ID: 1079400875

View in Genome Browser
Species Human (GRCh38)
Location 11:20105478-20105500
Sequence GATGATGGTGATCCAAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 865
Summary {0: 1, 1: 0, 2: 2, 3: 79, 4: 783}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079400875_1079400877 11 Left 1079400875 11:20105478-20105500 CCATCATTTGGATCACCATCATC 0: 1
1: 0
2: 2
3: 79
4: 783
Right 1079400877 11:20105512-20105534 TGTTTCTGACTTCCTCCAGATGG 0: 1
1: 0
2: 3
3: 27
4: 244
1079400875_1079400878 12 Left 1079400875 11:20105478-20105500 CCATCATTTGGATCACCATCATC 0: 1
1: 0
2: 2
3: 79
4: 783
Right 1079400878 11:20105513-20105535 GTTTCTGACTTCCTCCAGATGGG 0: 1
1: 0
2: 2
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079400875 Original CRISPR GATGATGGTGATCCAAATGA TGG (reversed) Intronic
900505078 1:3025986-3026008 GATGATGGTGATGGAGGTGATGG + Intergenic
900659577 1:3775857-3775879 GATGAAGATGATCCAGAAGAGGG - Exonic
900742090 1:4336669-4336691 GATGATGGTGATGGTGATGATGG + Intergenic
900747249 1:4369002-4369024 GATGATGGTGATGGAAGTGATGG + Intergenic
900797355 1:4716559-4716581 GATGATGATGATGGAGATGATGG + Intronic
900797364 1:4716649-4716671 GATGATGGTGATGATAATGATGG + Intronic
900805816 1:4767694-4767716 GATGATGGTAATGATAATGATGG - Intronic
900945575 1:5829625-5829647 GATGATGGTGATAGTGATGACGG + Intergenic
901127122 1:6937471-6937493 GATGATGGTGATGGTGATGATGG - Intronic
901127146 1:6937647-6937669 GATGATGGTGATGGTGATGATGG - Intronic
901218478 1:7568181-7568203 GATGATGGTGATGTTGATGATGG - Intronic
901218495 1:7568315-7568337 GATGCTGGTGATCCTGATGAGGG - Intronic
901218505 1:7568398-7568420 GATGATGGTGATGTTGATGATGG - Intronic
901218513 1:7568472-7568494 GATGATGGTGATGTTGATGATGG - Intronic
901218519 1:7568523-7568545 GATGATGGTGATGCTGATGATGG - Intronic
901218525 1:7568574-7568596 GATGATGGTGATGTTGATGATGG - Intronic
901218553 1:7568796-7568818 GATGATGGTGATGTTGATGATGG - Intronic
901218564 1:7568905-7568927 GATGATGGTGATGTTGATGATGG - Intronic
901218583 1:7569075-7569097 GATGATGGTGATGTTGATGATGG - Intronic
901218606 1:7569297-7569319 GATGATGGTGATGTTGATGATGG - Intronic
901218615 1:7569372-7569394 GATGATGGTGATGTTGATGATGG - Intronic
901275812 1:7990180-7990202 GGTGATGGTGATGGTAATGATGG - Intergenic
901275916 1:7990672-7990694 GATGATGGTGGTGATAATGATGG - Intergenic
902681860 1:18049323-18049345 GATGATGGTGATGCTGGTGATGG + Intergenic
902957073 1:19932921-19932943 GGTGATGGTGATTATAATGATGG - Intergenic
903450123 1:23447637-23447659 GATTATGATGATTCAAGTGATGG + Intronic
903476930 1:23626012-23626034 GATGATGGTGATGGTGATGATGG + Intronic
903476954 1:23626174-23626196 GATGATGGTGATGATGATGATGG + Intronic
903476965 1:23626213-23626235 GATGATGGTGATGGGGATGATGG + Intronic
903476984 1:23626291-23626313 GATGATGGTGATGGGGATGATGG + Intronic
904324450 1:29718983-29719005 GATGATGGTGATGATGATGATGG - Intergenic
904357186 1:29948051-29948073 GAGGATGGTGAGGTAAATGATGG - Intergenic
904379758 1:30102590-30102612 GAGGATGGTGAGGTAAATGATGG + Intergenic
904413362 1:30339105-30339127 GATGATGGTGATGGTGATGATGG + Intergenic
904413366 1:30339132-30339154 GATGATGGTGATGGTGATGATGG + Intergenic
904413462 1:30340028-30340050 GATGATGGTGATGGTAATGATGG + Intergenic
904431009 1:30464135-30464157 GATGATGGTGATGATGATGATGG + Intergenic
904431031 1:30464378-30464400 GATGATGGTGATGGTGATGATGG + Intergenic
904431048 1:30464533-30464555 GATGATGGTGATGGTGATGATGG + Intergenic
904433776 1:30480883-30480905 GATGATGATGATGACAATGATGG + Intergenic
904434958 1:30488752-30488774 GATGATGGTGATGGTAATGGTGG + Intergenic
904864233 1:33564070-33564092 GATGATGATGATGAAGATGATGG - Intronic
904906414 1:33900394-33900416 GATGATGGGGATCCAATTTCTGG + Intronic
906711966 1:47937384-47937406 GATGATGGTGATGATTATGATGG - Intronic
906711968 1:47937414-47937436 GATGATGGTGATGATCATGATGG - Intronic
906803393 1:48756878-48756900 GATGATGGTGACTCAGATCAGGG + Intronic
906955298 1:50369154-50369176 GATGATGGTGATGGTGATGATGG + Intergenic
906955299 1:50369169-50369191 GATGATGGTGATGATGATGATGG + Intergenic
906955318 1:50369300-50369322 GATGATGGTGATGATGATGATGG + Intergenic
906955338 1:50369483-50369505 GATGATGGTGATGATGATGATGG + Intergenic
907222147 1:52914921-52914943 GATGACTGTGACCCAAATGTGGG - Intronic
907751568 1:57268296-57268318 GATGATGCTGCTGCAAAAGAAGG + Intronic
908466570 1:64402092-64402114 GAAGATGGTGAACAAAACGATGG - Intergenic
908482362 1:64554770-64554792 GATGATGATGTTCCATATTAGGG + Intronic
908573431 1:65434274-65434296 GATCATGGTGACACAAATGTTGG + Exonic
909230203 1:73079414-73079436 GATGATGGTGGTTCAGAAGAGGG + Intergenic
909879993 1:80863196-80863218 GATGATGATGATGAAAGTGATGG - Intergenic
910058685 1:83062673-83062695 GATGATGGTAATTTAAATGAGGG + Intergenic
910500014 1:87879639-87879661 GATGATGATGATGATAATGATGG + Intergenic
911139640 1:94485291-94485313 GATGATGGTGGTGGACATGATGG + Intronic
911766532 1:101682922-101682944 GATGATGGTGATGATGATGATGG + Intergenic
914673780 1:149892145-149892167 GATGATGGTAAACAGAATGATGG + Intronic
914901782 1:151715029-151715051 GATGATGGTGATCAAGATGGAGG - Intronic
915068003 1:153243099-153243121 GATGGTGGTGGTGGAAATGATGG - Intergenic
916003658 1:160639606-160639628 GATGATGGTGGTGGAAATGCAGG - Intronic
916578960 1:166090825-166090847 GATGATGGTGACCATAATGATGG + Intronic
918598786 1:186327470-186327492 GAGGATGATGATGAAAATGATGG - Exonic
921161014 1:212472164-212472186 GGTGATGATGAGCCCAATGAGGG - Intergenic
921316363 1:213895213-213895235 GATGATGGTGATGGTGATGATGG + Intergenic
922956215 1:229602978-229603000 GATGGTGGTGATCCCCAGGAGGG - Intronic
922964154 1:229674091-229674113 GATGATGGAGATGCAGATGTAGG + Intergenic
1062912356 10:1219809-1219831 GATGATGGTGATGGTAATGATGG + Intronic
1062912372 10:1219917-1219939 GATGATGGTGATGGTGATGATGG + Intronic
1062912396 10:1220062-1220084 GATGATGGTGATGGTGATGATGG + Intronic
1062912405 10:1220119-1220141 GATGATGGTGAAGATAATGATGG + Intronic
1062912409 10:1220149-1220171 GATGATGGTGATGGTAATGATGG + Intronic
1062912418 10:1220212-1220234 GATGATGGTGATGGTGATGATGG + Intronic
1062950393 10:1495852-1495874 AATGATGGTGATGAAGATGATGG - Intronic
1062950395 10:1495888-1495910 GATAATGTTGATACTAATGAAGG - Intronic
1062950402 10:1496017-1496039 GATGAGGTTGATACTAATGATGG - Intronic
1062950412 10:1496296-1496318 GATGATGTTGATACTGATGATGG - Intronic
1063444393 10:6100573-6100595 GATGATGGTGATGATGATGATGG + Intronic
1064094575 10:12413602-12413624 GATGATGGTGATGCTAATTATGG + Intronic
1064415842 10:15149299-15149321 GATGATGGTGATGGTGATGATGG - Intronic
1064415859 10:15149418-15149440 GATGATGGTGATGGTGATGATGG - Intronic
1064415871 10:15149505-15149527 GATGATGGTGGTGATAATGATGG - Intronic
1064425967 10:15229591-15229613 GATGATGGTGATGGTGATGATGG - Intronic
1064425975 10:15229633-15229655 GATGATGGTGATGGTGATGATGG - Intronic
1066328558 10:34392534-34392556 GATGGTGGTGAGGGAAATGAAGG - Intronic
1067730686 10:48809169-48809191 GATGATGGTGATGGTGATGATGG - Intronic
1067730707 10:48809298-48809320 GATGATGGTGATGGTGATGATGG - Intronic
1067770449 10:49118939-49118961 GATGGAGGTGATTGAAATGAGGG + Intergenic
1068566842 10:58585449-58585471 GAATATGGTGATACAAATTAGGG + Intronic
1069186643 10:65430760-65430782 GATGATGGTGATTCTTTTGATGG - Intergenic
1069792648 10:71032910-71032932 GATGATGGTGATGGCAATGATGG + Intergenic
1069792670 10:71033135-71033157 GATTATGGTGATGATAATGATGG + Intergenic
1069852690 10:71420475-71420497 GATGATGGTGATGGTGATGATGG + Intronic
1071243771 10:83740606-83740628 GATCATGCTGATCCAAAAGGTGG + Intergenic
1071488715 10:86121490-86121512 GATGATGGTGATGGTGATGATGG - Intronic
1073663515 10:105504479-105504501 GATGATGGTGATGACAGTGATGG - Intergenic
1074482951 10:113844025-113844047 TATTATGGTTATCAAAATGATGG - Intronic
1074627750 10:115211891-115211913 GATTATGGTGCTACAAATGTTGG + Intronic
1075069748 10:119313088-119313110 GATGGTGGTGATGGTAATGATGG + Intronic
1075088056 10:119426743-119426765 GATGATGGTGATACTGATGATGG - Intronic
1075088064 10:119426832-119426854 GATGGTGGTGATGCTGATGATGG - Intronic
1075088108 10:119427365-119427387 GATGGTGGTGATGCTGATGATGG - Intronic
1075088116 10:119427455-119427477 GATGGTGGTGATGCTGATGATGG - Intronic
1075088123 10:119427527-119427549 GATGGTGGTGATACTGATGATGG - Intronic
1075088128 10:119427563-119427585 GATGGTGGTGATGCTGATGATGG - Intronic
1075088139 10:119427709-119427731 GATGGTGGTGATACTAATGATGG - Intronic
1075088147 10:119427781-119427803 GATGGTGGTGATGCTGATGATGG - Intronic
1075487894 10:122841025-122841047 GATGATGGTGATGAGGATGATGG - Intronic
1075533984 10:123255034-123255056 GATGATGGTGATGATAATGATGG - Intergenic
1075533995 10:123255101-123255123 GATGATGGTGATGGTAATGGTGG - Intergenic
1075534002 10:123255136-123255158 GATGATGGTGATGGTAATGGTGG - Intergenic
1075534017 10:123255217-123255239 GATGATGGTGATGGTAATGATGG - Intergenic
1075534044 10:123255370-123255392 GATGATGGTGATGGTAATGATGG - Intergenic
1075534050 10:123255405-123255427 GATGATGGTGATGGTAATGTTGG - Intergenic
1075534056 10:123255440-123255462 GATGATGGTGATGGTAATGGTGG - Intergenic
1075534061 10:123255472-123255494 GATGATGGTGATGGTAATGGTGG - Intergenic
1075534066 10:123255504-123255526 GATGATGGTGATGGTAATGATGG - Intergenic
1075534072 10:123255539-123255561 GATGATGGTGATGGTAATGTTGG - Intergenic
1075534106 10:123255699-123255721 GATGATGGTGATGGTAATGGTGG - Intergenic
1075534113 10:123255734-123255756 GATGATGGTGATGGTAATGGTGG - Intergenic
1075534121 10:123255766-123255788 AATGATGGTGATGGTAATGATGG - Intergenic
1075534129 10:123255815-123255837 GATGATGGTGATGGTAATGGTGG - Intergenic
1075534140 10:123255893-123255915 GATGATGGTGATGATAATGGTGG - Intergenic
1075549356 10:123380614-123380636 GATGATGGTGATGATAATGATGG - Intergenic
1075622185 10:123936043-123936065 GATGATGGTGATGGTGATGATGG - Intronic
1076592204 10:131591243-131591265 GATGATGGTGATGCTGGTGATGG - Intergenic
1076625117 10:131816869-131816891 GATGATGATGATCAGAAAGATGG + Intergenic
1076677521 10:132154891-132154913 GATGATCGTGATCATGATGACGG + Intronic
1076720912 10:132392566-132392588 GATGATGGTGATGGTGATGATGG + Intergenic
1077417160 11:2429731-2429753 GATGATGGTGATGATGATGATGG + Intergenic
1077546659 11:3174030-3174052 GATGATGGTGATGATGATGAAGG - Intergenic
1077552479 11:3207025-3207047 GATGATGGTGATGGTGATGACGG + Intergenic
1077552489 11:3207106-3207128 GATGATGGTGATGGTGATGATGG + Intergenic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1078639062 11:13078566-13078588 GCTCATGGTGATCCAGATGTTGG - Intergenic
1079400875 11:20105478-20105500 GATGATGGTGATCCAAATGATGG - Intronic
1079531396 11:21458880-21458902 GATGATGGTGATGGTGATGAAGG - Intronic
1080216368 11:29846128-29846150 GGTGATGGTAATCAAAATGATGG + Intergenic
1082203707 11:49405354-49405376 GATGATGGTGATCGTAACAATGG - Intergenic
1082682324 11:56190721-56190743 GAAGATGGTGACCCACATCATGG + Intergenic
1083261103 11:61523648-61523670 GATGAGGGTGCTCCAAAGGGGGG + Intronic
1083716804 11:64582163-64582185 GATGGTGGTGATTGAGATGATGG - Intergenic
1083716810 11:64582205-64582227 GATGGTGGTGATTGAGATGATGG - Intergenic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084443384 11:69189084-69189106 GATGATGGTGATGATGATGATGG - Intergenic
1084444315 11:69194706-69194728 GATGATGGTGATACTGGTGATGG + Intergenic
1084444326 11:69194773-69194795 GATGATGGTGATACTGGTGATGG + Intergenic
1084444340 11:69194879-69194901 GATGATGGTGATACTGGTGATGG + Intergenic
1084444359 11:69195060-69195082 GATGATGGTGATGATGATGATGG + Intergenic
1084459982 11:69291549-69291571 GATGATGGTGGTGATAATGATGG - Intergenic
1084459984 11:69291564-69291586 GATGATGGTGATGGTGATGATGG - Intergenic
1084459993 11:69291641-69291663 GATGATGGTGGTGGTAATGATGG - Intergenic
1084460021 11:69291866-69291888 GATGATGGTGGTGATAATGATGG - Intergenic
1084465823 11:69322480-69322502 GATGATGGTGATGGTAATGGTGG + Intronic
1084581439 11:70026275-70026297 GATGACAGTGATCATAATGATGG + Intergenic
1084686999 11:70702301-70702323 GATGATGGTGATTGTGATGATGG - Intronic
1084701149 11:70787014-70787036 GATGATGGTGATGCTGGTGATGG - Intronic
1084738798 11:71124166-71124188 GATGATGGTGATGGTGATGATGG + Intronic
1084738800 11:71124181-71124203 GATGATGGTGATGGTGATGATGG + Intronic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1084935245 11:72583437-72583459 GATGATGATGTACCACATGAAGG - Exonic
1085227477 11:74935475-74935497 GATGATGGTGGCCCAGATAAGGG + Intronic
1086121980 11:83313955-83313977 GATGATGATGATTACAATGATGG + Intergenic
1086182397 11:83969190-83969212 GAGGCTTGTGATCCAATTGATGG - Intronic
1086291917 11:85321091-85321113 GATGATAGTGATTTGAATGAGGG + Intronic
1086564490 11:88210227-88210249 GATGTTGATGGTCCAAATGGAGG - Intergenic
1086651381 11:89295081-89295103 GATGATGGTGATCGTAACAATGG + Intronic
1088691646 11:112333503-112333525 GATGATGATGATGAAGATGATGG + Intergenic
1089495114 11:118903935-118903957 CAAGCTGATGATCCAAATGATGG + Intronic
1089613542 11:119682747-119682769 GATGATGGTGATGATGATGATGG - Intronic
1090001459 11:122963476-122963498 GATGACGTGGAGCCAAATGAAGG - Intergenic
1090351528 11:126111365-126111387 AATGATGCTGACCCAAAAGAAGG + Intergenic
1090971841 11:131650626-131650648 GATGATGGTGATGATGATGATGG - Intronic
1091179078 11:133587337-133587359 GATGATGGTGATAAGAATAATGG + Intergenic
1091255282 11:134178732-134178754 GATGATGGTGCTGCAAAGAAGGG + Exonic
1091668871 12:2438343-2438365 GATGATGGTGGTGGTAATGATGG + Intronic
1092278813 12:7083455-7083477 GATGATGGTGATGGAGGTGATGG + Intronic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1092555088 12:9550595-9550617 AATGTTGGTGATGGAAATGAGGG + Intergenic
1094517008 12:31140079-31140101 AATGTTGGTGATGGAAATGAGGG - Intergenic
1094822387 12:34236450-34236472 GATGATGGTGATGGTGATGATGG - Intergenic
1095092313 12:38118733-38118755 GATGATGGTGATGATGATGATGG + Intergenic
1095092347 12:38119013-38119035 GATGATGGTGATGGAGATGACGG + Intergenic
1095108085 12:38259558-38259580 GATGTTGGTGGGCCAAATAAGGG + Intergenic
1097928048 12:65153103-65153125 GATTATGATGATCAAAATAAAGG - Intergenic
1099109671 12:78542738-78542760 CATGATGGTTATGCAAATTAAGG - Intergenic
1099228648 12:79997953-79997975 GATGAAGGTGATCAATGTGAGGG + Intergenic
1101183417 12:102246223-102246245 GATGATGGTGATGATGATGATGG + Intergenic
1101331395 12:103760609-103760631 GATGATGGTGATGATACTGATGG + Intronic
1101735877 12:107462516-107462538 GATGGTGGTGATAGCAATGATGG + Intronic
1101735923 12:107463097-107463119 GATGATGGTGATAGTGATGATGG + Intronic
1101744591 12:107529301-107529323 GATGATGATGATGGAGATGATGG + Intronic
1101826947 12:108227768-108227790 GATGGTGATGATCATAATGATGG + Intronic
1101927207 12:108982192-108982214 GATGATGGAGATCATGATGATGG - Intronic
1101927217 12:108982305-108982327 GGTGATGATGATGAAAATGATGG - Intronic
1101927225 12:108982419-108982441 GATGATGGTGATCATGATGATGG - Intronic
1101927244 12:108982650-108982672 AATGATGGTGATCATGATGATGG - Intronic
1101927245 12:108982665-108982687 GATGATGGTGATGATAATGATGG - Intronic
1101927246 12:108982680-108982702 GATGATGGTGATGATGATGATGG - Intronic
1101927252 12:108982803-108982825 GATGATGGTGATGATGATGATGG - Intronic
1101927267 12:108983049-108983071 GATGATGGTGATGGTGATGATGG - Intronic
1101927270 12:108983073-108983095 GATGATGGTGATCATGATGATGG - Intronic
1101927271 12:108983088-108983110 GATGATGGTGATCATGATGATGG - Intronic
1102176670 12:110880805-110880827 GATGATGGTGATGGTAGTGATGG + Intronic
1103199488 12:119075391-119075413 GATGATGATGATGATAATGATGG + Intronic
1103199515 12:119075703-119075725 GATGATGGTGATGTTGATGATGG + Intronic
1103201260 12:119089811-119089833 GATGATGGTGATGGTGATGATGG - Intronic
1103248633 12:119480563-119480585 GATGATGGTGATGATGATGATGG - Intronic
1103248634 12:119480578-119480600 GATGATGGTGATGAGGATGATGG - Intronic
1103248636 12:119480593-119480615 GATGATGGTGATGGTGATGATGG - Intronic
1103248645 12:119480686-119480708 GATGATGGTGATGATAATGGTGG - Intronic
1103248656 12:119480755-119480777 GATGATGGTGATGATGATGATGG - Intronic
1103248690 12:119481025-119481047 GATGATGGTGATGATGATGATGG - Intronic
1103248694 12:119481055-119481077 GATGATGGTGATGATGATGATGG - Intronic
1103248695 12:119481070-119481092 GATGATGGTGATGATGATGATGG - Intronic
1103262409 12:119598925-119598947 GATGATGGTGATGTAGATGATGG + Intronic
1103799033 12:123525162-123525184 ATTGATGGTGATCATAATGACGG + Intronic
1103871097 12:124092592-124092614 GATGATGGTGATGGTGATGATGG + Intronic
1103871107 12:124092653-124092675 GATGATGGTGATGGTGATGATGG + Intronic
1103871115 12:124092730-124092752 GATGATGGTGATGGTGATGATGG + Intronic
1103871129 12:124092872-124092894 GATGATGGTGATGGTGATGATGG + Intronic
1103871133 12:124092911-124092933 GATGATGGTGATGGTGATGATGG + Intronic
1103871144 12:124093017-124093039 GATGATGGTGATGGTGATGATGG + Intronic
1103871213 12:124093592-124093614 GGTGATGGTGATGATAATGATGG + Intronic
1103871218 12:124093637-124093659 GATGATGGTGATGGTGATGATGG + Intronic
1104364570 12:128165306-128165328 GATGTTGGTGATGGCAATGATGG - Intergenic
1104375429 12:128262027-128262049 GATGATGGTGATGATGATGATGG + Intergenic
1104421464 12:128639235-128639257 GATGATGGTGATAATGATGATGG + Intronic
1104421465 12:128639250-128639272 GATGATGGTGATGATGATGATGG + Intronic
1104421477 12:128639405-128639427 GATGATGATGATAATAATGATGG + Intronic
1104484313 12:129136765-129136787 GATGATGGTGATGGTGATGATGG - Intronic
1104484315 12:129136780-129136802 GATGATGGTGATGGTGATGATGG - Intronic
1104484355 12:129137181-129137203 GATGATGGTGATTGTGATGATGG - Intronic
1104596406 12:130123064-130123086 GATGATGGTGATAATAACGATGG - Intergenic
1104613321 12:130248010-130248032 GATGATGGTGATGGTGATGATGG + Intergenic
1104683201 12:130766657-130766679 GATGATGGTGTTGGTAATGATGG - Intergenic
1104744024 12:131199501-131199523 GATGATGGTGATGGTGATGATGG - Intergenic
1104762176 12:131303912-131303934 GATGATGGTGATAACGATGATGG - Intergenic
1104762196 12:131304174-131304196 GATGATGGTGATGAGGATGATGG - Intergenic
1104776982 12:131395590-131395612 GATGATGGTGATGATGATGATGG + Intergenic
1104776991 12:131395671-131395693 GATGATGGTGATGGTGATGATGG + Intergenic
1104776995 12:131395713-131395735 GATGATGGTGATGGTGATGATGG + Intergenic
1104776999 12:131395749-131395771 GATGATGGTGATGATGATGATGG + Intergenic
1104777013 12:131395938-131395960 GATGATGGTGATGATGATGATGG + Intergenic
1104777021 12:131396029-131396051 GATGATGGTGATGGTGATGATGG + Intergenic
1104777027 12:131396080-131396102 GATGATGTTGATGATAATGATGG + Intergenic
1104777422 12:131399061-131399083 GATGATGGTGATGGTGATGATGG + Intergenic
1104798846 12:131539416-131539438 GATGATGGTGATGGTGATGATGG + Intergenic
1104798852 12:131539467-131539489 GATGATGGTGATGGTGATGATGG + Intergenic
1104817580 12:131656622-131656644 GATGATGGTGATGAGGATGATGG + Intergenic
1104817600 12:131656884-131656906 GATGATGGTGATAACGATGATGG + Intergenic
1104932967 12:132349819-132349841 GATGATGGTGATGGTGATGATGG - Intergenic
1104932976 12:132349895-132349917 GATGATGGTGATGGTGATGATGG - Intergenic
1104932979 12:132349925-132349947 GATGATGGTGATGATAGTGATGG - Intergenic
1104955537 12:132463614-132463636 GATGATGGTGATGGTGATGATGG - Intergenic
1104955564 12:132463860-132463882 GATGATGGTGATGGTGATGATGG - Intergenic
1104955583 12:132464013-132464035 GATGATGGTGATGGTGATGATGG - Intergenic
1104955594 12:132464232-132464254 GATGATGGTGATGGTGATGATGG - Intergenic
1104955607 12:132464358-132464380 GATGATGGTGATGGTGATGATGG - Intergenic
1105009041 12:132742786-132742808 GATGATGGTGATGGTGATGATGG - Intronic
1105294306 13:19074786-19074808 GATGATGGTGATGGTGATGATGG - Intergenic
1106017406 13:25882934-25882956 GATGATGGTGATGGTGATGATGG + Intronic
1106218809 13:27727514-27727536 GATGATGATGATGGAGATGATGG + Intergenic
1107171791 13:37351228-37351250 GATGATGATGATGATAATGATGG + Intergenic
1107256405 13:38432806-38432828 GATGATGGTGATTCAGATAGAGG + Intergenic
1107579288 13:41764986-41765008 GATGATGGTGGTCTAAACTACGG + Intronic
1107813812 13:44225937-44225959 GATGATGATGATGATAATGATGG - Intergenic
1107890915 13:44913634-44913656 GATGATGGTGATGATGATGACGG + Intergenic
1111867983 13:93793679-93793701 TATGATGGTGATGAAGATGACGG + Intronic
1112251315 13:97783318-97783340 GGTGATGTTTATCAAAATGATGG + Intergenic
1112316677 13:98369247-98369269 ACTGATGGTGTTCCAAAAGAGGG + Intronic
1113717885 13:112526597-112526619 GATGATGGTGATGATGATGATGG - Intronic
1113899127 13:113786492-113786514 GATGATGGTGATGGTGATGATGG - Intronic
1113930462 13:113965748-113965770 GATGATGGTGATGGTGATGATGG + Intergenic
1113930464 13:113965763-113965785 GATGATGGTGATGGTGATGATGG + Intergenic
1113930477 13:113965859-113965881 GATGATGGTGATGGTGATGATGG + Intergenic
1113930497 13:113966048-113966070 GATGCTGGTGATGGGAATGATGG + Intergenic
1113930512 13:113966200-113966222 GATGATGGTGATTATAATGGTGG + Intergenic
1113930526 13:113966311-113966333 GATGCTGGTGATGGGAATGATGG + Intergenic
1115574197 14:34694950-34694972 GGTGCTGGAGATCCAAATTAAGG + Intergenic
1115787774 14:36845639-36845661 GATGAATATGATCCAATTGATGG + Intronic
1117149192 14:52867939-52867961 GATGATAGTAATCCAAATTAAGG - Intronic
1121096332 14:91220381-91220403 GATGATGATGATGATAATGACGG - Intronic
1121630690 14:95419833-95419855 GATGATGGTGATGGTGATGATGG + Intronic
1121630693 14:95419848-95419870 GATGATGGTGATGGAGGTGATGG + Intronic
1121841225 14:97135841-97135863 GATGATGGTGGTGGCAATGATGG - Intergenic
1121841245 14:97135956-97135978 GATGATGGTGGTGCTAATGATGG - Intergenic
1122005013 14:98695948-98695970 GATGATGATGATGATAATGATGG + Intergenic
1122005018 14:98695996-98696018 GATGATGGTGATGATGATGATGG + Intergenic
1122180682 14:99952247-99952269 GATGGTGGTGATGCTGATGATGG + Intergenic
1122265066 14:100542728-100542750 GATGATGGTGGCTCAGATGACGG - Intronic
1122801465 14:104232059-104232081 GATGATGGTGATGATGATGATGG - Intergenic
1122801479 14:104232172-104232194 GATGATGGTGATGGTAATGATGG - Intergenic
1122801500 14:104232359-104232381 GATAATGGTGATGAAGATGATGG - Intergenic
1122801507 14:104232485-104232507 GATGATGGTGATGATAATGATGG - Intergenic
1124181135 15:27475694-27475716 GATGATGGTGATAGTAATAATGG + Intronic
1130135064 15:81175539-81175561 GATGATGGTGATGGTAGTGATGG - Intronic
1130784925 15:87085526-87085548 GATGATGCTGGTCCACATGGTGG + Intergenic
1132787874 16:1668158-1668180 GCTGATGGCGATCTCAATGATGG - Exonic
1133545036 16:6797951-6797973 GATGATGGTGATCACGGTGATGG + Intronic
1134011837 16:10859622-10859644 GATGATGGTGATGGTGATGATGG + Intergenic
1134808142 16:17143216-17143238 GATGATGGTAATGGCAATGATGG - Intronic
1134808197 16:17143721-17143743 GATGATGGTAATGGCAATGATGG - Intronic
1134912152 16:18037221-18037243 GATGATGGTGATGATAATGATGG + Intergenic
1135539055 16:23316068-23316090 GGTGATGGTGATCCTGATGGTGG - Intronic
1135539081 16:23316221-23316243 GGTGATGGTGATCCTGATGGTGG - Intronic
1135539128 16:23316515-23316537 GGTGATGGTGATCCTGATGGTGG - Intronic
1135539152 16:23316668-23316690 GATGATGGTGATGGTGATGATGG - Intronic
1135539165 16:23316758-23316780 GATGATGGTGATGGTGATGATGG - Intronic
1135882653 16:26273832-26273854 GATGATGGTGATGATAGTGATGG + Intergenic
1137800760 16:51260040-51260062 GATGATGATGATGACAATGATGG + Intergenic
1139307606 16:66000727-66000749 GATGATGATGATCTAAAGCAAGG - Intergenic
1139358285 16:66380478-66380500 GATGGTGGTGATCACGATGATGG + Intronic
1140357062 16:74315480-74315502 GATGATGGTGATGATGATGATGG - Intergenic
1140741846 16:77948394-77948416 GATGATGGTGTTGCAAATGAGGG - Intronic
1140834836 16:78783695-78783717 GATCATGGTGATGAAGATGAGGG + Intronic
1140834839 16:78783737-78783759 GATGATGGTGATGGTGATGATGG + Intronic
1141029662 16:80576423-80576445 GATGATGGTGATGATGATGATGG + Intergenic
1141029675 16:80576600-80576622 GATGATGGTGATGATGATGATGG + Intergenic
1141319825 16:82997064-82997086 GATGGTGGTGATGGTAATGACGG + Intronic
1141319837 16:82997148-82997170 GATGATGGTGATGATAGTGATGG + Intronic
1141366047 16:83444159-83444181 GATGATGGTGATGGTGATGATGG + Intronic
1141731065 16:85823352-85823374 GATGATGGTGATGGTTATGATGG - Intergenic
1141813645 16:86393868-86393890 GATGATGGTGATGATGATGATGG - Intergenic
1141813659 16:86394008-86394030 GATGATGGTGATGATGATGATGG - Intergenic
1141817113 16:86419092-86419114 GATGATGGTGATGATGATGATGG + Intergenic
1141817121 16:86419173-86419195 GATGATGGTGATGATGATGATGG + Intergenic
1141823640 16:86464309-86464331 GATGATGGTGATGGTAATGATGG + Intergenic
1141823649 16:86464357-86464379 GGTGATGGTGATGGTAATGATGG + Intergenic
1141843121 16:86587447-86587469 GATGATGGTGATGATAATGATGG - Intergenic
1141843180 16:86587834-86587856 GATGATGGTGATGATGATGATGG - Intergenic
1141843231 16:86588242-86588264 GATGATGGTGATGATGATGATGG - Intergenic
1141880074 16:86852095-86852117 GATGATGGTGATGGTGATGATGG - Intergenic
1141880106 16:86852373-86852395 GATGATGGTGATGGTGATGATGG - Intergenic
1141881240 16:86861088-86861110 GATGATGGTGATGATAAGGATGG + Intergenic
1141881249 16:86861148-86861170 GATGATGGTGATGATAAGGATGG + Intergenic
1141881305 16:86861544-86861566 GATGATGGTGATGATAATGGTGG + Intergenic
1141894659 16:86951412-86951434 GATGATGGTGATGGTGATGATGG - Intergenic
1141894669 16:86951538-86951560 GATGATGGTGATGGTGATGATGG - Intergenic
1141894684 16:86951693-86951715 AATGATGGTGATGGTAATGATGG - Intergenic
1141931767 16:87209790-87209812 GATGATGGTGATGATGATGACGG + Intronic
1141931776 16:87209861-87209883 GATGATGGTGATGGTGATGACGG + Intronic
1141931798 16:87210017-87210039 GGTGATGGTGATGGTAATGATGG + Intronic
1141931865 16:87210527-87210549 GATGGTGGTGATGGCAATGATGG + Intronic
1141932221 16:87213503-87213525 GATGATGGTGACATTAATGATGG + Intronic
1141988771 16:87597714-87597736 GATGATGGTGATGGTGATGATGG - Intergenic
1142064528 16:88053564-88053586 GATGATGATGATGGAGATGATGG - Intronic
1142064628 16:88054158-88054180 GATGATGATGATGGAGATGATGG - Intronic
1142087688 16:88192921-88192943 GATGATGGTGATAGTGATGATGG + Intergenic
1142087692 16:88192957-88192979 GATGATGGTGATGGTAGTGATGG + Intergenic
1142103541 16:88289290-88289312 GATGATGGTGATGAGGATGATGG + Intergenic
1142111031 16:88331674-88331696 GATGATGGTGATAATAGTGATGG - Intergenic
1142111047 16:88331815-88331837 GATGATGGTGATGATAGTGATGG - Intergenic
1142118205 16:88371849-88371871 GATGATGGTGATGGTGATGATGG - Intergenic
1142118228 16:88372005-88372027 GATGATGGTGATGGTGATGATGG - Intergenic
1142118287 16:88372389-88372411 GATGATGGTGATGGTAGTGATGG - Intergenic
1142118289 16:88372404-88372426 GATGATGGTGATGGTGATGATGG - Intergenic
1142208913 16:88798291-88798313 GATAATGGTGATGGTAATGATGG + Intergenic
1142267040 16:89068926-89068948 GATGATGGTGATGATGATGATGG + Intergenic
1142267051 16:89069010-89069032 GATGATGGTGATGATGATGATGG + Intergenic
1142267078 16:89069214-89069236 GATGATGGTGATGATGATGATGG + Intergenic
1142503017 17:344192-344214 GATGATGGTGATGATGATGAGGG - Intronic
1142503053 17:344533-344555 GATGATGGTGATCATGATGATGG - Intronic
1143916523 17:10297556-10297578 GATGATGGTGATGGTGATGATGG + Intergenic
1143916575 17:10297955-10297977 GATGATGGTGATAATGATGACGG + Intergenic
1143978319 17:10846526-10846548 GATGGTGGTGGTGGAAATGAAGG + Intergenic
1143978369 17:10846745-10846767 GATGGTGGTGGTGGAAATGAAGG + Intergenic
1143978404 17:10846889-10846911 GATGGTGGTGGTGGAAATGAAGG + Intergenic
1144719697 17:17460124-17460146 GATGGTGGTGATGGTAATGATGG - Intergenic
1146643628 17:34561453-34561475 GACGATGGTGATGACAATGATGG + Intergenic
1146675401 17:34770052-34770074 GATGATGGTGATGGTAATGATGG + Intergenic
1146675404 17:34770100-34770122 GATGATGTTGATAATAATGATGG + Intergenic
1147383028 17:40066751-40066773 GATGATGGTGATGATCATGACGG + Intronic
1149579807 17:57741727-57741749 GATGAAGGTGAAGCAACTGAAGG + Intergenic
1151432835 17:74076205-74076227 GATGGTGGTGATCATAGTGATGG + Intergenic
1151432918 17:74076750-74076772 GATGATGGTGGTGGTAATGATGG + Intergenic
1151981143 17:77509850-77509872 GATGATCGTGATGCTAATGATGG - Intergenic
1152131343 17:78478542-78478564 GATGATGGTGATTGTCATGATGG - Intronic
1152371944 17:79893728-79893750 GATGATGGTGATGGTGATGATGG - Intergenic
1152371947 17:79893761-79893783 GATGATGGTGATGATGATGATGG - Intergenic
1152499842 17:80700564-80700586 GATGATGGTGATGGTGATGATGG + Intronic
1152499859 17:80700657-80700679 GATGATGGTGATGGTGATGATGG + Intronic
1152658555 17:81531242-81531264 GATGATGGTGATGGTGATGATGG + Intronic
1152658577 17:81531347-81531369 GATGATGGTGATGGTGATGATGG + Intronic
1152658612 17:81531539-81531561 GATGATGGTGATGGCGATGATGG + Intronic
1152658613 17:81531554-81531576 GATGATGGTGATGATAGTGATGG + Intronic
1152658635 17:81531734-81531756 GATGATGGTGATGATAGTGATGG + Intronic
1152658637 17:81531758-81531780 GATGATGGTGATGATAGTGATGG + Intronic
1152658656 17:81531875-81531897 GATGATGGTGATGGCGATGATGG + Intronic
1152658680 17:81532091-81532113 GATGATGGTGATGATAGTGATGG + Intronic
1152658682 17:81532115-81532137 GATGATGGTGATGATAGTGATGG + Intronic
1152658707 17:81532313-81532335 GATGATGGTGATGATAGTGATGG + Intronic
1152658714 17:81532388-81532410 GATGATGGTGATGATAGTGATGG + Intronic
1152658745 17:81532625-81532647 GATGATGGTGATGGTGATGATGG + Intronic
1152659382 17:81535357-81535379 GATGATGGTGATGGAGATGGTGG - Intronic
1152659433 17:81535516-81535538 GATGATGGTGATGGAGATGGTGG - Intronic
1153703853 18:7725106-7725128 AATGATGGACATCTAAATGATGG + Intronic
1154347781 18:13557807-13557829 GATGATGGTGATGATCATGATGG - Intronic
1154405632 18:14087808-14087830 AATGATGGTGATGACAATGATGG - Intronic
1155784297 18:29877834-29877856 CATTTTGATGATCCAAATGATGG - Intergenic
1156042180 18:32835198-32835220 GATGATGGTGGTCTGGATGAGGG + Intergenic
1156973599 18:43189063-43189085 GATGATGGTGATAATAATGATGG - Intergenic
1157305816 18:46516863-46516885 GATGATGGTGATAGGGATGAAGG - Intronic
1158045288 18:53148299-53148321 AAGGATGGTGATGCACATGAAGG + Intronic
1158569925 18:58589616-58589638 GATGATGATGATTGAAATGTAGG - Intronic
1160143189 18:76344353-76344375 GATGATGGTGATAGTGATGATGG + Intergenic
1160143192 18:76344368-76344390 GATGATGGTGATGGTGATGAGGG + Intergenic
1160143194 18:76344392-76344414 GATAATGGTGATACTAATGATGG + Intergenic
1160143201 18:76344485-76344507 GATGATGGTGATGGTGATGATGG + Intergenic
1161642243 19:5431612-5431634 GATGATGGTGATGGTGATGAAGG + Intergenic
1161881307 19:6955246-6955268 GATGATGGTGATGTTGATGAAGG + Intergenic
1161881319 19:6955365-6955387 GATGATGGTGATAGTGATGATGG + Intergenic
1161881321 19:6955380-6955402 GATGATGGTGATGGTGATGATGG + Intergenic
1161899385 19:7106723-7106745 GATGATAGTGATGGTAATGAGGG + Intergenic
1161899406 19:7106912-7106934 GATGATGGTGATGATTATGATGG + Intergenic
1161899481 19:7107725-7107747 GATGATGGTGATAATTATGATGG + Intergenic
1161929807 19:7331269-7331291 GATGATGGTGATGACAATGATGG - Intergenic
1161929812 19:7331311-7331333 GATGATGGTGATGATGATGATGG - Intergenic
1161929822 19:7331413-7331435 CATGATGGTGATGACAATGATGG - Intergenic
1163050343 19:14678589-14678611 GATGGTGGTGATGCCAATAATGG + Intronic
1163321946 19:16579950-16579972 AGGGATGGTGAGCCAAATGAGGG - Intronic
1164274672 19:23705929-23705951 GATTATGCTGATGCAAAAGATGG - Intergenic
1164559689 19:29281766-29281788 TAGTATGGTGATTCAAATGATGG + Intergenic
1164708545 19:30338361-30338383 GATGATGGTGATAATAATGGTGG + Intronic
1164721465 19:30434795-30434817 GATGATGGTGATGGTGATGATGG + Intronic
1164721476 19:30434936-30434958 GATGATGGTGATAATGATGATGG + Intronic
1164772838 19:30825080-30825102 GATGATGGTGATGGTGATGATGG + Intergenic
1166225390 19:41391996-41392018 GAGGAAGGTGAGTCAAATGAAGG - Intronic
1168361767 19:55746804-55746826 GATGATGGTGATGATGATGACGG + Intergenic
1168574574 19:57499416-57499438 GATGATGGAGATGGAGATGATGG - Intronic
1168574576 19:57499431-57499453 GATGATGGAGATGGAGATGATGG - Intronic
1168574580 19:57499482-57499504 GATGATGGAGATGGAGATGATGG - Intronic
1168574597 19:57499623-57499645 GATGATGGAGATGGAGATGATGG - Intronic
1168574600 19:57499656-57499678 GATGATGGAGATGGAGATGATGG - Intronic
925330857 2:3057641-3057663 GAAGATGGTGATGATAATGATGG + Intergenic
926132397 2:10312173-10312195 GATGATGGTGATGGTGATGATGG - Intronic
926132419 2:10312450-10312472 GATGATGGTGATGGTGATGATGG - Intronic
926446928 2:12954262-12954284 TATTATGGTGATCTCAATGAAGG + Intergenic
927901360 2:26821364-26821386 GATTATGATGATCAAAAAGAGGG - Intergenic
930960709 2:57257412-57257434 GATGATGATGATCTTAATGTTGG + Intergenic
931376388 2:61712167-61712189 GATGATGATGGTGCAAAAGAAGG - Intergenic
932450483 2:71807501-71807523 GATGGTGGTGATGAAGATGATGG + Intergenic
932460203 2:71877169-71877191 GATGATGGTGATAAAGCTGAAGG + Intergenic
934542302 2:95185736-95185758 GGTGATGGGGATCCTAGTGAGGG + Intergenic
935396307 2:102613047-102613069 GATGATGGTGATGGCAACGATGG - Intergenic
935832632 2:107016662-107016684 GGTGATGGGCATCTAAATGAAGG - Intergenic
936327050 2:111514341-111514363 GATGATGGTTATGGAGATGATGG - Intergenic
936730987 2:115381703-115381725 GATGATGGTGATCTACAGGTGGG + Intronic
936864919 2:117066559-117066581 GATAAGGGTAATTCAAATGAGGG - Intergenic
937020200 2:118643474-118643496 AATGATGATGAGTCAAATGAAGG - Intergenic
937814529 2:126236805-126236827 GGTGATGGTGATGCATATGTAGG + Intergenic
937968552 2:127533015-127533037 GAGGATGGGTATACAAATGATGG + Intergenic
938115330 2:128599047-128599069 GATGATGGTGATAACAATTATGG - Intergenic
938312844 2:130304866-130304888 GATGATGGTGATGATAGTGATGG + Intergenic
938690174 2:133780705-133780727 GATGATGATGATGATAATGATGG + Intergenic
939325096 2:140678247-140678269 GATGATGGTGAAGGAAATTACGG + Intronic
939546701 2:143563696-143563718 GATGATGGTGATGATCATGATGG - Intronic
940206434 2:151207593-151207615 CATGTTGGTGATCGAAATGGAGG - Intergenic
942072470 2:172328287-172328309 GATGATGGTGATGATGATGATGG - Intergenic
942213777 2:173697878-173697900 GATGATGGTGATGTTAATGGTGG - Intergenic
942407877 2:175675223-175675245 GATGTTGGGGATTCAAATGTTGG - Intergenic
944279968 2:197884762-197884784 GATGATGGTGATTTAAATTGTGG - Intronic
944531430 2:200671627-200671649 GATGATTGTAATCAAAATGATGG + Intronic
944577960 2:201108005-201108027 GGAGATGGTGGTCTAAATGAAGG - Intergenic
945215880 2:207433610-207433632 GTTGGTGCTGACCCAAATGATGG + Intergenic
945557484 2:211297475-211297497 AATGATGGTGCCCAAAATGATGG - Intergenic
946547761 2:220764060-220764082 GATGATGATGATGAAGATGATGG - Intergenic
947545100 2:231005010-231005032 GATGATGGTGATGGTGATGATGG - Intronic
947545141 2:231005265-231005287 GATGATGGTGATGGTGATGATGG - Intronic
947545150 2:231005325-231005347 GATGATGGTGATGGTGATGATGG - Intronic
947545204 2:231005607-231005629 GATGATGGTGATGATGATGATGG - Intronic
947619370 2:231579336-231579358 GATGATGATGATGATAATGATGG - Intergenic
947619386 2:231579627-231579649 GATGACGGTGATGATAATGATGG - Intergenic
948518399 2:238520595-238520617 GATGATGGTGATGGTGATGATGG + Intergenic
948518401 2:238520610-238520632 GATGATGGTGGTAATAATGATGG + Intergenic
1169876979 20:10308863-10308885 GATGATGGTGATTATAATGGTGG - Intergenic
1171269274 20:23800751-23800773 GATGATGGTGATGGTAATGGTGG - Intergenic
1171878897 20:30602208-30602230 GATGATGGTGATGGTGATGATGG - Intergenic
1172114898 20:32567891-32567913 AATGATGGTGATGAAGATGATGG - Intronic
1172114899 20:32567906-32567928 GATGATGGTGGTGGTAATGATGG - Intronic
1172114904 20:32567945-32567967 GATGGTGGTGATGAAGATGATGG - Intronic
1172239925 20:33406131-33406153 GAGGGTGGTGTTCCAAGTGAAGG + Intergenic
1172321526 20:33998776-33998798 GGTGATGGTGTTTCAAATGAAGG + Intronic
1172742608 20:37180763-37180785 GATGATGGTGGCCCAAACCAGGG - Intronic
1172897969 20:38313998-38314020 GATGATGGTGATAGTAATGGTGG + Intronic
1172940651 20:38651688-38651710 GATGATGGTGATGCTGCTGATGG + Intergenic
1172940663 20:38651811-38651833 GATGATGGTGATGCTGCTGACGG + Intergenic
1172940665 20:38651835-38651857 GATGATGGTGATGATGATGATGG + Intergenic
1172940674 20:38651928-38651950 GCTGATGGTGATGATAATGATGG + Intergenic
1174086335 20:48010686-48010708 GGTGATGGTGATATTAATGATGG - Intergenic
1174607171 20:51769045-51769067 GATGATGGTGACCAACAGGAGGG - Intergenic
1174774367 20:53330648-53330670 GATGATGGGGATGCAGAAGAAGG - Intronic
1175127217 20:56761484-56761506 GATGATGGTGATAATAGTGATGG + Intergenic
1175127229 20:56761562-56761584 AATGATGGTGATGATAATGATGG + Intergenic
1175127231 20:56761586-56761608 GATGATGATGATGGTAATGATGG + Intergenic
1175486350 20:59349517-59349539 GATGATGATGATGATAATGATGG + Intergenic
1175509136 20:59510355-59510377 GATGATGGTTATACAACAGAAGG - Intergenic
1175533001 20:59686958-59686980 GATGATGGTGATTGTGATGATGG + Intronic
1175671470 20:60906753-60906775 GATGATGGTGATGATAGTGATGG + Intergenic
1175728725 20:61337303-61337325 AATGATGGTGATAATAATGATGG + Intronic
1175728726 20:61337318-61337340 AATGATGGTGATGATAATGATGG + Intronic
1175764942 20:61585851-61585873 GATAATGGTGATGAAGATGATGG + Intronic
1175764958 20:61585981-61586003 GATGATGGTGATGATGATGATGG + Intronic
1175764972 20:61586076-61586098 GATGATGGTGATGAAGATGATGG + Intronic
1175799811 20:61795080-61795102 GATGATGTTGATGGTAATGATGG + Intronic
1175906480 20:62382144-62382166 GATGATGGTGATGACAATGGTGG + Intergenic
1175933483 20:62504370-62504392 GATGGTGGTGATGGAGATGATGG - Intergenic
1175933486 20:62504388-62504410 GATGGTGATGATGGAAATGATGG - Intergenic
1176118339 20:63443045-63443067 GGTGATGGTGATGCTGATGATGG - Intronic
1176245956 20:64097007-64097029 GATGATGGTGATGGTGATGATGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176661605 21:9640695-9640717 CATGATGCTTAGCCAAATGAAGG + Intergenic
1177929685 21:27265657-27265679 GATGGTGGTGAGAAAAATGAAGG + Intergenic
1178957181 21:37033150-37033172 GATGATGATCATGAAAATGATGG + Intergenic
1180176233 21:46091324-46091346 GATGGTGGTGATGGTAATGATGG + Intergenic
1180919224 22:19511169-19511191 GATGAATGTAATCCAAAAGATGG - Intronic
1181054071 22:20251627-20251649 GAGGATGGTGATGAAGATGATGG - Intronic
1181879897 22:25970093-25970115 GGTGATGATGATGCAAATGGTGG - Intronic
1181879902 22:25970145-25970167 AATGATGGTGATGATAATGATGG - Intronic
1182006816 22:26967252-26967274 GATGATGGTGATGGAGATAATGG + Intergenic
1182011964 22:27008485-27008507 GATGATGGTGATGGTGATGATGG - Intergenic
1182090163 22:27589114-27589136 GATGATGGTGATGATAATGATGG - Intergenic
1183092692 22:35533813-35533835 GATGATGGTGATGATGATGATGG + Intergenic
1183592804 22:38790440-38790462 GAGGATGGTGATGCCACTGATGG + Intronic
1183721601 22:39565983-39566005 GATGATGGTGATGGTGATGATGG + Intergenic
1184263838 22:43335858-43335880 GATGATGGTGATGGTGATGATGG + Intronic
1184263847 22:43335957-43335979 GATGATGGTGATGATGATGATGG + Intronic
1184286614 22:43475472-43475494 GATGATGGTGATGGTGATGATGG + Intronic
1184435972 22:44476849-44476871 GATGAAGGTGAGAAAAATGAAGG - Intergenic
1184436323 22:44479880-44479902 GATGATGGTGATGGTGATGATGG - Intergenic
1184436328 22:44479913-44479935 GATGATGGTGATGATGATGATGG - Intergenic
1184436330 22:44479937-44479959 GATGATGGTGATGTTGATGATGG - Intergenic
1184519444 22:44984125-44984147 GATGATGGTGATCATGATGATGG - Intronic
1184519462 22:44984236-44984258 GATGATGGTGGTGGTAATGAGGG - Intronic
1184519727 22:44986230-44986252 GATGATGGTTGTCATAATGATGG - Intronic
1184534963 22:45080261-45080283 GATGATGGTGATGATGATGATGG - Intergenic
1184534971 22:45080363-45080385 GATGATGGTGATGATGATGATGG - Intergenic
1184534972 22:45080378-45080400 GATGATGGTGATGATGATGATGG - Intergenic
1184534978 22:45080471-45080493 GATGATGGTGATGATGATGATGG - Intergenic
1184666741 22:45993286-45993308 GATGGTGGTGATGGTAATGATGG + Intergenic
1184833936 22:47009390-47009412 GATGGTGATGATGGAAATGATGG - Intronic
1184884774 22:47336129-47336151 GGAGATGGTGATGGAAATGATGG - Intergenic
1184927758 22:47656065-47656087 GATGATGGTGATGGTGATGATGG - Intergenic
1184927781 22:47656314-47656336 GATGATGGTGATCATGATGGTGG - Intergenic
1185003466 22:48261445-48261467 GAGGATGGTGATGGTAATGATGG - Intergenic
1185060701 22:48605128-48605150 GATGATGGTGATGGTGATGATGG + Intronic
1185060715 22:48605218-48605240 GGTGATGGTGATGGTAATGATGG + Intronic
1185078836 22:48698187-48698209 GATGATGGTGACAATAATGATGG + Intronic
1185102164 22:48846473-48846495 CCTGATGGTGTTCCAGATGATGG + Intronic
1185136152 22:49073897-49073919 GATAATGGTGATGGTAATGATGG - Intergenic
1185136159 22:49073953-49073975 GATAATGGTGATGGTAATGATGG - Intergenic
1185209646 22:49563339-49563361 GATGATGATGGTGGAAATGAGGG - Intronic
1185215249 22:49595536-49595558 GATGATGGTGATGGTGATGATGG + Intronic
1185215493 22:49597753-49597775 GATGATGATGATGATAATGATGG + Intronic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
950866204 3:16191105-16191127 GAAGATGGTGAACCAATGGATGG - Intronic
952073815 3:29671265-29671287 GATGATGGTGACCCACAGGTGGG - Intronic
952595494 3:35012780-35012802 GATGTTGGAGATGCAACTGAGGG + Intergenic
954764986 3:52907277-52907299 GATGAGGATGACCCAGATGAAGG - Exonic
955000496 3:54923009-54923031 GATGATGGTGGCCCAAACCAGGG - Intronic
955005548 3:54965392-54965414 GAAGATGGCAATCCAAATGGAGG - Intronic
955620749 3:60861578-60861600 GATGATGATGATAGCAATGATGG - Intronic
955960151 3:64332290-64332312 GATGATGGTGATGGTGATGATGG + Intronic
956661412 3:71601955-71601977 GGTGATGGTGATGACAATGATGG + Intergenic
956787108 3:72651898-72651920 GATGATGGTGATGGTGATGAAGG - Intergenic
957458408 3:80484141-80484163 CATGAAGGTGATCAAAATAAAGG + Intergenic
960043370 3:113172999-113173021 GAAACTGGTGATCCAAATAAGGG + Intergenic
960172746 3:114481873-114481895 GATGATGATGATGCAAAGAACGG + Intronic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
961656542 3:128445570-128445592 GATGGTGGTGATGGCAATGATGG + Intergenic
961657482 3:128451323-128451345 GATGATGGTGAAGCTAGTGACGG + Intergenic
962221487 3:133567960-133567982 GATGATGGTGATGATGATGATGG - Intergenic
963116644 3:141736040-141736062 CATGAAGGTGAACCAAAGGAAGG + Intergenic
963560694 3:146861412-146861434 GATGATGGTGATGATGATGATGG + Intergenic
963560695 3:146861427-146861449 GATGATGGTGATGACGATGATGG + Intergenic
963560699 3:146861499-146861521 GATGATGGTGATGATGATGATGG + Intergenic
964510724 3:157447982-157448004 GATGATGATGATAGAAATCATGG + Intronic
968067672 3:195767784-195767806 GATGATGGTGGTGGCAATGATGG - Intronic
968590051 4:1453452-1453474 GATAATGGTGATGCAGATAATGG - Intergenic
968592873 4:1467964-1467986 GATGATGGTGATGGTAATGATGG + Intergenic
968602050 4:1514169-1514191 GATGATGGTGATGGTGATGATGG + Intergenic
968602224 4:1515452-1515474 GATGATGGTGATGGTGATGATGG + Intergenic
969218515 4:5743388-5743410 GATGATGATAATGAAAATGATGG - Intronic
969234544 4:5856392-5856414 GATGGTGGTGATGGTAATGATGG - Intronic
969234559 4:5856519-5856541 GATGATGGTGATGGTAATGATGG - Intronic
969234578 4:5856658-5856680 GATGATGGTGATGGTAATGATGG - Intronic
969234665 4:5857225-5857247 GATGATGGTGATGGTGATGATGG - Intronic
969234682 4:5857348-5857370 GATGATGGTGATGATAATGGTGG - Intronic
969256254 4:6003682-6003704 GATGATGGTGATGATAGTGATGG + Intergenic
969256263 4:6003776-6003798 GATGATGGTGATGGTGATGATGG + Intergenic
969256265 4:6003791-6003813 GATGATGGTGATGGTGATGATGG + Intergenic
969256271 4:6003853-6003875 GATGATGGTGATGGTGATGATGG + Intergenic
969256280 4:6003930-6003952 GATGATGGTGATGGTGATGATGG + Intergenic
969256289 4:6004035-6004057 GATGATGGTGATGGTGATGATGG + Intergenic
969256295 4:6004097-6004119 GATGATGGTGATGGTGATGATGG + Intergenic
969256296 4:6004112-6004134 GATGATGGTGATAGTGATGATGG + Intergenic
969256298 4:6004127-6004149 GATGATGGTGATGGTGATGATGG + Intergenic
969256303 4:6004175-6004197 GATGATGGTGATGGTGATGATGG + Intergenic
969256305 4:6004190-6004212 GATGATGGTGATGGTGATGATGG + Intergenic
969256326 4:6004362-6004384 GATGATGGTGATGGTGATGATGG + Intergenic
969466919 4:7362835-7362857 GATGATGGTGATAATGATGATGG - Intronic
969485323 4:7469236-7469258 GATGATGGTGATGGAGGTGATGG + Intronic
969503057 4:7565831-7565853 GATGATGGTGATGGTGATGATGG + Intronic
969503068 4:7565938-7565960 GATGATGGTGATGGTAGTGATGG + Intronic
969524290 4:7696260-7696282 GATGATGGGGACCCTGATGACGG - Intronic
969710881 4:8842674-8842696 GATGATGGTGATGGTGATGATGG + Intergenic
970481667 4:16482238-16482260 GATGATGGTGATTATGATGATGG + Intergenic
971173092 4:24253935-24253957 GATGCTGGGGATACCAATGATGG + Intergenic
971703281 4:30007862-30007884 AATGGTGGTGATCCCAATGAAGG - Intergenic
971895317 4:32585628-32585650 GATGATGATGATGATAATGATGG + Intergenic
974251081 4:59383817-59383839 GATGATGATGATGAAGATGATGG - Intergenic
974388165 4:61230137-61230159 CATGATGGTGAATAAAATGAAGG + Intronic
975309482 4:72886917-72886939 GATGATTATGATTAAAATGAGGG - Intergenic
976910996 4:90305225-90305247 GTTAATGCTGATCCAAATGCAGG + Intronic
978525133 4:109657384-109657406 GATGACACTGACCCAAATGAAGG - Intronic
981000218 4:139822123-139822145 GATGATGGTGATTGTGATGATGG - Intronic
981559067 4:146027174-146027196 GATGATGATGATGCTGATGATGG - Intergenic
981725679 4:147844764-147844786 GATGGCGGTGGTTCAAATGAAGG - Intronic
981818603 4:148860321-148860343 AGTGATGGTGATAGAAATGAAGG + Intergenic
981821702 4:148894542-148894564 GATGATGATGATTACAATGATGG + Intergenic
985034739 4:185827054-185827076 GATGATGGTGATGATGATGATGG - Intronic
985034747 4:185827147-185827169 GATGATGGTGATGATGATGATGG - Intronic
985034749 4:185827171-185827193 GATGATGGTGATTCTGATGATGG - Intronic
985034760 4:185827288-185827310 GATGATGGTGATGATGATGATGG - Intronic
985034764 4:185827420-185827442 GATGATGGTGATGATGATGATGG - Intronic
985034771 4:185827687-185827709 GATGATGGTGATGATGATGATGG - Intronic
985034785 4:185827846-185827868 GATGATGGTGACGCTGATGATGG - Intronic
985034787 4:185827879-185827901 GATGATGGTGACGCTGATGATGG - Intronic
985617141 5:929906-929928 GATCATGGTGATGCAAAGGGTGG - Intergenic
985857290 5:2439604-2439626 GATAATGGTGATGATAATGATGG - Intergenic
985978849 5:3445920-3445942 GATGGTGGTGATGGCAATGATGG + Intergenic
985978857 5:3445974-3445996 GATGATGGTGATGGTGATGATGG + Intergenic
985978925 5:3446382-3446404 GATGATGGTGATCATGGTGATGG + Intergenic
986075647 5:4335252-4335274 GATGATGGTGATGATGATGATGG + Intergenic
986279120 5:6308686-6308708 GATGATGGTGATGGTAATGACGG + Intergenic
986289325 5:6386450-6386472 GATGATGGTGATGATGATGACGG + Intergenic
986436786 5:7741935-7741957 GATGATGATGATAATAATGACGG - Intronic
986736307 5:10670102-10670124 GATGATGGTGATGGTAATTATGG + Intergenic
987199856 5:15565854-15565876 GATGAGGGTGACCCATATGAGGG + Intronic
989359014 5:40578201-40578223 GAAAATGGTGATGCAGATGAGGG + Intergenic
990791275 5:59482987-59483009 GATGAGGGCCATCCAAATGTAGG - Intronic
991032528 5:62097544-62097566 GATGATGGTGATGATGATGATGG + Intergenic
991585924 5:68201810-68201832 GGTGATGGTGGTGGAAATGATGG + Intergenic
992154026 5:73936970-73936992 GATAATGGTGAGCCAATGGAGGG + Intronic
992774376 5:80076952-80076974 GATGATGATGATGACAATGATGG + Exonic
993069181 5:83137175-83137197 GATGATGTTGATCATGATGATGG + Intronic
994364679 5:98899648-98899670 GCAGATGGTGACCCAAATGCAGG - Exonic
995453156 5:112325067-112325089 ATTGATGGTCATCCAAATTAGGG - Intronic
995710449 5:115030103-115030125 GATGATTCTGATCCATATTAAGG + Intergenic
995723668 5:115164034-115164056 GGTGATGGAGATTCGAATGATGG - Intronic
995774253 5:115708957-115708979 GATGATGGTGAGGGAAATAAAGG + Intergenic
995916170 5:117247637-117247659 GATGATGGTGATAGTGATGATGG + Intergenic
995962883 5:117865528-117865550 GATGATGATGATGATAATGATGG - Intergenic
997425928 5:133802593-133802615 GATGATGCTGACCAAACTGAGGG + Intergenic
997511364 5:134456993-134457015 GATGATGATGATGATAATGATGG + Intergenic
998503162 5:142651185-142651207 GATGAAGGTTACCCAAAAGAAGG - Intronic
1000770138 5:165342689-165342711 GGAGATGGTGATACAAATGAGGG - Intergenic
1001246736 5:170110573-170110595 GATGATGATGATGATAATGATGG + Intergenic
1001302930 5:170550473-170550495 GATGATGGTGATGACAATGATGG + Intronic
1001302934 5:170550527-170550549 GATGATGGTGATAATGATGATGG + Intronic
1001302935 5:170550542-170550564 GATGATGGTGATGACAATGATGG + Intronic
1001302939 5:170550599-170550621 GATGATGGTGATGACAATGATGG + Intronic
1001302941 5:170550626-170550648 GATGATGGTGATGACAATGATGG + Intronic
1001302944 5:170550683-170550705 GATGATGGTGATGACAATGATGG + Intronic
1001482598 5:172098915-172098937 GATGATGGTAATGGTAATGATGG - Intronic
1001482609 5:172098975-172098997 GATGGTGGTGATGGTAATGATGG - Intronic
1001482612 5:172098993-172099015 GATGATGGTAATGGTAATGATGG - Intronic
1001482621 5:172099050-172099072 AATGATGGTGATGGTAATGATGG - Intronic
1001715277 5:173810595-173810617 GATGATGGTGGTGGTAATGATGG + Intergenic
1001858762 5:175034926-175034948 AATGATGGTGATGATAATGATGG + Intergenic
1001858779 5:175035069-175035091 GATGATGGTGATGATAATGATGG + Intergenic
1002966411 6:1970708-1970730 GAGGATAGAGATCCAAAGGAGGG + Intronic
1003430837 6:6036003-6036025 GATGATGGTGATGATGATGATGG - Intergenic
1003516339 6:6821960-6821982 GATGATGGTGATGGTGATGATGG + Intergenic
1003516349 6:6822039-6822061 GATGATGGTGATGGTGATGATGG + Intergenic
1003914219 6:10770745-10770767 GATGATGGTGTTGATAATGATGG - Intronic
1004838331 6:19554329-19554351 GATGATGATGATGAAGATGATGG - Intergenic
1005118561 6:22365196-22365218 GAAAATTGTGTTCCAAATGAGGG + Intergenic
1007543618 6:42673136-42673158 GAAGATGGTGGTACAAATGAGGG - Intronic
1009051967 6:58286755-58286777 GATGATGGTGATGATGATGATGG - Intergenic
1009728901 6:67573418-67573440 CATGATGGTGACCTAAATGAAGG - Intergenic
1010080279 6:71853571-71853593 GGTGATGGTGATAAAAATAATGG - Intergenic
1010962373 6:82160454-82160476 GATGATGATGATGACAATGATGG + Intergenic
1011006630 6:82652964-82652986 GATGATGGTGATAAAAACTAAGG - Intergenic
1011388020 6:86818536-86818558 GATGATGATGATGAAATTGATGG - Intergenic
1013115606 6:107101705-107101727 GATGATGGCGATCCAAAGTGAGG - Intronic
1013735968 6:113227341-113227363 GATGATGGTGATGCAAAGATGGG - Intergenic
1014957880 6:127643317-127643339 AATGATGGTGTCCGAAATGATGG + Intergenic
1015905770 6:138115055-138115077 AATGTTGGTGATCAAGATGATGG - Intergenic
1017095349 6:150800024-150800046 GATGAGGGTGTTCCAAAAGTGGG - Intronic
1018622913 6:165749281-165749303 GATGATGGTGATGGTGATGATGG - Intronic
1018622915 6:165749296-165749318 GATGATGGTGATGGTGATGATGG - Intronic
1018699571 6:166416011-166416033 GATGATGGTGAGCGTAATGGTGG - Intronic
1018699650 6:166416389-166416411 GATGATGGTGAGGCTAATGAGGG - Intronic
1018840925 6:167515982-167516004 GATGATGGTGATGATGATGATGG - Intergenic
1018840943 6:167516205-167516227 GATGATGGTGATGATAATGATGG - Intergenic
1018840956 6:167516324-167516346 GATGATGGTGGTGATAATGATGG - Intergenic
1018840958 6:167516339-167516361 GATGATGGTGATGGTGATGATGG - Intergenic
1018840974 6:167516552-167516574 GATGATGGTGATGATAATGATGG - Intergenic
1018840977 6:167516582-167516604 GATGATGGTGATGATGATGATGG - Intergenic
1018996604 6:168715043-168715065 GATGATGGTGATGGAAATGATGG + Intergenic
1019110852 6:169712432-169712454 AGTGATGGTGATTCAGATGATGG - Exonic
1019138063 6:169923963-169923985 GATGATGGTGATGGTGATGATGG - Intergenic
1019138110 6:169924631-169924653 GATGATGGTGATGATAATGGTGG - Intergenic
1019180376 6:170183632-170183654 GATGATGGTGATGGTGATGATGG + Intergenic
1019353440 7:566158-566180 GATGATGGTGATAGTGATGATGG - Intronic
1019353497 7:566667-566689 GATGATGGTGATGGTGATGAAGG - Intronic
1019353501 7:566697-566719 GATGATGGTGATGATGATGAAGG - Intronic
1019353595 7:567451-567473 GATGATGGTGATAGTGATGATGG - Intronic
1019353598 7:567481-567503 GATGATGGTGATGGTGATGAAGG - Intronic
1019353602 7:567511-567533 GATGATGGTGATGGTGATGAAGG - Intronic
1019353604 7:567526-567548 GATGATGGTGATAGTGATGATGG - Intronic
1019372038 7:667142-667164 GGTGATGGTGATGATAATGATGG + Intronic
1019372048 7:667223-667245 TATGATGGTGATGATAATGATGG + Intronic
1019824294 7:3270840-3270862 GATGATGGTGATAATGATGATGG + Intergenic
1021897913 7:25255047-25255069 GAGGATGGTGCTCCAGGTGATGG - Intergenic
1023400176 7:39786992-39787014 GATGATGGTGATCCTGACCAGGG + Intergenic
1023713274 7:43017227-43017249 GATGATGGTAAAACAAATAAAGG + Intergenic
1024217558 7:47260352-47260374 GATGATGGTGATGATGATGATGG + Intergenic
1024230982 7:47363284-47363306 GATGATGGTGATGGTGATGATGG - Intronic
1024334582 7:48194388-48194410 GATGATAGTGATGGTAATGATGG + Intronic
1024644826 7:51362391-51362413 GTTGATGGTGATACTAATGGTGG - Intergenic
1026113253 7:67475243-67475265 GATGATGGTGATGATAATGGTGG + Intergenic
1026113271 7:67475399-67475421 GATGATGGTGATGATGATGATGG + Intergenic
1026113273 7:67475414-67475436 GATGATGGTGATGATAATGGTGG + Intergenic
1026113289 7:67475579-67475601 GATGATGGTGATGATAATGGTGG + Intergenic
1026113295 7:67475618-67475640 GATGATGGTGATGGTGATGATGG + Intergenic
1026113297 7:67475633-67475655 GATGATGGTGATGGTGATGATGG + Intergenic
1026113299 7:67475648-67475670 GATGATGGTGATGATAATGGTGG + Intergenic
1026113309 7:67475708-67475730 GATGATGGTGATGGTGATGATGG + Intergenic
1026286460 7:68967801-68967823 GATGATGGTGATGGTGATGATGG + Intergenic
1026556897 7:71416268-71416290 GATGACGATGATGCCAATGATGG - Intronic
1027755944 7:82212175-82212197 TATCATCTTGATCCAAATGATGG + Intronic
1028440250 7:90851448-90851470 GATGATGGTAATGCTAATAATGG + Intronic
1028960981 7:96749691-96749713 GATCATGCTGATGCAAAAGATGG + Intergenic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1029794134 7:102875900-102875922 GATGATGATGATGCAAAGAAAGG + Intronic
1030147518 7:106371558-106371580 GATGATGGACAGCCAAATCATGG - Intergenic
1031832790 7:126647771-126647793 GATAATGGTGATTCAACTTAAGG - Intronic
1032409188 7:131681489-131681511 GATGATGGTGATGATAGTGATGG + Intergenic
1032513394 7:132489771-132489793 GATGATGATGATAATAATGATGG - Intronic
1032610625 7:133408455-133408477 GATGATGGTGATGATGATGATGG + Intronic
1033496558 7:141903062-141903084 GATGATGCTTATCCACATTAGGG + Intergenic
1033619864 7:143052447-143052469 GATGATGGTGTTTCCCATGAAGG - Exonic
1033830036 7:145241073-145241095 GATGATGGTGATCTACATATGGG + Intergenic
1034679091 7:152914844-152914866 GATGATAGTGATGATAATGATGG - Intergenic
1034826116 7:154264661-154264683 AATGATGGTGATCCTGATGATGG + Intronic
1034826121 7:154264766-154264788 AATGATGATGATCCTGATGATGG + Intronic
1034826127 7:154264859-154264881 AATGATGGTGATCCTGATGATGG + Intronic
1034826132 7:154264949-154264971 AATGATGGTGATCCTGATGATGG + Intronic
1034969811 7:155411889-155411911 GATGATGGTGATGAAGATGATGG - Intergenic
1035041754 7:155933966-155933988 GATGATGGTGATGATGATGATGG - Intergenic
1035041779 7:155934210-155934232 GATGATGGTGATAATGATGATGG - Intergenic
1035106954 7:156449174-156449196 GATGGTGGTGATGACAATGATGG + Intergenic
1035310721 7:157966507-157966529 GATGGTGGTGATGAAGATGATGG - Intronic
1035310734 7:157966693-157966715 GATGGTGGTGATGAAGATGATGG - Intronic
1035310736 7:157966711-157966733 GATGGTGGTGATGAAGATGATGG - Intronic
1035310742 7:157966786-157966808 GATGGTGGTGATGAAGATGATGG - Intronic
1035310749 7:157966867-157966889 GATGATGGTGATGACAGTGATGG - Intronic
1035323382 7:158049111-158049133 GATGATAGTGATGCTGATGATGG - Intronic
1035340181 7:158155568-158155590 GATGATGGTGATGGTGATGATGG - Intronic
1035340197 7:158155715-158155737 GATGATGGTGATGGTGATGATGG - Intronic
1035340200 7:158155739-158155761 GATGATGGTGATGGTGATGATGG - Intronic
1035384763 7:158463428-158463450 CATGATGGTGATGACAATGATGG - Intronic
1035384779 7:158463633-158463655 GATGATGGTGATGATGATGATGG - Intronic
1035659669 8:1337536-1337558 GATGATGATGATCATAATGGTGG + Intergenic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036387608 8:8295612-8295634 GATGATGGTGACCCTGATGGTGG - Intergenic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1038609845 8:29050267-29050289 GAAGATGGTGTTACAAATAAGGG - Intronic
1039657679 8:39427796-39427818 AATGATGGAGATCCTAAGGAAGG + Intergenic
1039922107 8:41900579-41900601 GATGATGGTGATGCTGGTGATGG - Intergenic
1039922111 8:41900612-41900634 GATGATGATGATGCTAGTGATGG - Intergenic
1042346814 8:67736027-67736049 GATGCTGGTGATCCCTCTGAAGG + Intronic
1043023325 8:75034014-75034036 GATGATGGAGATCTAAACTAAGG - Exonic
1043773402 8:84233712-84233734 GATAATGTTGGTCCAAGTGAAGG - Intronic
1044835350 8:96289939-96289961 GATGATGATAATGCAGATGACGG + Intronic
1045855905 8:106765307-106765329 GAAGCTGGTGATTCAAGTGAAGG - Intronic
1045947506 8:107812868-107812890 GCTGATGGTCAAACAAATGAGGG - Intergenic
1046446765 8:114331195-114331217 GATGATGATGATGACAATGATGG + Intergenic
1048422620 8:134292350-134292372 CATGATGGTGACCTAAATTAAGG + Intergenic
1048682753 8:136864059-136864081 GATGATGGTGAGGATAATGATGG + Intergenic
1049264184 8:141658275-141658297 GATGATGGTGATGGCGATGATGG - Intergenic
1049291990 8:141808450-141808472 GATGATGGTGATGATGATGATGG - Intergenic
1049292036 8:141808969-141808991 GATGATGGTGATAATGATGATGG - Intergenic
1049369375 8:142256349-142256371 GATGATGGTGGTGATAATGATGG - Intronic
1049369384 8:142256410-142256432 GATGATGGTGGTGATAATGATGG - Intronic
1049369414 8:142256590-142256612 GATGATGGTGATGATAGTGATGG - Intronic
1049428399 8:142547966-142547988 GATGATGGTGATGATAATGATGG + Intergenic
1049445612 8:142629488-142629510 GATGATGGTGAAGATAATGATGG - Intergenic
1049445613 8:142629503-142629525 GATGATGGTGATAGTGATGATGG - Intergenic
1050030055 9:1376421-1376443 AATGATGTTGATGCTAATGAAGG + Intergenic
1050901701 9:10958432-10958454 GAGGATGCTGATATAAATGATGG - Intergenic
1051328806 9:16001600-16001622 TATGATGGTGGTCCCAATGGTGG + Intronic
1051379000 9:16436206-16436228 GAAGATGATGACCCCAATGATGG - Exonic
1051908176 9:22120780-22120802 GATGATGATGATGATAATGATGG - Intergenic
1051992825 9:23174001-23174023 GATGATGGTGATAATGATGATGG + Intergenic
1053111823 9:35467568-35467590 GATGAGGGTGTTCCATATGTGGG - Intergenic
1056255274 9:84792977-84792999 GATGATGGTGATGATACTGATGG - Intronic
1056680339 9:88712024-88712046 GATGATGATGATGGGAATGATGG + Intergenic
1057265529 9:93614880-93614902 GGTGATGGTGATGGTAATGATGG + Intronic
1057265577 9:93615359-93615381 GATGATGGTGATAGTAATGATGG + Intronic
1057267035 9:93624360-93624382 GGTGATGGTGATGAAAATGATGG + Intronic
1057267090 9:93624819-93624841 GATGATGGTGATGATGATGATGG + Intronic
1057968114 9:99524472-99524494 GATGATGATGATGAAGATGATGG + Intergenic
1058138185 9:101330314-101330336 GGTGGTGCTGATCCCAATGAGGG + Intergenic
1058935422 9:109765437-109765459 GATGATGGTGATCATGATGATGG - Intronic
1059450636 9:114369659-114369681 GCTGATGGTGATGCTAATGATGG - Intronic
1059629360 9:116103606-116103628 GATGATGATGATGATAATGATGG + Intergenic
1060104863 9:120867233-120867255 GAGGATGGTGATTCAAATTCTGG + Intronic
1060742199 9:126106587-126106609 GATGATGGTGATGGTGATGATGG + Intergenic
1060742201 9:126106602-126106624 GATGATGGTGATGGTGATGATGG + Intergenic
1061845138 9:133383664-133383686 GATGATGGTGATGGTGATGATGG + Intronic
1062458932 9:136654825-136654847 GATGATGGTGATGCTGATGATGG - Intergenic
1203490854 Un_GL000224v1:103148-103170 GAAGTTGGGGATCCAGATGATGG + Intergenic
1203503478 Un_KI270741v1:45026-45048 GAAGTTGGGGATCCAGATGATGG + Intergenic
1203639167 Un_KI270750v1:142538-142560 CATGATGCTTAGCCAAATGAAGG + Intergenic
1185683070 X:1904783-1904805 GATGATGGTGATAGTGATGATGG + Intergenic
1185683090 X:1905028-1905050 GACAATGGTGATGGAAATGATGG + Intergenic
1185721160 X:2382594-2382616 GATGATGGTGATGGTGATGATGG - Intronic
1185721165 X:2382630-2382652 GATGATGGTGATGGTGATGATGG - Intronic
1185721173 X:2382693-2382715 GATGATGGTGATGGTGATGATGG - Intronic
1185721188 X:2382840-2382862 GATGATGGTGATAATGATGATGG - Intronic
1185721227 X:2383313-2383335 GATGATGGTGATGGTGATGATGG - Intronic
1185721435 X:2385192-2385214 GATGATGGTGATGGTAATGATGG - Intronic
1185739569 X:2520304-2520326 GATGATGGTGATGATGATGATGG - Intergenic
1185844661 X:3426762-3426784 GATGATGGTGATGACGATGATGG + Intergenic
1185844668 X:3426837-3426859 GATGATGGTGATGATGATGATGG + Intergenic
1185854922 X:3524890-3524912 GATGATGGTGATGACCATGATGG - Intergenic
1185930134 X:4193549-4193571 GATGATGGTGATGGTGATGATGG + Intergenic
1185930151 X:4193747-4193769 GATGATGGTGATGATAGTGATGG + Intergenic
1186074954 X:5867936-5867958 GATGATGGTGATAATGATGATGG - Intronic
1186098853 X:6133152-6133174 GATGATGGTGATAATGATGATGG - Intronic
1186131659 X:6473257-6473279 GATGATAGTGATGGCAATGATGG + Intergenic
1186214553 X:7284933-7284955 GATGGTGGTGATGCTGATGATGG + Intronic
1186214558 X:7285013-7285035 GATGATGGCGATGCTGATGATGG + Intronic
1188821635 X:34782319-34782341 GATGATGATGATGAAGATGATGG - Intergenic
1189318382 X:40072491-40072513 GATGAGGCTGAATCAAATGATGG - Exonic
1189711981 X:43822825-43822847 GATGATGGTGATGGTGATGATGG - Intronic
1189731582 X:44026518-44026540 GATGATGGTGATGATGATGATGG - Intergenic
1190845847 X:54189806-54189828 GATGATGGTGATTCTAGAGATGG + Intergenic
1195666671 X:107437781-107437803 GATGATGGTGATGATGATGATGG + Intergenic
1196008502 X:110861106-110861128 GCTGGTGGTGATGCAAAGGAAGG + Intergenic
1197151600 X:123226175-123226197 GGTGATGATGATGCTAATGATGG - Intronic
1197724973 X:129770160-129770182 GATGATGGTGATGATGATGAGGG - Intergenic
1198004082 X:132474065-132474087 GGGGATGGTGATTAAAATGAGGG + Intronic
1198993114 X:142539027-142539049 GATGATGGTGATAACAATGATGG + Intergenic
1199235204 X:145484700-145484722 GATGATGGTGACTCAATTGAGGG + Intergenic
1200381278 X:155839928-155839950 GATAATGGTCATCCTAAAGAGGG - Intergenic
1200808694 Y:7460112-7460134 GATGATGGTGATGGTGATGATGG + Intergenic
1201056845 Y:10002351-10002373 GATGATGGTGATGATAATGATGG + Intergenic
1201143536 Y:11048184-11048206 GATGGTGGTGATCATCATGATGG + Intergenic
1201501307 Y:14645846-14645868 GATGATGGTGATGATGATGATGG + Intronic
1201518965 Y:14851282-14851304 GATGATGGTGATGATGATGATGG + Intergenic
1201614093 Y:15876791-15876813 GATAATGGTGATGATAATGATGG + Intergenic
1201614106 Y:15876911-15876933 GATGATGGTGATGGCAATGAGGG + Intergenic
1201616262 Y:15902866-15902888 GATGATGGTGATGGCAATGAGGG - Intergenic
1201616275 Y:15902986-15903008 GATAATGGTGATGATAATGATGG - Intergenic
1201669555 Y:16503111-16503133 GATGATGGTGATAGGGATGATGG - Intergenic
1201768405 Y:17594515-17594537 AATGATGGTGGTGGAAATGATGG - Intergenic
1201833148 Y:18311470-18311492 AATGATGGTGGTGGAAATGATGG + Intergenic