ID: 1079400287

View in Genome Browser
Species Human (GRCh38)
Location 11:20101427-20101449
Sequence GAATTTATCATGTGCGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079400284_1079400287 5 Left 1079400284 11:20101399-20101421 CCACGATACATCTGTTGCAATTT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1079400287 11:20101427-20101449 GAATTTATCATGTGCGTACTGGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079400287 Original CRISPR GAATTTATCATGTGCGTACT GGG Intronic
900674210 1:3874074-3874096 GAGTTTATCATGTACATACATGG + Intronic
907155799 1:52332527-52332549 AAATGTATCATGTGCTTATTAGG + Intronic
907862616 1:58368141-58368163 GAATTTAAAATGTACTTACTGGG + Intronic
911975074 1:104482198-104482220 GAATTTATTATGTTCTTACTTGG - Intergenic
912453379 1:109781445-109781467 GAATTTAACATATGGGTTCTGGG + Intergenic
913377474 1:118168994-118169016 GATTTTATCCTGTGGGAACTGGG + Intronic
915130319 1:153691260-153691282 GAATTTATTAGGTGCCTGCTGGG - Intronic
916046140 1:161001101-161001123 GAAGTTGTCCTGTGCCTACTCGG - Exonic
920347165 1:205313844-205313866 GTATTTACCATTTGCGTCCTTGG - Intronic
922620840 1:226987121-226987143 GATTTTATCATCTGTGTAGTAGG + Exonic
923230042 1:231977127-231977149 GAATTTATAAGGTGCATACATGG - Intronic
1063634556 10:7769106-7769128 AAAATTATCATGTACGGACTAGG - Intronic
1064877384 10:20009812-20009834 GAATTTATCAGGAAGGTACTTGG + Intronic
1071158037 10:82713643-82713665 GGATTTATCAAGTGCATACATGG + Intronic
1071680527 10:87700895-87700917 TAATTTATTATGTGCTTACATGG - Intronic
1071730430 10:88243215-88243237 GAATTTATCATCTGCAAAGTAGG - Intergenic
1076910510 10:133385876-133385898 TAATTTATCATGTGGTGACTGGG - Intronic
1078115973 11:8450926-8450948 GCATCTTTCATGTGCTTACTAGG - Intronic
1079400287 11:20101427-20101449 GAATTTATCATGTGCGTACTGGG + Intronic
1084940629 11:72610975-72610997 GACTTTATCTTGGGAGTACTGGG - Intronic
1084988879 11:72904006-72904028 GAATTTATAATCTGGGAACTGGG + Intronic
1085342120 11:75739043-75739065 GAATTTATCATGGGGGTGCAGGG + Intergenic
1088368310 11:109061768-109061790 AAATTTATCATGTGACTAATGGG + Intergenic
1090585525 11:128207894-128207916 GAATTTATCCTGTAGGCACTGGG - Intergenic
1091246221 11:134097261-134097283 GAATTTCTTAAGTGAGTACTAGG + Intronic
1093833286 12:23793283-23793305 GCATTTATTAAGTGCCTACTCGG + Intronic
1097504880 12:60454117-60454139 GAATTAAGCATGTGCATAATAGG + Intergenic
1100809262 12:98322404-98322426 GAAATTCACATGTGCGTAGTAGG + Intergenic
1105392160 13:19990223-19990245 GAAAGTATCTTGTGCATACTAGG + Intronic
1111854893 13:93625469-93625491 GAATTGATCATTTGGATACTGGG - Intronic
1115795683 14:36932798-36932820 AAAATCATCATGTGTGTACTTGG + Intronic
1120004127 14:79337697-79337719 GCATTTATCATGTGAGGAATTGG - Intronic
1120389823 14:83891646-83891668 GAATTTATGTTTTGTGTACTTGG - Intergenic
1120396674 14:83975850-83975872 GAAATTAACATGTGAGTAATTGG - Intergenic
1124408005 15:29409101-29409123 GAATTTGTTATGTGCCTACATGG + Intronic
1124824168 15:33076924-33076946 GAATTAATCATGTGGGTATTAGG - Intronic
1125046182 15:35243820-35243842 GAATTTTTCATGCGCGTCCGTGG - Intronic
1127014327 15:54666320-54666342 GAATTTTTCATGTGCCTTTTGGG + Intergenic
1127713886 15:61628306-61628328 GTATTTATTAAGTGCCTACTGGG + Intergenic
1132021959 15:98370557-98370579 AAATTTATAATGTACATACTTGG - Intergenic
1136225759 16:28859352-28859374 GAATTTATCTGTTGGGTACTGGG - Intronic
1144030922 17:11322707-11322729 GAATTTCTTATGTGCATACATGG + Intronic
1146397188 17:32478035-32478057 GAAGTCTTGATGTGCGTACTTGG + Intronic
1149827412 17:59842294-59842316 GTATTTATCATGTTCCAACTTGG + Intergenic
1150519960 17:65855761-65855783 GAATTTTTTAAGTGCGTAATAGG + Intronic
1151880792 17:76893294-76893316 GTATTTACCATGTGCCTGCTCGG - Intronic
1153608719 18:6860254-6860276 GAATTTATCCTGTGGGTAAAAGG - Intronic
1156800349 18:41105271-41105293 GAAATTATTATGTGCATATTAGG + Intergenic
1159587166 18:70291681-70291703 CAATTTATCATGGGCTTATTGGG + Intronic
1159607694 18:70492588-70492610 CATTTTATCATCTGCATACTGGG + Intergenic
1159948382 18:74460193-74460215 GAATGTATCATTTGGGTAATTGG - Intergenic
1164559643 19:29281150-29281172 GAATTTCTCATGTGGCTACATGG + Intergenic
927470759 2:23374517-23374539 GAATTTATCATGAGATTCCTTGG + Intergenic
928193613 2:29196489-29196511 GAATTTATCAAGTCCCTACTGGG - Intronic
936876778 2:117199787-117199809 GAATTTATACTGTGAGTAGTAGG + Intergenic
937926351 2:127170637-127170659 GAATTTATCCTGAGGGCACTGGG + Intergenic
940422638 2:153498328-153498350 GAATATATCTTGTGCCCACTGGG + Intergenic
941612316 2:167676866-167676888 GAACTTATAATGTGCATACATGG - Intergenic
1169329659 20:4706370-4706392 GAATTCATCGTGTGCCTCCTGGG - Intergenic
1169910535 20:10644466-10644488 GACTTTATCATTTGGGTATTAGG - Intronic
1170564113 20:17585213-17585235 GACTTTATCTTGTGGGTGCTTGG + Intronic
1174726646 20:52869546-52869568 GACTTTATCTTGAGGGTACTAGG + Intergenic
1175597359 20:60246154-60246176 GAATTCAAAATGTGCGTCCTGGG + Intergenic
1178786189 21:35655973-35655995 GAATGAATCATGTGGGCACTAGG + Intronic
1179044771 21:37834202-37834224 GAATTTTTCCTGTGGGTAATGGG - Intronic
1181847089 22:25719603-25719625 GCATTTATTAAGTGCCTACTGGG + Intronic
1182102166 22:27665173-27665195 GAATCTGTGATGTGAGTACTAGG - Intergenic
951802978 3:26617235-26617257 GAATTTTTCATATTCCTACTGGG + Intergenic
952947347 3:38487208-38487230 GAATACATCATGTCCGGACTTGG + Exonic
954482434 3:50813205-50813227 CAATTTATCATGAGTTTACTGGG - Intronic
956478412 3:69648220-69648242 GACTTTATCATGTGCTTAAGGGG - Intergenic
958914118 3:100028600-100028622 GTATTTATTAAGTGCCTACTAGG - Intronic
960178658 3:114547734-114547756 GTATTTATTAAGTGCATACTAGG + Intronic
970295717 4:14627211-14627233 GATTTTATCATGAGGGTAGTGGG - Intergenic
972507038 4:39729321-39729343 GAATTTTTCATTTACCTACTTGG + Intronic
973054194 4:45633911-45633933 GATTTTATCATCTGCATACAAGG - Intergenic
978221229 4:106277070-106277092 GTATTTTTCATGTGCTTATTAGG - Intronic
981048424 4:140287239-140287261 GCATTTAGCATGTGTGTACATGG - Intronic
981595286 4:146414313-146414335 GTATTTTTCAAGTGCCTACTTGG - Intronic
987353653 5:17043461-17043483 AAATCTGTCATGTGTGTACTGGG - Intergenic
987614204 5:20251262-20251284 GAATTTTTCATTTGCATTCTGGG + Intronic
990599148 5:57339897-57339919 GAATTTATAATGTGTGTTCATGG + Intergenic
991574205 5:68085821-68085843 GAATTTATCTTGTGGGAACCTGG - Intergenic
993342879 5:86746561-86746583 CAATTCATCATGTGCATACAAGG + Intergenic
994904398 5:105818336-105818358 TGATTTATCATGTGTGTACAGGG - Intergenic
995239920 5:109874108-109874130 GAACTAAGCATGTGGGTACTAGG + Intergenic
996618910 5:125476471-125476493 AAATTTATTATGTACGTTCTTGG - Intergenic
999615014 5:153413971-153413993 GGATTTATCAAGTCCCTACTGGG + Intergenic
999813491 5:155151781-155151803 GAATATATCATGTTGGTATTTGG - Intergenic
1005093165 6:22080607-22080629 AAATTTCTCATGTGCTTACTAGG + Intergenic
1012529176 6:100213659-100213681 AAAATTATCATGTGGGGACTGGG + Intergenic
1016871487 6:148821505-148821527 GAATTTATCATGTAGAAACTTGG - Intronic
1020460023 7:8419032-8419054 GAATTTATGCAGTGCTTACTAGG + Intergenic
1023877200 7:44293328-44293350 GAATTTGTCATGAGCTTATTTGG - Intronic
1028274827 7:88841923-88841945 GAATTTATCAGTTGCCTACTAGG + Intronic
1040508804 8:48075509-48075531 GTCTTTATCAAGTGCTTACTGGG + Intergenic
1042223126 8:66493137-66493159 TAATTTGTCATGTGCTAACTTGG - Intronic
1043823060 8:84892186-84892208 GAATCTATCATGTGTGCACCAGG + Intronic
1046181377 8:110653668-110653690 GAATTTATAATGTGGGTGTTTGG - Intergenic
1047624317 8:126640427-126640449 GAATTTATCCTGCAAGTACTGGG + Intergenic
1050042645 9:1512157-1512179 GGATTTATCATGTGGGTGATGGG + Intergenic
1050080561 9:1911396-1911418 GAATGTATCATCTGAGTAGTGGG - Intergenic
1051924942 9:22313347-22313369 GAATTTATCATGTGTTTGTTTGG + Intergenic
1054852828 9:69866250-69866272 AGATTTATCATGTGCTTACATGG + Intronic
1059826193 9:118031623-118031645 CAATTTATCATGTTCTTTCTTGG - Intergenic
1059933738 9:119286563-119286585 AAATTTAACATGTGTCTACTGGG + Intronic
1186894308 X:13990613-13990635 TAATGTATCATGTGCATCCTTGG + Intergenic
1195458881 X:105101137-105101159 CAATTAATCATGTGCCCACTGGG - Intronic
1196624158 X:117859070-117859092 TCATTTATCAAGTGCTTACTGGG + Intergenic
1199318771 X:146413420-146413442 TAAGTAATCATGTACGTACTGGG + Intergenic