ID: 1079400284

View in Genome Browser
Species Human (GRCh38)
Location 11:20101399-20101421
Sequence AAATTGCAACAGATGTATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079400284_1079400287 5 Left 1079400284 11:20101399-20101421 CCACGATACATCTGTTGCAATTT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1079400287 11:20101427-20101449 GAATTTATCATGTGCGTACTGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1079400284_1079400286 4 Left 1079400284 11:20101399-20101421 CCACGATACATCTGTTGCAATTT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1079400286 11:20101426-20101448 AGAATTTATCATGTGCGTACTGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079400284 Original CRISPR AAATTGCAACAGATGTATCG TGG (reversed) Intronic
903725063 1:25435648-25435670 AGATTGCAACACAGGTATCTGGG - Intronic
906866521 1:49427042-49427064 AAATGTCAACAGATGTAGTGAGG + Intronic
910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG + Intergenic
913610506 1:120505569-120505591 AAAATGCAAGAGCTGTATCAGGG - Intergenic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914580684 1:149016670-149016692 AAAATGCAAGAGCTGTATCAGGG + Intronic
923004230 1:230032807-230032829 TAACTGCAACAGAAGCATCGTGG - Intergenic
1064912425 10:20416985-20417007 AAATTTCAACATATGAATGGGGG - Intergenic
1074324303 10:112433101-112433123 AAATTTCAACAAATGTATTAAGG + Intronic
1075282427 10:121151271-121151293 AAATTGAAACAGATCAATAGTGG - Intergenic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1090357897 11:126152333-126152355 AAATTACAACAAATGTAGCATGG - Intergenic
1097437885 12:59572535-59572557 AAATTGCCACAGATGAGTCTAGG - Intergenic
1097610320 12:61812010-61812032 ATATTGTAAGAGATGTATTGTGG + Intronic
1100091694 12:90980134-90980156 AAATTGAGACAGATGTTTCATGG + Intronic
1102185227 12:110942365-110942387 AACTTGCAAGAGATTTATTGAGG - Intergenic
1103248117 12:119475672-119475694 AAAGTGAAACAGTTGTATGGGGG - Intronic
1105395864 13:20033806-20033828 TAATAGTAACAGATGTATCATGG - Intronic
1106778521 13:33032242-33032264 TAATGGGAACAGATGTATCTGGG - Intronic
1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG + Intergenic
1113476406 13:110585037-110585059 AAATCTCAACAGATGTTTTGTGG - Intergenic
1113810105 13:113135629-113135651 AAATTTTAACATATGTATGGGGG + Intronic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1119929737 14:78533502-78533524 AAATGGCAGGAGATGGATCGTGG - Intronic
1125929570 15:43590592-43590614 AAATTTTAACAGATGTAAAGAGG + Intergenic
1125942737 15:43690424-43690446 AAATTTTAACAGATGTAAAGAGG + Intergenic
1127040566 15:54971203-54971225 AAATGCCAACAAATGTATAGGGG + Intergenic
1127057862 15:55150856-55150878 AAATTGCCACAAATATATGGTGG - Intergenic
1137373967 16:47935638-47935660 AAATTGAAACAAACATATCGTGG + Intergenic
1137648098 16:50093499-50093521 AAATTGCAACTGGTGTCTAGAGG + Intronic
1141560642 16:84865534-84865556 AAAAGGCAACAGATGTATTTGGG - Intronic
1144907874 17:18651415-18651437 AAAATGGAACAGATTTATCCGGG + Intronic
1150511746 17:65759863-65759885 TACTTACAACAGATTTATCGGGG - Intronic
1166517646 19:43459496-43459518 ATATTGCAATACATGTATAGAGG - Intergenic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
928529852 2:32179886-32179908 AATTTACAACAGATATATAGTGG - Intronic
931833545 2:66076169-66076191 AAATACCAACATATGTATCAAGG + Intergenic
936246258 2:110830415-110830437 AAAATGCAATAGATTTATTGTGG - Intronic
940108953 2:150129275-150129297 AATTTGCATCAGGTGTATAGTGG + Intergenic
940461745 2:153972593-153972615 AAAATGCTACAGATGAATTGGGG + Intronic
941626081 2:167831820-167831842 AAACTGCAACATATGTAGAGAGG + Intergenic
941947967 2:171121125-171121147 AAATTTCTACAGATGAATAGTGG + Intronic
942114646 2:172716041-172716063 AAATTGCCACAGATTTATAAAGG + Intergenic
946234681 2:218316621-218316643 AAATTGCAAAATATGTAGAGGGG + Intronic
1169924311 20:10766819-10766841 AAATAGGAACAGATGAATCCAGG + Intergenic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
949124365 3:428727-428749 AGATTGCAAAATATGTCTCGTGG + Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
952057066 3:29460476-29460498 AAAATGCCACTGATGTATCTGGG + Intronic
953765062 3:45733620-45733642 AAAATGCAACAGATTCATCAAGG - Intronic
964809219 3:160644650-160644672 AACTTGCAACAGATGCAATGGGG + Intergenic
967129014 3:186453480-186453502 AAATTTCAACACATGAATTGGGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970589384 4:17546194-17546216 AAATAGAAGCAGAGGTATCGAGG + Intergenic
971286159 4:25291731-25291753 AAATGGCAACTGAGGTATCCAGG - Intergenic
971779314 4:31010966-31010988 ATATTTCAACAGATTTATCGGGG - Intronic
971862447 4:32125444-32125466 AAATTGTAACAGAAGGATGGGGG + Intergenic
976668761 4:87628641-87628663 AAATTTCAACAAATGAATGGGGG - Intergenic
979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG + Intronic
979560450 4:122096043-122096065 AAGTTACAAGAGATTTATCGTGG + Intergenic
980695515 4:136350390-136350412 ATATTGCATCAGAAGTATTGTGG - Intergenic
981129283 4:141140480-141140502 AAAAGGAAACAGATGTATTGTGG - Intronic
983278191 4:165644474-165644496 ATATTGCAAAGAATGTATCGGGG + Intergenic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989635614 5:43529797-43529819 AAAATGGAACAGATTTATCCGGG - Exonic
993159935 5:84277167-84277189 AAATTTCAACATATGAATCTTGG - Intronic
993858571 5:93105482-93105504 AACTTGGAAAAGATGTATAGGGG - Intergenic
994326625 5:98455145-98455167 AAACTGCAACAGATGTGAAGTGG + Intergenic
995445471 5:112237893-112237915 AAATTGGAACAGATTTAGCATGG + Intronic
1001465587 5:171962341-171962363 AAATTATAACAAATGTATCTTGG - Intronic
1008955538 6:57212421-57212443 AAAGTGCAAGAGATTTATTGGGG - Intronic
1009590161 6:65658376-65658398 TAGTTGCAACAGATGTATCATGG + Intronic
1009793975 6:68442271-68442293 AAATTGCAAGTGATGTAGCCAGG + Intergenic
1010116723 6:72321217-72321239 AAACTACAACAGATATATCAAGG + Intronic
1014484058 6:121977641-121977663 AAATTGCACCTGATCTATCATGG - Intergenic
1014509239 6:122300644-122300666 AAACTGCAAGAGATTTATTGAGG + Intergenic
1015075860 6:129156958-129156980 AAATGGCAACAGAGGAATCCTGG + Intronic
1021093398 7:16508890-16508912 AAATTGCACCATATGTAGCCCGG + Intronic
1021700378 7:23314001-23314023 AAAATGCAACTGATGTCTCATGG - Intronic
1023026583 7:36056350-36056372 AAAATGCAAGAGATTTATTGGGG + Intergenic
1033719155 7:144038587-144038609 AAATTCCATCAGATATATCTTGG - Intergenic
1047099752 8:121663793-121663815 AAATTGCACCTAAGGTATCGTGG + Intergenic
1048966024 8:139615164-139615186 AAATAGCAACAGAAGTAGCCAGG + Intronic
1050538384 9:6649376-6649398 GAATTGCAACTGATGTCTTGGGG + Intergenic
1051293209 9:15566940-15566962 AATTTTCAACAGAAGTATCAAGG - Intronic
1052682598 9:31713309-31713331 AAATTCCAAAAAATGTATTGGGG - Intergenic
1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG + Intergenic
1056809783 9:89755209-89755231 ACATTGCAGCAGAGGTATGGGGG - Intergenic
1057013380 9:91628459-91628481 ACATAACTACAGATGTATCGGGG - Intronic
1060648653 9:125305295-125305317 TAATTCCCACAGATGTATTGAGG + Intronic
1203655542 Un_KI270752v1:20732-20754 AAATTGCTAGAGATCTATGGGGG + Intergenic
1185553576 X:1002911-1002933 AAATGGGAACAGATGTAGCCGGG - Intergenic
1187094629 X:16134408-16134430 AAATAGAAACAGATTTATAGAGG - Intronic
1193180828 X:78454522-78454544 TATTTGAAACAGATGTTTCGGGG - Intergenic
1193916650 X:87372752-87372774 AAATGGCAACAGATCGATCAAGG + Intergenic
1194193403 X:90864722-90864744 AACTGGCAACAGAGGTATCCAGG + Intergenic
1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG + Intergenic
1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG + Intergenic
1200540014 Y:4447109-4447131 AACTGGCAACAGAGGTATCCAGG + Intergenic