ID: 1079401380

View in Genome Browser
Species Human (GRCh38)
Location 11:20108989-20109011
Sequence GAGACACAAGATGCTATCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079401373_1079401380 22 Left 1079401373 11:20108944-20108966 CCAGGTTTCCAAGAGTTTTTTTG 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1079401380 11:20108989-20109011 GAGACACAAGATGCTATCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 61
1079401374_1079401380 14 Left 1079401374 11:20108952-20108974 CCAAGAGTTTTTTTGTTTCCTTG 0: 1
1: 0
2: 8
3: 135
4: 1239
Right 1079401380 11:20108989-20109011 GAGACACAAGATGCTATCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 61
1079401379_1079401380 -4 Left 1079401379 11:20108970-20108992 CCTTGGTACTGGACAGTGGGAGA 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1079401380 11:20108989-20109011 GAGACACAAGATGCTATCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079401380 Original CRISPR GAGACACAAGATGCTATCGT AGG Intronic
902160867 1:14529358-14529380 GAGACACATGATGCTTCCATTGG - Intergenic
909875865 1:80802244-80802266 GAGACACAAGATTGTTTTGTTGG + Intergenic
910609320 1:89124348-89124370 GAGATACAAGATGATCTGGTGGG - Intronic
911967680 1:104387977-104387999 GAGGCAGAGGATGGTATCGTCGG - Intergenic
914426823 1:147585449-147585471 GTCACACAAGATGCTAACGATGG + Intronic
924597912 1:245463405-245463427 GAGACACAAGATGTCATGGGAGG - Intronic
1069437327 10:68396921-68396943 GAGACAGAAGATGTGATCTTTGG - Intronic
1074509262 10:114098261-114098283 GCTACACAAGAGGCTATGGTGGG - Intergenic
1075598268 10:123748038-123748060 GAGACACCAGAGGCCATCTTGGG + Intronic
1076822789 10:132948704-132948726 GAGACACAGGAAGCTAACGGAGG - Intergenic
1079401380 11:20108989-20109011 GAGACACAAGATGCTATCGTAGG + Intronic
1088591693 11:111408906-111408928 GAGACACAAGGTGCTGTGGGAGG + Intronic
1089958345 11:122593493-122593515 GAGACATAAGAAGCAATTGTGGG + Intergenic
1090052715 11:123394323-123394345 GAGACACAAAATGGTATCATTGG - Intergenic
1095740108 12:45597509-45597531 GAGAGACAAGATGCTTTGGAGGG - Intergenic
1100682672 12:96945695-96945717 GTGACAGAAGATGCTATCTTTGG - Exonic
1107404682 13:40101466-40101488 GAGACTCAAGCTGCTATCAGGGG + Intergenic
1110260201 13:73476183-73476205 GATACACAAGATGACATAGTGGG + Intergenic
1111614742 13:90648649-90648671 AAGAAACAAGATGCTATAGTTGG - Intergenic
1117621395 14:57590721-57590743 GAGACACAAGAGACTCTTGTAGG - Intronic
1120265276 14:82240631-82240653 GAGAGACAAGCTGCAATTGTTGG + Intergenic
1120310999 14:82828317-82828339 GAGAGACAAGATGCTATAAATGG - Intergenic
1122015363 14:98790488-98790510 GAGACACAAGAAGATGTCATTGG - Intergenic
1132995656 16:2821136-2821158 GGGACACAGGATGCTTTCCTGGG - Intronic
1134179889 16:12039011-12039033 GAGACACAAGATAGTCTCGAGGG + Intronic
1143939019 17:10519079-10519101 GAAACAAAAGAAGCTATCTTTGG - Intergenic
1144577007 17:16435727-16435749 GAGACTCAGGAGGCTATTGTGGG - Intronic
1148221711 17:45867328-45867350 GGGGCCCAAGATGCTATTGTTGG + Intergenic
1148345711 17:46902506-46902528 GAGAGACAAAATGCTATGGCAGG + Intergenic
1157582180 18:48780022-48780044 GAGACACAAGCTGCTTCCTTAGG - Intronic
1158601341 18:58858750-58858772 GAGTGACAAGATGGTATCGTTGG + Intergenic
1159837461 18:73356147-73356169 GAGACAGAAGGTGCTATGGAGGG - Intergenic
1160516118 18:79480127-79480149 GACTCACAAGATGCCGTCGTGGG + Intronic
1167060669 19:47143741-47143763 GAGACTGAAGGTGCTATTGTTGG + Intronic
930663405 2:54078245-54078267 GAGACAGAAAATGCAATCATTGG - Intronic
932695173 2:73950291-73950313 GAGACAGAAGATAGTATCATTGG - Intronic
940462923 2:153990401-153990423 CAGACACAGGATGCTAACATTGG - Intronic
944201005 2:197107390-197107412 CAGACACCAGATGCTGTCTTTGG + Intronic
1182602947 22:31481272-31481294 GATACTCAAGAGGCTAACGTGGG - Intronic
953898726 3:46825378-46825400 AAGACACAAAATGATATTGTAGG - Intergenic
956282816 3:67576314-67576336 GAGACACAGTATGCCATGGTAGG + Intronic
960608949 3:119537186-119537208 GAGACACATGAAGCTGTGGTTGG + Exonic
964384915 3:156137301-156137323 GAGACTGAAGATGCTACCTTTGG + Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
965987428 3:174772719-174772741 CAGACACAAAATGATATAGTAGG + Intronic
966106243 3:176338011-176338033 GTGTTACAAGATGTTATCGTTGG + Intergenic
974874175 4:67682799-67682821 GAGAAACTTGATGCTATCTTTGG + Intronic
978893975 4:113863642-113863664 GAGACAGAAGAAGATTTCGTAGG + Intergenic
979766646 4:124471985-124472007 GAGACACAAGCTCTTATCATGGG + Intergenic
985949187 5:3210476-3210498 GAGAAACAAGATGCTCTCTGTGG + Intergenic
987390864 5:17374310-17374332 GAGACACAAGATGTTAGCTTGGG - Intergenic
994162428 5:96571715-96571737 GTGGCACAAGATGCTATTTTTGG - Intronic
1012697900 6:102412850-102412872 AAGCCACAAGCTGCTATCGAAGG + Intergenic
1019756195 7:2771967-2771989 GAGACACCACATGCTCTCCTAGG - Intronic
1021695317 7:23270613-23270635 GAGACACAAGCTGTTCTCCTTGG + Intronic
1023287951 7:38638313-38638335 GAAACAGAAGATGCTATTTTGGG - Intergenic
1032470863 7:132178010-132178032 GAGTCACAAAATGATATCCTGGG + Intronic
1032590179 7:133184795-133184817 TAGACACAAGAAGCTGTCTTAGG + Intergenic
1035238855 7:157517304-157517326 CAGACACCTGAGGCTATCGTGGG - Intergenic
1039925496 8:41927965-41927987 GAAACAAAAAATGCTATCTTTGG - Intergenic
1046976349 8:120282752-120282774 GAGAGACAAGATGATATTTTAGG + Intronic
1053360332 9:37482082-37482104 GAGACAGAAGAAGCTATTCTCGG + Intergenic
1058140906 9:101356195-101356217 CAGAAACAAGATGCTATCTATGG - Intergenic
1186445174 X:9621061-9621083 GAGAGACGAGATGCCATGGTTGG + Intronic
1200792221 Y:7309701-7309723 AAAACACAAAATGCTATAGTGGG - Intergenic
1201906163 Y:19087445-19087467 GTGACACAAGATGCCATCTGGGG + Intergenic
1201988465 Y:19995451-19995473 AAGACACAAGATGCCTTGGTGGG - Intergenic