ID: 1079400286

View in Genome Browser
Species Human (GRCh38)
Location 11:20101426-20101448
Sequence AGAATTTATCATGTGCGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079400284_1079400286 4 Left 1079400284 11:20101399-20101421 CCACGATACATCTGTTGCAATTT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1079400286 11:20101426-20101448 AGAATTTATCATGTGCGTACTGG 0: 1
1: 0
2: 0
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079400286 Original CRISPR AGAATTTATCATGTGCGTAC TGG Intronic
900110974 1:1005506-1005528 AGATTTTACTATGTGCGTTCTGG - Intergenic
900811329 1:4803498-4803520 AGGATTTATCAGGTGCTAACAGG - Intergenic
906358644 1:45132578-45132600 ACCATTTATAATGTGCCTACGGG + Intronic
906440012 1:45833687-45833709 AGCATCTTTCATGTGCTTACCGG + Intronic
907862615 1:58368140-58368162 AGAATTTAAAATGTACTTACTGG + Intronic
911685612 1:100773657-100773679 ACAACTTTTCATGTGCTTACTGG + Intergenic
915130320 1:153691261-153691283 AGAATTTATTAGGTGCCTGCTGG - Intronic
915388432 1:155518596-155518618 ACAATTTTTCATGTGCTTATTGG - Intronic
915394831 1:155575368-155575390 AGCATTTTTCATGTGCTTATTGG + Intergenic
916358862 1:163944633-163944655 AGGATTTTTCATGTGCTAACTGG - Intergenic
918748590 1:188240734-188240756 AGCATTTTTCATGTGCTTATTGG - Intergenic
919423185 1:197397503-197397525 AGAAATAATCATTTGTGTACAGG - Intronic
920744158 1:208609939-208609961 AGAATTTGTTATGTGTCTACAGG - Intergenic
924376055 1:243410418-243410440 AGAATTTATAACATGCTTACTGG - Intronic
1063981544 10:11456330-11456352 AGCATTTTTCATGTGCTTATGGG - Intronic
1064896962 10:20247682-20247704 AGAATAAATCATGCGCATACTGG - Intronic
1071877646 10:89859730-89859752 AGAATTTTTCATGTGTTTATGGG - Intergenic
1074659796 10:115640725-115640747 AGAAATTATCATCAGCGAACAGG - Intronic
1079400286 11:20101426-20101448 AGAATTTATCATGTGCGTACTGG + Intronic
1084940630 11:72610976-72610998 AGACTTTATCTTGGGAGTACTGG - Intronic
1084988878 11:72904005-72904027 AGAATTTATAATCTGGGAACTGG + Intronic
1085342119 11:75739042-75739064 TGAATTTATCATGGGGGTGCAGG + Intergenic
1089618187 11:119707021-119707043 AGAATCTATCATTTGCCTTCTGG + Intronic
1092943076 12:13428395-13428417 AAAATTTATCATCTGAGTTCTGG - Intergenic
1093081206 12:14813535-14813557 AGCATTTATCAAGTGCTCACTGG + Intronic
1095689781 12:45074768-45074790 ATAATTTATCATGTCAGTAGTGG - Intergenic
1097838132 12:64294063-64294085 AGCATTTTTCATGTGCTTATTGG - Intronic
1107099132 13:36570030-36570052 ATATTTTTTCATGTGCTTACTGG - Intergenic
1108164793 13:47681012-47681034 AGAATTTAAAATGTGAGAACAGG + Intergenic
1112139176 13:96619425-96619447 AGTATTTATCAAGTGCTGACTGG + Intronic
1112706502 13:102075138-102075160 AGAATGTATCATCTGCAAACAGG - Intronic
1113062056 13:106332547-106332569 AGAATTTACCATGTGAATACTGG - Intergenic
1116054192 14:39842301-39842323 AGAATATATTTTGTGCATACTGG + Intergenic
1118224515 14:63886599-63886621 AGAATTTATCTTGTACTTATTGG + Intronic
1120235617 14:81887565-81887587 AGCATTTTTCATGTGCTTATTGG + Intergenic
1123479938 15:20621829-20621851 AGAATCTTTCATGTGCTTATTGG - Intergenic
1123638069 15:22378535-22378557 AGAATCTTTCATGTGCTTATTGG + Intergenic
1127713885 15:61628305-61628327 AGTATTTATTAAGTGCCTACTGG + Intergenic
1149404422 17:56332590-56332612 TGAATTGATCATATACGTACAGG + Intronic
1150017236 17:61570428-61570450 AGTATTTTTCATGTGCTTATTGG + Intergenic
1150070385 17:62145189-62145211 AGCATTTTTCATGTGCTTATTGG + Intergenic
1152385097 17:79969048-79969070 AGAATTTTTCATGTGCTTATTGG - Intronic
1152464804 17:80459965-80459987 AGAATTTTTCATGTGCTCATTGG - Intergenic
1155474169 18:26221515-26221537 AGATTTTATCCTGTGGGTAACGG + Intergenic
1156262130 18:35454752-35454774 AGCATTTTTCATGTGCTTATTGG - Intronic
1158914209 18:62104306-62104328 AGAATTTATCATATGCTAAAAGG - Intronic
1166172711 19:41042828-41042850 AGGATTTTTCATGTGCTCACTGG - Intergenic
1167302947 19:48689857-48689879 ACATTTTATCATGTGCACACAGG + Intergenic
928193614 2:29196490-29196512 AGAATTTATCAAGTCCCTACTGG - Intronic
931983336 2:67717980-67718002 AGCATTTAGCATGTGCACACAGG + Intergenic
937926350 2:127170636-127170658 AGAATTTATCCTGAGGGCACTGG + Intergenic
940240697 2:151560323-151560345 AGAGATTATCATGTGCAGACAGG + Intronic
943086913 2:183323233-183323255 AGAAACTATCATGAGCGAACAGG - Intergenic
947745507 2:232505340-232505362 GGGATTCAACATGTGCGTACAGG + Intergenic
1172290535 20:33772976-33772998 AAAATTTATCAAGTGCAAACGGG - Intronic
1175597358 20:60246153-60246175 AGAATTCAAAATGTGCGTCCTGG + Intergenic
1178404899 21:32316136-32316158 AGAACTCATCATGTGCCTAATGG + Intronic
1179930339 21:44567234-44567256 AGCACTTCTCATGTGTGTACTGG - Intronic
1180023623 21:45145625-45145647 AGAATTGATCCTGTGAGGACTGG + Intronic
1181847088 22:25719602-25719624 AGCATTTATTAAGTGCCTACTGG + Intronic
1184702436 22:46185054-46185076 AGAAGTTATCCTGAACGTACTGG + Intronic
950295115 3:11823139-11823161 ACAACTTTTCATGTGCTTACTGG + Intronic
951802977 3:26617234-26617256 AGAATTTTTCATATTCCTACTGG + Intergenic
955817038 3:62854748-62854770 AGAATTTATCAAGTACAAACAGG - Intronic
956478413 3:69648221-69648243 GGACTTTATCATGTGCTTAAGGG - Intergenic
958572469 3:95905612-95905634 AAAATATATCATGTGCATAAAGG + Intergenic
958695037 3:97516493-97516515 AGAATTCATCATGAGAATACTGG + Intronic
958761327 3:98311833-98311855 AGAATTTATAAAGTGAATACTGG - Intergenic
962631886 3:137284959-137284981 AGAAATTATAATGTGCTGACAGG - Intergenic
964311158 3:155394426-155394448 AGAATTTGTCATGTCAGCACTGG - Intronic
970733480 4:19137250-19137272 AGATTTTAGCCTGTGCTTACAGG - Intergenic
974389483 4:61246914-61246936 AAAATTCATCATGTGCTTACAGG + Intronic
977347692 4:95838743-95838765 AGAATTTATCATTTGCAAATAGG + Intergenic
979025004 4:115559436-115559458 AGAATTAATCATTTGCATAGTGG + Intergenic
980657030 4:135802365-135802387 AGAATTTAAGATGTCCGTCCAGG - Intergenic
980699708 4:136409053-136409075 AGAATTTTTCTTGTGCTGACCGG + Intergenic
983854709 4:172629388-172629410 AGAATTTCTCATGTGAGAATCGG + Intronic
987353654 5:17043462-17043484 AAAATCTGTCATGTGTGTACTGG - Intergenic
991622915 5:68565032-68565054 ACACTTTTTCATGTGCTTACTGG - Intergenic
994904399 5:105818337-105818359 CTGATTTATCATGTGTGTACAGG - Intergenic
1001757900 5:174185056-174185078 AGAATTTATCATTTGAGGCCGGG - Intronic
1002920408 6:1565793-1565815 AGAATTTATCATCAGCACACTGG + Intergenic
1010355522 6:74928073-74928095 AGAATATATAATGTGAGTGCTGG - Intergenic
1010704508 6:79091591-79091613 AAAATTTATTATATGCATACCGG - Intergenic
1012272323 6:97229133-97229155 AGAAATTTTCATGTGCTTTCCGG - Exonic
1012529175 6:100213658-100213680 AAAAATTATCATGTGGGGACTGG + Intergenic
1012586167 6:100925406-100925428 AGCATTTTTCATGTGCTTATTGG - Intergenic
1023170062 7:37382516-37382538 AGAATTTATCTTCTGCTTTCAGG - Intronic
1023443376 7:40207293-40207315 AGCATTTTTCATGTGCTTATTGG - Intronic
1024087330 7:45905591-45905613 AGACTTTTTCATGTGCTTATAGG - Intergenic
1024370426 7:48576781-48576803 AGAAGTTATATTGTGCTTACTGG - Intronic
1034712826 7:153209731-153209753 ACATTTTATCATGTGCTTATTGG + Intergenic
1040508803 8:48075508-48075530 AGTCTTTATCAAGTGCTTACTGG + Intergenic
1042402946 8:68370581-68370603 TGAATTTATCATGTGCACACTGG - Intronic
1047624316 8:126640426-126640448 AGAATTTATCCTGCAAGTACTGG + Intergenic
1048232305 8:132655696-132655718 AGCATTTTTTATGTGCTTACTGG - Intronic
1048873722 8:138820180-138820202 AGAATCTATCCTATGCGTAATGG + Intronic
1057600917 9:96456344-96456366 AAACTTTATCATCTGGGTACAGG - Intronic
1185957310 X:4505509-4505531 AAAATTTATCATTTGCCTTCTGG + Intergenic
1186492084 X:9981841-9981863 AGGATTTATTAGGTGCGCACCGG - Intergenic
1186524076 X:10231997-10232019 AGAATATATCATGACCCTACAGG - Intronic
1186643906 X:11486026-11486048 AGACTTAATCATATGCCTACCGG - Intronic
1187620649 X:21049768-21049790 AGAATCTATCATCTGCAAACAGG - Intergenic
1189892308 X:45616296-45616318 AGCATTTTTCATGTGCTTATTGG + Intergenic
1190500565 X:51073353-51073375 AGGTTTTATCATGTGCATATGGG - Intergenic
1193542206 X:82786316-82786338 AGAATTTAACATCTGCAAACAGG - Intergenic
1193987366 X:88260577-88260599 GGAAATTTTCATGTGCTTACTGG + Intergenic
1194423091 X:93701250-93701272 ATAATTTTTCATTTGCATACTGG + Intronic
1195162216 X:102181882-102181904 GGAATTTATCTTGTTCATACTGG - Intergenic
1196624157 X:117859069-117859091 ATCATTTATCAAGTGCTTACTGG + Intergenic
1199095387 X:143732664-143732686 AGAATAAAACATGTGCTTACTGG - Intergenic
1199876825 X:151938571-151938593 ACAATTTTCCATGTGCTTACTGG + Intergenic
1201745666 Y:17370430-17370452 AAAATTTATCATTTGCCTTCTGG + Intergenic