAAAGGAAAATTTGAAGGG + Intronic
944461086 2:199951536-199951558 ATGAAATGGAAGAATGTGGATGG - Intronic
945648438 2:212530879-212530901 TTGAAAGAGAAGAAAGTGAATGG - Intronic
945711873 2:213307037-213307059 TTCAAAAAGAATAATTTGGAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946082275 2:217132064-217132086 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
946802979 2:223440817-223440839 TTGAAAAAGAAGAATATGGTTGG - Intergenic
947387187 2:229602926-229602948 TTGAATAAGAACAATGTGGGAGG + Intronic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
948571957 2:238923213-238923235 TCTAAAAAGCATAATGTGGCTGG + Intergenic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1169062082 20:2668153-2668175 GTGAATGAGCAGAATATGGAGGG + Intergenic
1169158373 20:3353963-3353985 TTGGAAAAATAGAATGTGCATGG - Intronic
1169526841 20:6437663-6437685 TTTATAAAGCTGAAAGTGGATGG + Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170103446 20:12727605-12727627 TTGAAAAAGCAAGATCTAGAAGG - Intergenic
1170138632 20:13103102-13103124 TTTATAAAGCAGATTGTGCAAGG - Intronic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172214289 20:33224079-33224101 TTGAAAGAAGAGAAGGTGGAAGG + Intronic
1172249855 20:33471429-33471451 TTAAGTAAGCAGAATGTAGAAGG + Intergenic
1172423687 20:34839513-34839535 TTGAAAAAGAACAATGTTGGAGG - Intergenic
1175592981 20:60207999-60208021 TTGAAAAGGCAAAAGGTGAACGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1179374810 21:40841124-40841146 TAGAAAAAGGATAATATGGAGGG + Intronic
1179806560 21:43841876-43841898 TTGAAAAAGAAGAAAGTTGGGGG - Intergenic
1180191184 21:46163775-46163797 TTGAAAAAGGAGAACATTGAGGG - Intronic
1180256689 21:46634890-46634912 TTTAAAAAAAAAAATGTGGAAGG - Intergenic
1180667638 22:17527052-17527074 ATGAATAACCAGAATGTAGAAGG + Intronic
1182842154 22:33399842-33399864 TTAAAAAAGCAGAAGTTGGCCGG - Intronic
1182944608 22:34310262-34310284 CTGAGAAAGAAGAATGTGTATGG + Intergenic
1183050198 22:35254716-35254738 TTGAAAACACAGCATGTGGCAGG - Intergenic
1183090354 22:35518213-35518235 TTGAATAAGGACCATGTGGAAGG + Intergenic
1184302598 22:43570993-43571015 TTAACAAAGCAGTATGAGGAAGG + Intronic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
950434610 3:12971411-12971433 TTGAAAAAGCAGAACTCGGGAGG + Intronic
950803188 3:15572128-15572150 TTTAAAAAGCAGACTGGGCATGG - Intronic
951292255 3:20886703-20886725 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951864272 3:27289699-27289721 ATGAAAGAGCACACTGTGGAAGG + Intronic
952679793 3:36078052-36078074 TTGAAAAAGCAGAAATGGGTTGG - Intergenic
953408800 3:42676155-42676177 TTGAAAAAGAAGAAAGTTAATGG - Intergenic
953889213 3:46738186-46738208 TTTAATAAGTAGTATGTGGATGG - Intronic
954571471 3:51644558-51644580 TTTAAAAAGTAGAAAGTGCAAGG + Intronic
954741634 3:52756297-52756319 TTGAAAAAGAAGAATAGAGATGG + Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
956349962 3:68323565-68323587 TTGAAAAATCATAATTTTGAAGG - Intronic
957134048 3:76262386-76262408 TTGAAAAAGCAGACAGTGCATGG - Intronic
957307597 3:78478219-78478241 TTTAAAAATCAAAATATGGAAGG - Intergenic
957496587 3:80999475-80999497 TTGACAATGCTTAATGTGGAGGG + Intergenic
957499390 3:81034347-81034369 TTGACAAAAAAGAATGTGAAAGG - Intergenic
957938856 3:86978559-86978581 TTGAAATGGCAGATTCTGGATGG + Exonic
957955604 3:87183052-87183074 TTGATAAAGCAGAGTTTGAAAGG - Intergenic
957966790 3:87332532-87332554 TTGATTTTGCAGAATGTGGATGG + Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
959188300 3:103075593-103075615 TTGAAAAAGGAGAAAATGGAGGG + Intergenic
959384117 3:105680355-105680377 TTTAAATAGCTAAATGTGGATGG - Intronic
959535401 3:107479223-107479245 TTGAAAAAGAACAAGGTTGAAGG + Intergenic
959742910 3:109741532-109741554 ATGAAAAAAGAGAATGTGCAAGG - Intergenic
959745930 3:109776643-109776665 TTGAGGAAGAAGTATGTGGATGG - Intergenic
960016348 3:112893280-112893302 TTGAAAAAGTATAAAGTTGAAGG + Intergenic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960026241 3:113013989-113014011 TTGAAAAACATGAATTTGGAGGG - Exonic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960579686 3:119266455-119266477 TTTAAAAAGCACATTGTGGCTGG + Intergenic
960830855 3:121846101-121846123 TGCATAAAGGAGAATGTGGACGG - Intronic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961225176 3:125237836-125237858 TTGAAAAAGAAGAATGAAGCAGG + Intronic
961348542 3:126282163-126282185 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
961915651 3:130371376-130371398 TTGAAAAAGAACAAAGTTGAAGG + Intronic
962057628 3:131888751-131888773 TTCAAAATGCAGAGAGTGGAGGG + Intronic
962141411 3:132794433-132794455 TTGAAAAAGAAGAAAGTTGGAGG + Intergenic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
963459614 3:145592711-145592733 TTAAAATAGCAGAATGTAGTAGG - Intergenic
964212745 3:154246307-154246329 TTGAACATGGAGAATGTGGCTGG + Intronic
965233159 3:166079363-166079385 ATAAAAAAGCTGAATGTGAAGGG + Intergenic
965696765 3:171416509-171416531 TAGAGAAAGCTGAATATGGATGG + Intronic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
965930416 3:174035939-174035961 TTGTAAATGCAGAATGTATAAGG - Intronic
967481932 3:189982567-189982589 TAGAGAAAGCAGAATGTAGTAGG - Intronic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
968113933 3:196074583-196074605 TTAAAAAGGCATAAAGTGGACGG + Intronic
968560107 4:1275485-1275507 TTGAAAAAGAAGAATAAGGCTGG + Intergenic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
969158043 4:5230484-5230506 TTGTAAAAGTGGAATGTGGCCGG - Intronic
970203771 4:13635192-13635214 TAGGAAAAGCAGAAATTGGAGGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971881776 4:32383990-32384012 AAGAAACAGCAGAATGTGTAGGG + Intergenic
972839040 4:42909523-42909545 TAGAAAAAGGAAAATGTGCAGGG - Intronic
972882882 4:43447548-43447570 TTGAGGAAGAAGTATGTGGATGG - Intergenic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
973102999 4:46295371-46295393 TTGAGGAAGAAGTATGTGGATGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973242699 4:47973894-47973916 TAGAAAAAGCAAATTGTGGCCGG + Intronic
973545831 4:51981021-51981043 TTTAAAAATCTGAAAGTGGAAGG + Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973689763 4:53414825-53414847 CTGAAAAAGCATAAGTTGGAGGG - Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974965884 4:68760270-68760292 GAGAAAATGCTGAATGTGGATGG - Intergenic
975217494 4:71772430-71772452 ATGAGAAATCAGAATCTGGAAGG - Intronic
975996039 4:80316764-80316786 TTAAAAAAGAAGAAAGTGGGAGG + Intronic
976279115 4:83309120-83309142 TTGAAATAGTAGGCTGTGGAAGG + Intronic
976480098 4:85532714-85532736 ATGAAATGGCAGAATGTGCATGG - Intronic
976751410 4:88454380-88454402 TTGAAAAATCTGAATGTTAAGGG + Intergenic
977370464 4:96127935-96127957 TTGAAAAATCATAGTGTTGACGG - Intergenic
977567083 4:98591915-98591937 TTTAAAAAGAACAATGTTGAAGG + Intronic
978234485 4:106442225-106442247 TTGATAAAGTAGAAAGGGGAAGG + Intergenic
978459541 4:108936232-108936254 TTAAAAAAGAAAAAAGTGGAAGG - Intronic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
978910320 4:114054903-114054925 TAGAAAAAGCAGGATGCAGAAGG - Intergenic
979538571 4:121853232-121853254 TGGAAATAGATGAATGTGGATGG - Intronic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
980847704 4:138343757-138343779 TTCAAAAAGCAGAGTGGGGCTGG + Intergenic
981064594 4:140469599-140469621 TTTAAAAAGTGGAATGGGGATGG - Intronic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982649416 4:158068008-158068030 TTGAGAAAGTAAAATATGGAAGG - Intergenic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983730920 4:170992136-170992158 GAGAAAATGCTGAATGTGGATGG - Intergenic
983951104 4:173642593-173642615 CTGCAAAAGCAGCATGTGGTAGG - Intergenic
984547809 4:181128344-181128366 TTGAAGATGCAGGATGGGGAAGG + Intergenic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
985733020 5:1561470-1561492 TTGGATAATAAGAATGTGGAGGG + Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
985974917 5:3410273-3410295 TTGAAAAAGGAAAATGTAAAAGG - Intergenic
986561623 5:9065960-9065982 TTTAAAAAGCACATTGTGTAAGG - Intronic
986702579 5:10425363-10425385 TTGAAAAAGGAGCATGGAGATGG + Intronic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987743023 5:21934772-21934794 GAGAAAAGGAAGAATGTGGAGGG - Intronic
988053673 5:26063209-26063231 TTCAAAAAGCAGAATTTGTCAGG - Intergenic
988238280 5:28575176-28575198 GAGAAAATGCTGAATGTGGATGG + Intergenic
989262948 5:39438867-39438889 TTGATAAAGGAGAAGGTAGAAGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989676835 5:43982579-43982601 TTTAGAAAGAAGTATGTGGATGG - Intergenic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990559440 5:56968926-56968948 TTGAAAAAGAACAAAGTTGAAGG - Intronic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
993162325 5:84308283-84308305 TTGAAAACGCTGAGTGTGAATGG + Intronic
993402448 5:87470463-87470485 TTTAAAAAGAACAATGTTGAAGG - Intergenic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
994868540 5:105313294-105313316 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
995086572 5:108117975-108117997 ATGAAAAAGCAGGAGATGGAGGG + Intronic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
995573485 5:113505780-113505802 TAGAAAAAGCAAAATGTATATGG + Intergenic
995656042 5:114427140-114427162 TTGAAAGAGGAGAAGGTGCAGGG - Intronic
996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997291708 5:132741162-132741184 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997793164 5:136781332-136781354 TTGAAAGAGCAGAATTTAGTAGG + Intergenic
998177476 5:139910888-139910910 TGGAGAGAGCAGAAGGTGGAAGG + Intronic
998188600 5:140002420-140002442 TTGAAAAGGCAGAATTTGAAGGG + Intronic
998289632 5:140901089-140901111 ATGAATAACCAGAATGTAGAAGG - Intronic
998662625 5:144256968-144256990 TAGTAAAATCAGAATGTGGAAGG + Intronic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
999139978 5:149354143-149354165 TTTAAAAACCAGAAAATGGAAGG - Exonic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000403284 5:160856015-160856037 TTGAAAAAAAATAAAGTGGAAGG - Intergenic
1000870839 5:166575130-166575152 ATTAAAAAGCTGAATGGGGAGGG + Intergenic
1000933045 5:167275299-167275321 TTAAAAAAGAAGAAAGTGGGAGG - Intergenic
1000955273 5:167535636-167535658 TTTACATGGCAGAATGTGGAAGG - Intronic
1001028697 5:168245934-168245956 TTCAAAATGCAGGATGTGGCTGG + Intronic
1001253869 5:170168992-170169014 TTGAAAAAGGAAACTGGGGAAGG + Intergenic
1001479572 5:172078726-172078748 TTGAAAAAACTGAATGTGAGCGG + Intronic
1002682405 5:180977099-180977121 TTGAAAAAGCTGAATTAGGTAGG + Intergenic
1002733249 5:181359331-181359353 TGGAAAAAACAGAATGTATAAGG - Intergenic
1003694080 6:8384971-8384993 TTGAAAAAGCAGAAAAGGGAAGG + Intergenic
1004589719 6:17037837-17037859 ACGAAAAAGGAGAATCTGGATGG - Intergenic
1004780596 6:18904229-18904251 TTTAAAAAGAGGAATGTGGCAGG + Intergenic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005318469 6:24627960-24627982 TAGAATAAGCAGTATTTGGAAGG - Intronic
1005429358 6:25738133-25738155 TTGAAAAAGAATAAAGTGGTAGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006985507 6:38173044-38173066 TTTAAAAAGAAGCATGTGAATGG + Exonic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007296743 6:40828856-40828878 TTTAAAAATAAGCATGTGGATGG - Intergenic
1007466748 6:42057621-42057643 TTCAAAACTCAGAATGTGGCCGG + Intronic
1007611309 6:43151115-43151137 ATGAAAAAGCAGAGTCTGGCTGG - Intronic
1008465689 6:51828102-51828124 TGGTAAGAGAAGAATGTGGAGGG + Intronic
1009370081 6:62888728-62888750 TTTAAAAAGCAAGATTTGGAAGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG + Intergenic
1013070882 6:106728335-106728357 CTCAAAAGGCTGAATGTGGAGGG - Intergenic
1013338037 6:109185259-109185281 TTGAGAAAACACAATGTGGATGG + Intergenic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1014274528 6:119372356-119372378 TATAAAAAGCAGCATTTGGAAGG + Intergenic
1014457763 6:121656285-121656307 TTTAAAAAGCAGAAGATGGCTGG - Intergenic
1014503097 6:122217780-122217802 CTGAAAAAGTAGAAAGTGAATGG - Intergenic
1014517074 6:122393003-122393025 TTGAAAAACCCGAATTAGGAAGG - Intergenic
1014892323 6:126857846-126857868 TTAAAAATGCAGAATGGGGCTGG - Intergenic
1015168497 6:130225360-130225382 TGGGAAAACAAGAATGTGGAAGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016008219 6:139111080-139111102 TTTAAAAAGCAAATTGTGGGAGG - Intergenic
1016447261 6:144146882-144146904 CTGAAAAAGTAAATTGTGGATGG + Intergenic
1016447350 6:144147703-144147725 CTGAAAAAGTAAATTGTGGATGG - Intergenic
1016974828 6:149797126-149797148 TTTAAATAGCAGAATATGTAAGG + Intronic
1017403691 6:154093487-154093509 GTGAAAATGCCGAATTTGGAAGG - Intronic
1017702759 6:157091489-157091511 TCAAACAAGCAGAATCTGGAAGG + Intronic
1018665243 6:166129659-166129681 TTGAAAAAGTACAAAGTTGAAGG - Intergenic
1019237499 6:170631653-170631675 TGGAAAAAACAGAATGTATAAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019754065 7:2755204-2755226 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1021054129 7:16026140-16026162 TTGAAAAAGTTGAAGGTGTAAGG - Intergenic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021485488 7:21164049-21164071 TTTAAAAAGAAGAATCTGGTAGG - Intergenic
1021979258 7:26038649-26038671 TTGAAAAAGTGGAGTGTTGAGGG - Intergenic
1022016619 7:26355260-26355282 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1022233041 7:28432740-28432762 TTTAAAAAGAAGAAAGTTGAGGG - Intronic
1022264370 7:28739686-28739708 TGGGAAAAGGAGAATTTGGAGGG + Intronic
1022704797 7:32792328-32792350 TTGAAAAATCATAATGTGGGAGG + Intergenic
1022910132 7:34892931-34892953 TTGAAAAATCATAATGTGGGAGG + Intergenic
1023235891 7:38086465-38086487 TTGAAAAAGGACAATGTGTATGG + Intergenic
1024324657 7:48099644-48099666 TTAAAAAACAAGAAAGTGGAAGG - Intronic
1024635478 7:51285792-51285814 TTGAAAAATAAGAATGTTGGAGG + Intronic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1026181609 7:68046075-68046097 TTCAAAAAGCAGAAATTGTAGGG + Intergenic
1027837947 7:83270006-83270028 TATAAAATGCAGAGTGTGGATGG + Intergenic
1028133840 7:87206515-87206537 TTGAAAAAACAGTATGTATAGGG - Intronic
1028287983 7:89027867-89027889 TAGAAAAAGCAGAACATTGAGGG - Intronic
1028761669 7:94504115-94504137 TGGAAAAAGCAAAATGTAGCAGG + Intergenic
1029478020 7:100796710-100796732 TTGAAAATGCAGATTCTGGTTGG - Intronic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030554638 7:111008135-111008157 TTGAAAATAGAGAATGGGGAGGG - Intronic
1030929921 7:115509967-115509989 TTCACATAGCAGAATGTGGAAGG + Intergenic
1030943677 7:115688812-115688834 TTGACAGAGCAGCATGTGAAAGG + Intergenic
1031236392 7:119184340-119184362 TGCAGAAAGAAGAATGTGGAAGG + Intergenic
1031632674 7:124063189-124063211 GTGAATAAGCAGAATCTTGAAGG + Intergenic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032142401 7:129344692-129344714 TTGGAAAAGAAGACTGTTGATGG + Intronic
1032445060 7:131975100-131975122 TTCACACAGCAGAAGGTGGAAGG - Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033476432 7:141697598-141697620 GTGACAAAGTAGAATGTGAATGG - Intronic
1033955075 7:146837426-146837448 TTAAAAATGCAAAATGTTGAAGG - Intronic
1034095591 7:148405024-148405046 TGGAAAAAGCAGCATTTGGGTGG + Intronic
1034713542 7:153218582-153218604 TTGAATCAGCAGACTGTGTAAGG - Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035066242 7:156107156-156107178 TGGCAAAAGCAGAATGTATATGG + Intergenic
1035322754 7:158044287-158044309 TTGAACCAGCAGACTGTGGGCGG + Intronic
1035510269 8:174958-174980 TGGAAAAAACAGAATGTATAAGG + Intergenic
1035576129 8:707031-707053 TTGAAAAAGAACAAAGTTGAGGG + Intronic
1036743207 8:11384997-11385019 TTGAAAAAGAAGAATGAAGTAGG + Intergenic
1037019410 8:13950724-13950746 TGGAAAATGAAGAATGTGTAGGG + Intergenic
1037076274 8:14723217-14723239 GAGAAAATGCAGAATGTGAATGG + Intronic
1037166201 8:15832011-15832033 ATGAAAAAACAGTATGTTGAAGG + Intergenic
1037240225 8:16768959-16768981 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1038911226 8:31967100-31967122 TTGAAAAACCAGGCTGTGGATGG + Intronic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039340902 8:36648803-36648825 TTGAAACAGCATAAATTGGAGGG + Intergenic
1039431890 8:37531273-37531295 TTGAAAAAGCACATTTTGGCCGG + Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1041272254 8:56121013-56121035 TAGAAAAGGCAGAATATGGCTGG - Intergenic
1041411805 8:57564668-57564690 TTAAAAAGGCAGAAAGTGGCTGG + Intergenic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1041971035 8:63742872-63742894 TTGAGAAAGGAGAACGTGCAAGG - Intergenic
1042323269 8:67501006-67501028 TTGAAAAAGAAGAATGAAAAGGG - Intronic
1042744077 8:72086200-72086222 AAGAAAAAGTAGAATGTGCAAGG - Intronic
1042817780 8:72896718-72896740 TTGAAAAAGCACAGTGAGAAAGG - Intronic
1043066395 8:75576497-75576519 TTGAAATGGCAGAAGGTGAAAGG + Intergenic
1043333574 8:79146644-79146666 TTGAAAGCGCAGAATGAGGATGG - Intergenic
1043407868 8:79957154-79957176 AAGAAAAAACAGAATGTGGCAGG - Intronic
1043488622 8:80724726-80724748 GTGAAAAATCAGAATGGAGAAGG - Intronic
1044765400 8:95566930-95566952 ATGAAAAAGCAACCTGTGGAAGG - Intergenic
1045932801 8:107646881-107646903 TTGAAAAAGAAGAATGAAGTTGG + Intergenic
1046143820 8:110130557-110130579 TTGAAAAAGAAGAATGTGTAAGG + Intergenic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046356359 8:113090619-113090641 TTGGCAAAGCACAGTGTGGATGG - Intronic
1046420676 8:113979918-113979940 GAGAAAATGCTGAATGTGGATGG + Intergenic
1046533497 8:115477847-115477869 TTAAAAAAGGACAATGTGGATGG - Intronic
1046629181 8:116606424-116606446 TTGACAAACCTAAATGTGGATGG - Intergenic
1047216689 8:122881767-122881789 TTGGAAAAGCAGAAAGGGTATGG - Intronic
1047256695 8:123218763-123218785 GTGAGACAGAAGAATGTGGAAGG + Intergenic
1048132935 8:131717601-131717623 TTGAAAAAAGAGAAAGTGCAGGG - Intergenic
1048210737 8:132452451-132452473 GTGATAAAGCAGCATGTGCATGG - Intronic
1048242174 8:132753495-132753517 TGGAACAAGCAGAATTTGGTGGG - Intronic
1051301196 9:15652788-15652810 TTGAAAAAGAAGAATAAAGATGG - Intronic
1051352405 9:16210128-16210150 TTGAAAAAGAAGAAAGCTGAAGG - Intronic
1051715955 9:19984292-19984314 TTGAAAAAGAAGAATATTGGAGG + Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053601631 9:39616721-39616743 TTGACAAAGCACAATGGGAAGGG + Intergenic
1053859279 9:42370487-42370509 TTGACAAAGCACAATGGGAAGGG + Intergenic
1054251904 9:62725725-62725747 TTGACAAAGCACAATGGGAAGGG - Intergenic
1054566017 9:66760226-66760248 TTGACAAAGCACAATGGGAAGGG - Intergenic
1055101343 9:72468883-72468905 TTAAAAAAGAACAATGTGAAAGG - Intergenic
1055118507 9:72631721-72631743 TTCAATAGGCAGAGTGTGGATGG - Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055692548 9:78848125-78848147 TTGAAAAGGCACAATGGGGATGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056094504 9:83238732-83238754 TTGAAAAAGAACAAAGTTGAAGG - Intergenic
1056831019 9:89917684-89917706 TTGAAAATGAGGAATGTGGATGG - Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057449118 9:95141011-95141033 TTAAAAAAACAGGATGTGGCTGG + Intronic
1057513061 9:95697017-95697039 TGCAAAAAGCAGCAGGTGGAGGG + Intergenic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057717930 9:97509841-97509863 ATAAAAAAGCAAATTGTGGAAGG - Intronic
1058602324 9:106683529-106683551 GACATAAAGCAGAATGTGGAAGG - Intergenic
1058884688 9:109314326-109314348 TTGAAATAGCAGAAGGTCGATGG - Intronic
1059058128 9:111005732-111005754 TTGTGAAAACAGAATATGGAAGG - Intronic
1059365184 9:113781345-113781367 AGGAAAGAGCATAATGTGGAAGG - Intergenic
1059434500 9:114267902-114267924 TTCCAACAGCAGAATGGGGAGGG - Intronic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1061722786 9:132563390-132563412 TTGAAAGAGCTGCATGTGGCTGG + Intronic
1062000433 9:134213214-134213236 TAGGAAAACCAGAAAGTGGAAGG + Intergenic
1062298894 9:135852752-135852774 TTGAAGAATAAGAATGTGCAGGG - Intronic
1185834515 X:3332538-3332560 CTTAAAAAGAAGAATGTGGCCGG - Intronic
1186307322 X:8276395-8276417 TTGAAAAAAAAAAATGTGAAAGG + Intergenic
1186430785 X:9502766-9502788 TTCACATAGCAGAAAGTGGAAGG - Intronic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1186538677 X:10376605-10376627 TTGAGAAAGCAGGATGTAGTGGG - Intergenic
1186957144 X:14696112-14696134 TTGAAAGAAGAGAATGTAGAAGG + Intronic
1187128626 X:16479274-16479296 TTGGAAAAGCAGATTGCTGAAGG + Intergenic
1187671463 X:21670074-21670096 TTGAAGAAGAAGAATGTTGGAGG - Intergenic
1188422823 X:30010294-30010316 TTGAAAAAGCAGTATGTTATTGG - Intergenic
1188577915 X:31675212-31675234 GTGAAAAAACAGAATGCAGATGG - Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1190176064 X:48150721-48150743 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190182074 X:48201233-48201255 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190201220 X:48363025-48363047 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202483 X:48375152-48375174 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202656 X:48376858-48376880 TTGAAAAAGAAGAATAAGGTAGG + Intergenic
1190207882 X:48418552-48418574 TTGAAAAAGAAGAATAAGGTAGG - Intergenic
1190208055 X:48420258-48420280 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190210686 X:48444302-48444324 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190661655 X:52660168-52660190 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190669300 X:52725742-52725764 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190670117 X:52732662-52732684 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1191690054 X:63930259-63930281 TTGAAAAACCCGAATGTCAAGGG - Intergenic
1191717032 X:64200799-64200821 TTGAAAGAGCAAAATGTTGAGGG - Intronic
1192622379 X:72691346-72691368 TTAAAAAAGAAGAAAGTTGAAGG - Intronic
1194647583 X:96476456-96476478 TTGAAAAAGGAGTATGTTAATGG + Intergenic
1194655245 X:96565111-96565133 TTAAAAATGCAGATTGTGGTGGG - Intergenic
1194701347 X:97118757-97118779 TTGAAAAAGAAGAATCTTGAAGG + Intronic
1195254317 X:103078367-103078389 TTTAGGAAGCTGAATGTGGAAGG - Intronic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1195584344 X:106547399-106547421 TTGAAAAAGAATAAAGTGGGAGG - Intergenic
1195993589 X:110708770-110708792 TTGAAAGAGCAGAGTGTGGATGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196481458 X:116155023-116155045 GTGAAAAAGCAGAATATGGGTGG + Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197210144 X:123821539-123821561 TTGAAAAAGCAGCATCAGGCCGG - Intergenic
1197303314 X:124807671-124807693 TTAAAAAATCAAAATGTGGGGGG + Intronic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1198113484 X:133523114-133523136 TTCAAGAGGAAGAATGTGGAAGG + Intergenic
1198429040 X:136547459-136547481 TTGCAAAAGCAGAATTCTGAGGG - Intronic
1198546154 X:137694891-137694913 TAGAAAAAGCAGACAGTAGAAGG + Intergenic
1198635869 X:138699639-138699661 TTGCAAAAGCTAAATGGGGAAGG - Intronic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1199723647 X:150561474-150561496 TTGAAAAAGAAGAATGAAGTTGG - Intergenic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200094976 X:153654270-153654292 GTGATACAGCAGAATGTGGAGGG + Intergenic
1200907942 Y:8503980-8504002 TTGAGATATCAGAATCTGGATGG - Intergenic
1201316617 Y:12653473-12653495 TTGAAAAAGAATAAAGTTGAAGG - Intergenic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic
1201853967 Y:18520484-18520506 TTGAAAAAGCAGATTTAAGAAGG - Intergenic
1201879354 Y:18799900-18799922 TTGAAAAAGCAGATTTAAGAAGG + Intronic
1201922889 Y:19253757-19253779 TGGAAAAAGCAGAATCTTGTGGG + Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic
1202172231 Y:22061965-22061987 TGGAAGGAGCAGACTGTGGAAGG - Intergenic
1202219133 Y:22524406-22524428 TGGAAGGAGCAGACTGTGGAAGG + Intergenic
1202342344 Y:23882949-23882971 TTGAAAAAGCAGATTCAAGAAGG + Intergenic
1202528425 Y:25787136-25787158 TTGAAAAAGCAGATTCAAGAAGG - Intergenic