ID: 1079402158

View in Genome Browser
Species Human (GRCh38)
Location 11:20114562-20114584
Sequence CAGGCAAAGAAGGAACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079402158_1079402163 8 Left 1079402158 11:20114562-20114584 CCAGACTGTTCCTTCTTTGCCTG 0: 1
1: 0
2: 3
3: 29
4: 334
Right 1079402163 11:20114593-20114615 TCTATGGAAGGCGCGCCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 32
1079402158_1079402170 26 Left 1079402158 11:20114562-20114584 CCAGACTGTTCCTTCTTTGCCTG 0: 1
1: 0
2: 3
3: 29
4: 334
Right 1079402170 11:20114611-20114633 CCTGGGAGGATCCTGCCAAGTGG 0: 1
1: 0
2: 0
3: 26
4: 177
1079402158_1079402162 -4 Left 1079402158 11:20114562-20114584 CCAGACTGTTCCTTCTTTGCCTG 0: 1
1: 0
2: 3
3: 29
4: 334
Right 1079402162 11:20114581-20114603 CCTGTTTTCAGCTCTATGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 193
1079402158_1079402165 12 Left 1079402158 11:20114562-20114584 CCAGACTGTTCCTTCTTTGCCTG 0: 1
1: 0
2: 3
3: 29
4: 334
Right 1079402165 11:20114597-20114619 TGGAAGGCGCGCCCCCTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 88
1079402158_1079402164 9 Left 1079402158 11:20114562-20114584 CCAGACTGTTCCTTCTTTGCCTG 0: 1
1: 0
2: 3
3: 29
4: 334
Right 1079402164 11:20114594-20114616 CTATGGAAGGCGCGCCCCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 26
1079402158_1079402171 27 Left 1079402158 11:20114562-20114584 CCAGACTGTTCCTTCTTTGCCTG 0: 1
1: 0
2: 3
3: 29
4: 334
Right 1079402171 11:20114612-20114634 CTGGGAGGATCCTGCCAAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 166
1079402158_1079402160 -8 Left 1079402158 11:20114562-20114584 CCAGACTGTTCCTTCTTTGCCTG 0: 1
1: 0
2: 3
3: 29
4: 334
Right 1079402160 11:20114577-20114599 TTTGCCTGTTTTCAGCTCTATGG 0: 1
1: 0
2: 3
3: 24
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079402158 Original CRISPR CAGGCAAAGAAGGAACAGTC TGG (reversed) Intronic
901305305 1:8228482-8228504 AAGGAACAGAAAGAACAGTCTGG + Intergenic
901475844 1:9488711-9488733 CAGACTGAGAAGGAGCAGTCAGG + Intergenic
901676812 1:10890139-10890161 CAGCCAAATAAGGAACGTTCAGG - Intergenic
901783191 1:11608164-11608186 GAGGGAAAGAAGGAACAGGGAGG + Intergenic
902033883 1:13442422-13442444 CAGGCATAGAAGGGCCTGTCTGG + Intergenic
902196642 1:14803360-14803382 CAGGGACAGGAGGGACAGTCGGG - Intronic
902636843 1:17740236-17740258 CAGCCAAAGAAGGAACAAAATGG - Intergenic
902951887 1:19890854-19890876 CAGACACAGTAGGAAAAGTCTGG + Intronic
903405362 1:23091132-23091154 AAGGCAAAGAAGGAAAAGGGAGG + Intronic
904123738 1:28221363-28221385 CAAAGAAAGAAAGAACAGTCAGG + Intronic
904560649 1:31395039-31395061 CAGGAAAAGAAGTAGCAGCCCGG - Intergenic
904840090 1:33367137-33367159 CAGCCACAGCAGGAACCGTCCGG + Exonic
905043512 1:34978677-34978699 GAGGCAAGAAAGGAACAGTCTGG - Intergenic
905927976 1:41765536-41765558 CAAACAAAGAGGGAACAGTATGG - Intronic
906239140 1:44230775-44230797 AAGTCAAAGAAGGAAGAGGCTGG - Intronic
907590836 1:55669468-55669490 CAGCCAAGGAAGGAAGAGCCTGG - Intergenic
907808733 1:57846876-57846898 CAGGCAAAAAGGAGACAGTCTGG + Intronic
908427113 1:64017994-64018016 CAGGCAAGGAAAAAACAGCCTGG - Intronic
908704549 1:66937116-66937138 AAGGTATAGAAGGAAGAGTCAGG + Intronic
910509244 1:87985149-87985171 AAGGCAAAGCAGGAGAAGTCGGG + Intergenic
911099737 1:94085824-94085846 CAGGCAAAGAAGGAATGGGGGGG - Intronic
911322002 1:96425881-96425903 CAGGGAAAGAAGGAAAAGACTGG - Intergenic
911649980 1:100376937-100376959 CAGGCAAAGAAAGAACCAACAGG - Intronic
912664665 1:111568327-111568349 AAGGCAAAGCAGGAGCAGGCAGG + Intronic
913120443 1:115735863-115735885 CAGTCAAAGAAAGAGCAGGCCGG + Intronic
914003112 1:143709266-143709288 CAGGAGAAGAAGGAGCAGTTGGG + Intergenic
914746539 1:150505483-150505505 CAGGGAAAGGAGGAACAGATGGG + Intronic
914867941 1:151448567-151448589 CAGGCAAAGAAAAGATAGTCTGG - Intronic
915228264 1:154427314-154427336 CTGGCAAGGAAGACACAGTCAGG - Intronic
917242620 1:172965376-172965398 CATGCAAAGAAGTAAGAGACTGG + Intergenic
919320615 1:196032252-196032274 CAGGCAAAAAATGAATGGTCAGG + Intergenic
919978557 1:202628398-202628420 CAGCCAAAGAAGGTGCAGTCTGG + Intronic
920725109 1:208427620-208427642 CAGGCATAGAAGGAAGATTATGG + Intergenic
923536114 1:234853284-234853306 TAGGGAAAGAGGGAACAGGCAGG - Intergenic
923557593 1:235012939-235012961 CAGGGACAGAAGGGTCAGTCTGG + Intergenic
923703451 1:236322289-236322311 CAGGCCAGGAAGCAACAGCCTGG + Intergenic
924394650 1:243606248-243606270 CAGGCAAGGCTGGAACAGTATGG + Intronic
1062846301 10:708815-708837 CAGACAAAGAAGGAACATTTTGG - Intergenic
1063198455 10:3764781-3764803 TGGGCTAAGAAAGAACAGTCAGG + Intergenic
1064555987 10:16547634-16547656 AAGGCAAAGGAGGAGCAGGCAGG - Intergenic
1065184577 10:23159397-23159419 CAGCATAAGAAGAAACAGTCGGG - Intergenic
1065495914 10:26328070-26328092 CAGGCAAGGAAGCAAGAGGCAGG + Intergenic
1068093058 10:52456434-52456456 GAGGCTGAGAAGGAACATTCTGG + Intergenic
1069720191 10:70544854-70544876 GAGGAGAAAAAGGAACAGTCTGG - Intronic
1069979334 10:72241406-72241428 CAGGCAAAGTAGGAAGATCCAGG + Intergenic
1070779801 10:79130941-79130963 AAGACAAAGAGGGAACAATCCGG - Intronic
1071119857 10:82264677-82264699 CAGGGAAAGAAGCCACAGGCAGG + Intronic
1072006329 10:91253023-91253045 CAGGAAAAAAAGGAAGAATCAGG - Intronic
1074264536 10:111888315-111888337 GAGGCACAGAAAGAACATTCAGG - Intergenic
1075923399 10:126231910-126231932 CAGGCTGAGAAAGAACAGTTGGG - Intronic
1076129089 10:128000005-128000027 CAGCAACAGAAGGAACATTCTGG - Intronic
1076906616 10:133365544-133365566 CAGGCCAAGAACGAACAGCGTGG + Intronic
1077975966 11:7249516-7249538 CAGGCAAAGAAAGTAAAATCAGG - Intronic
1078391931 11:10942574-10942596 CAGGGAAAGAAGGAACACGCTGG - Intergenic
1079087525 11:17457451-17457473 CAAAGGAAGAAGGAACAGTCTGG - Intronic
1079402158 11:20114562-20114584 CAGGCAAAGAAGGAACAGTCTGG - Intronic
1079685700 11:23356813-23356835 GAGGCAAAGCAGGGACAGACTGG + Intergenic
1080114666 11:28608424-28608446 TAGGGAAAGAAGGAAGAGACAGG - Intergenic
1080224111 11:29940949-29940971 CTGGCAAATAAGGAACAGAGTGG - Intergenic
1080644218 11:34176385-34176407 CGTGCTTAGAAGGAACAGTCTGG - Intronic
1082958472 11:58896773-58896795 CAGGAAAACAAAGAGCAGTCTGG - Intronic
1083541749 11:63516187-63516209 CAGGCAGACAAGGGAAAGTCTGG + Intronic
1084098566 11:66929853-66929875 CAAGAAAATAAGGAACATTCAGG + Intronic
1086136381 11:83447066-83447088 GAGGGAAAGAAGGAAGATTCGGG + Intergenic
1087775413 11:102252303-102252325 CAGGCTAAGAAGGAGCAGTCAGG + Intergenic
1089642478 11:119856898-119856920 CAGGCAAAGAGGGAAGAATTTGG - Intergenic
1091990486 12:4951590-4951612 CAGGCAAAGCTGGAAGAGTTTGG + Intergenic
1092477986 12:8835420-8835442 CAGGTAAAGAAGCAAAAGGCAGG - Intronic
1092481209 12:8860689-8860711 CACACAAAGAGGGAACAGTTTGG - Intronic
1092685426 12:11039241-11039263 CAGGAATAGAAGTAAAAGTCAGG - Intronic
1093670630 12:21870624-21870646 TAGGCAAAGAAGGAAACGTGAGG - Intronic
1096953394 12:55499865-55499887 CAGGCAAAAATAGATCAGTCTGG + Intergenic
1097439762 12:59595696-59595718 CATGCAAAAAAAGAAGAGTCTGG - Intergenic
1097444895 12:59658560-59658582 AAGGCAAAGAAGGCACAGCAAGG - Intronic
1097725119 12:63066429-63066451 AAGGCACAGTAGGAACAGTGTGG - Intergenic
1097908444 12:64944458-64944480 AAGGGAAAGAGGGAACAGTGTGG - Intergenic
1099082287 12:78200476-78200498 GGGGCAAGGAAGGAATAGTCGGG - Exonic
1099199820 12:79662439-79662461 CAGGCAAAGAACTAAAAGACTGG - Intronic
1100086328 12:90914864-90914886 CAGGCAAAGGTGGAACAGTTTGG - Intronic
1100407872 12:94286791-94286813 CAAGGAAAGAAGAAACAGGCTGG - Intronic
1100992658 12:100267310-100267332 AAGGCAGAGCAGGAACAGCCAGG + Intronic
1102408351 12:112694124-112694146 CAGGCAAAGGAGGGCCACTCAGG - Intronic
1102676813 12:114665021-114665043 CAGGCACAGAACCCACAGTCGGG - Intergenic
1103059574 12:117847756-117847778 CAGGCACAGAGAGAACAGTATGG - Intronic
1103104614 12:118212660-118212682 AAGGCAAAAAAGGAACAGGGAGG + Intronic
1103928129 12:124435003-124435025 CAGGCTAGGATGGAACATTCAGG - Intronic
1104111416 12:125708487-125708509 CAGACAAATGAGGAACAGTATGG - Intergenic
1104628047 12:130375944-130375966 GAGACTGAGAAGGAACAGTCAGG - Intergenic
1104648243 12:130512161-130512183 CAGGCAGAGAAGAAACTGCCAGG - Intronic
1106965796 13:35065243-35065265 CATCCAAAGAAAGAAAAGTCAGG - Intronic
1107885053 13:44868060-44868082 CAGGCAAGGGAGGAAACGTCTGG + Intergenic
1108829053 13:54453816-54453838 CAGGCAGAGATGGAACAGTTTGG - Intergenic
1109554364 13:63952012-63952034 CAGGCTAAGAAAGAAGAGACAGG - Intergenic
1109650220 13:65314277-65314299 CAGGGAAAGAGGGGATAGTCTGG - Intergenic
1109703210 13:66054234-66054256 TAGGAAAAGAAGGAAAAATCAGG - Intergenic
1110541302 13:76709517-76709539 CAGGAAAAGCAGGAACACTGGGG + Intergenic
1111405529 13:87799614-87799636 CAGGGAAAGAAGGAAGAGCATGG + Intergenic
1111459342 13:88519339-88519361 CAGGAAAATATGGAACAGTTTGG + Intergenic
1112373472 13:98816485-98816507 CAGGTGAAGAAAGAACAGTCAGG + Intronic
1112847084 13:103656828-103656850 TATGCAAAGAAGGAAAAGACTGG + Intergenic
1113139273 13:107128917-107128939 AAGGCAAAGAGGGAACAGTCAGG - Intergenic
1113930419 13:113965329-113965351 AAGGGAGAGAAGGTACAGTCTGG + Intergenic
1114234167 14:20810360-20810382 CAGGAAAAGACGGAACAGTGGGG + Intergenic
1116926000 14:50638196-50638218 CAGAAAAAGAAGGAACACTTAGG - Intronic
1117428012 14:55621292-55621314 CAGGCAGAGCTGGAACAGTTTGG - Intronic
1118478903 14:66144074-66144096 CAAGTGAGGAAGGAACAGTCAGG - Intergenic
1118880063 14:69818182-69818204 CAGGGAAACAAGGAACAGAAGGG - Intergenic
1119185893 14:72642308-72642330 ATGGCAAAGGAGGAACAGTAAGG + Intronic
1120567930 14:86082314-86082336 AAGGCAAAGAGGGAGCAGGCAGG + Intergenic
1121624815 14:95375902-95375924 CTGGCAAAGCAGGTGCAGTCAGG - Intergenic
1122487935 14:102094294-102094316 CAGACAAATAATGAACAGTAAGG - Intronic
1122637483 14:103137120-103137142 CAGGCTGAGAAGGAACTTTCAGG - Exonic
1124350590 15:28952989-28953011 CAGGAAAAGGAAGAACAGGCGGG + Intronic
1124358484 15:29016790-29016812 CAGGCAAAGAAGGAAGGGAGGGG - Intronic
1124494176 15:30176318-30176340 CAGCCAAGGAAGGTGCAGTCTGG + Intergenic
1124749394 15:32362327-32362349 CAGCCAAGGAAGGTGCAGTCTGG - Intergenic
1128919334 15:71596013-71596035 CTGGAAAAGAAGCAACAGTGAGG - Intronic
1128998412 15:72313659-72313681 CAGACACAGAAGGAACAGGTGGG - Intronic
1129318217 15:74759043-74759065 CAGGAAAAGATAGAACAGGCTGG - Intergenic
1129760519 15:78126656-78126678 AAGGCATAGATGGAAAAGTCTGG - Intronic
1129850284 15:78789844-78789866 CAGGCAAAGAAGCAGCCTTCAGG + Intronic
1129965323 15:79729817-79729839 CAGGTTAAGAAGAAAAAGTCAGG + Intergenic
1130612702 15:85376084-85376106 CAGGCAGATAAAGAACAGTGGGG - Intergenic
1131199179 15:90382232-90382254 CAGGCAAAAAATGTACAGGCTGG - Intergenic
1131244028 15:90774498-90774520 CAGGCAAAGAGTGAAAATTCAGG + Intronic
1131394930 15:92078591-92078613 TGGGCAAAGCAGGAACAGCCTGG - Intronic
1132347775 15:101118826-101118848 CAGGGAAACAGGGAACGGTCAGG + Intergenic
1132349383 15:101129511-101129533 AAGGCAGAGAGGGAACACTCTGG - Intergenic
1133064309 16:3195183-3195205 CAGGAAGAGAAGGAACGGTTGGG - Intergenic
1133725083 16:8529964-8529986 CAGTCAAAGAAGGAACTACCTGG - Intergenic
1134233709 16:12449315-12449337 CAGGCAAAGAAGGCACGGTGGGG + Intronic
1136267316 16:29129388-29129410 CAGGCAATGAAGGCACAGAGAGG + Intergenic
1137778461 16:51076460-51076482 AAGAAAGAGAAGGAACAGTCAGG - Intergenic
1138421417 16:56901736-56901758 CAGGCAGAGAGGGCCCAGTCGGG - Intronic
1138448294 16:57078149-57078171 GAGGCAGGGAAGGAACAGGCAGG - Intronic
1138968099 16:62110593-62110615 CATGCAAAGATGGAAAAGCCTGG - Intergenic
1139221387 16:65186057-65186079 CAGGCAAAGAAAGAAAAGAAAGG - Intergenic
1139838021 16:69855474-69855496 AAGGGAAAAAAGGAACACTCTGG - Intronic
1141342522 16:83216075-83216097 CAGGCAGACAAGGAAGAGTCTGG - Intronic
1142070608 16:88089711-88089733 CAGGCAACGAAGGCACAGAGAGG + Intronic
1142192214 16:88723240-88723262 CAGGCAAGGCAGGAACAGGCAGG - Exonic
1142584404 17:962141-962163 GAAGAAAAGAAGGAACATTCAGG + Intronic
1143000615 17:3792838-3792860 CAGGCAAAGCACAACCAGTCTGG + Intronic
1143632493 17:8147118-8147140 CAGGACAAGAAGGAAAAGGCAGG + Intronic
1144187365 17:12809223-12809245 CAGGCAGAACTGGAACAGTCTGG - Intronic
1146644005 17:34564370-34564392 CAGGAAAATGAGGAAGAGTCAGG - Intergenic
1147597972 17:41728741-41728763 CAGGCAAAGAAGGAAAAACATGG + Intronic
1149177946 17:53897022-53897044 CAGGCAAAGAAGAAACAAAGAGG - Intergenic
1149208225 17:54273928-54273950 GAGGCAAAGGAGGAACATTATGG + Intergenic
1149901228 17:60481247-60481269 GAGGCAAAAAGGGAACAGTAGGG - Intronic
1151292914 17:73163472-73163494 CAGGAAAAGAAGGAAGAGCCAGG - Intergenic
1153068464 18:1076790-1076812 TAGGCAAAGAAGAAAAAGTAAGG + Intergenic
1153167843 18:2282567-2282589 CTGGCAAAGATGGAACACTTTGG - Intergenic
1153704786 18:7734271-7734293 CAGGAAAAGAAGGAACATGATGG + Intronic
1153732001 18:8023189-8023211 AAGGAAAAGAGGGAAAAGTCAGG + Intronic
1155137306 18:23008552-23008574 TAGGCAAAGATGGGACAATCTGG - Intronic
1155160258 18:23189749-23189771 CAGGCTCAGAAGGAAGAGCCAGG - Intronic
1155828899 18:30486640-30486662 CAGGCAAAGAAGTAGCAGAAAGG + Intergenic
1155909584 18:31493007-31493029 CAGGCTGAGAAGCAACAGCCTGG - Intergenic
1156345059 18:36249517-36249539 GTGACACAGAAGGAACAGTCTGG + Intronic
1157997316 18:52573857-52573879 CATCCTAAGAGGGAACAGTCTGG - Intronic
1158958001 18:62560186-62560208 GAGGCAAATATGGAGCAGTCTGG + Intronic
1160375255 18:78406508-78406530 CAGGCAAGGAAAGGACAGCCAGG + Intergenic
1160526838 18:79543371-79543393 CAGGACAAGAAGGGACAGCCTGG - Intergenic
1161215899 19:3094924-3094946 CAGGCAGGGAAGGCACAGGCAGG - Intronic
1161215913 19:3094976-3094998 CAGGCAGTGAAGGCACAGGCAGG - Intronic
1161313516 19:3607480-3607502 GAGCCAGAGGAGGAACAGTCTGG + Intergenic
1161527722 19:4767555-4767577 CAAGCATAGAAGGGACAGTTAGG - Intergenic
1163428067 19:17250041-17250063 CAGGCAATGAAGAAAGACTCAGG - Exonic
1163935371 19:20437566-20437588 CAGACCAGGAAGCAACAGTCTGG - Intergenic
1163977331 19:20864619-20864641 CAGACCAAGAAGCAACAGGCTGG - Intergenic
1164628637 19:29746520-29746542 CAGGCAGGGCAGGAAGAGTCTGG + Intergenic
1165682617 19:37790547-37790569 TAGTCCAAGACGGAACAGTCAGG - Intronic
1165859304 19:38898929-38898951 CAGGGCATGAAGGAACACTCAGG + Intronic
1166748141 19:45151722-45151744 CAGGCACAGAAGGACCAGTGAGG - Exonic
1166927256 19:46277506-46277528 CAGGGAAAGAAGGAAGATTTAGG + Intergenic
925226729 2:2189948-2189970 CACACAAAGAAGGAACTGTGTGG - Intronic
925923509 2:8654084-8654106 CGGGAACAGGAGGAACAGTCAGG - Intergenic
927827126 2:26316731-26316753 CAGGCAAGGAAGGGTCTGTCTGG + Intronic
928270952 2:29854073-29854095 CAGGATAAGAAAGAACATTCCGG - Intronic
928456806 2:31429853-31429875 GGGGCCAAGAAGGAAGAGTCAGG + Intergenic
930934936 2:56937497-56937519 AAGGCAGAGAAGGAGCAGGCAGG + Intergenic
931644770 2:64411924-64411946 CTGGCAGAGGAGGAAGAGTCAGG - Intergenic
932208254 2:69903346-69903368 CATTCAAACAAGGAACAGTATGG - Intronic
933263297 2:80153575-80153597 CAGGAAAAGAAGGAGCAGTGAGG - Intronic
934765869 2:96879717-96879739 CAGGCAGAGAAGACACAGTGGGG + Intronic
935206662 2:100902200-100902222 AAGGCAAACAAGGAACAGGATGG - Intronic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
935324502 2:101924144-101924166 CAGGAAAATGAGGAACAGTTTGG + Intergenic
935734426 2:106095713-106095735 TGGGCAAAGAGGGAACAGCCAGG + Intronic
936992149 2:118377539-118377561 CAGGAGAAGAAGGAAGATTCTGG - Intergenic
938608582 2:132922520-132922542 CAGAGAGAGAAGGAACAGCCAGG - Intronic
939251379 2:139685196-139685218 GAGGGAAAGAAGAAAAAGTCTGG + Intergenic
942699059 2:178683025-178683047 CTGGCCAAAAAAGAACAGTCAGG - Intronic
943620333 2:190141219-190141241 CAGGAAAATAAGGAAAAGTTTGG - Intronic
944180987 2:196893953-196893975 ACGGCAAAGAAGTAACAGTGAGG + Intronic
944290082 2:197995261-197995283 AAAGGAAAGAATGAACAGTCTGG - Intronic
947147068 2:227077997-227078019 CAGGCAAAGCAGGACCTGTGGGG - Exonic
947999033 2:234552636-234552658 CAGGCAAAGATATAACAGGCAGG + Intergenic
948807176 2:240458013-240458035 GAGGCCCAGAAGGAACAGTGTGG + Intronic
1169041248 20:2497375-2497397 CAGGGAAAAAAAGAACCGTCAGG + Intronic
1169187208 20:3628826-3628848 CAGGCTAAGAAGCAGCAGTAGGG - Intronic
1170448137 20:16451908-16451930 TAGGACAAGAAGGAAGAGTCAGG - Intronic
1172458263 20:35094587-35094609 TAGCCAAAGAAGTTACAGTCAGG + Intergenic
1174749044 20:53093574-53093596 AAGCCAAAGAAAGAACATTCTGG - Intronic
1175504517 20:59472192-59472214 CAGGAAAAACAGGAACAGTTTGG - Intergenic
1176776601 21:13140549-13140571 CAGTCAAAGAAAGAACAATGAGG + Intergenic
1177426902 21:20935053-20935075 CAGGCAAACAAATAACACTCTGG + Intergenic
1177585456 21:23088148-23088170 CAGGCAAAAGATAAACAGTCAGG + Intergenic
1178005472 21:28215187-28215209 AAGGCAAAGCAGGAACATTTGGG - Intergenic
1180005034 21:45016745-45016767 CAGGCTCAGAAGGAACAGATGGG + Intergenic
1182005680 22:26957513-26957535 TTGGCAAAGAAGGAAGAGTAGGG - Intergenic
1182109287 22:27711392-27711414 CAGGCAAGGAAGGGAAGGTCTGG + Intergenic
1183151327 22:36040014-36040036 CAGGCAGAGTTGGAACAGTTCGG - Intergenic
1183602297 22:38846982-38847004 CAGGAACAGAAGGAACAGAGTGG + Intergenic
1183776430 22:39969209-39969231 AAGGCAAAGAAGGCAAAGGCAGG - Intronic
1184765885 22:46572300-46572322 CAGGCAATGAAGTCACAGTGTGG - Intergenic
1185172765 22:49303349-49303371 CAGGCAATTAGGGAAGAGTCAGG + Intergenic
1203246919 22_KI270733v1_random:79378-79400 CAGACACAGAAGCAACAGCCTGG - Intergenic
951541436 3:23786000-23786022 CTGGCAAAGATGGAATAATCTGG - Intergenic
954595285 3:51819144-51819166 CAAGAAAAGAAAGAAAAGTCAGG - Intronic
955357859 3:58246440-58246462 CAGGCAGAGGAGGGACAGGCAGG - Intronic
955461328 3:59186823-59186845 CAGGCCAAGTAAGGACAGTCAGG + Intergenic
957364267 3:79201985-79202007 CAGGCAAAGAAGGGAAATTGAGG - Intronic
959589890 3:108067382-108067404 AAGGCAAAGAAAGAACAGATAGG + Intronic
961417156 3:126767474-126767496 CAGGCATGGGAGGAAAAGTCAGG - Intronic
962386312 3:134935301-134935323 CAGGCGAAGAAGGGAGGGTCAGG + Intronic
962485384 3:135837720-135837742 TAGGCAAAGAAGACACAGGCAGG - Intergenic
966474666 3:180330333-180330355 CAGGCAAAGAAAGGACAGGAAGG + Intergenic
967016427 3:185486441-185486463 CAGGCAGCGAAGGACCAGGCTGG - Exonic
967245786 3:187485052-187485074 CAGGAACAGAAGGAACAGTGTGG + Intergenic
967624760 3:191670634-191670656 GAGGGAAAGAAGGAACATTTGGG + Intergenic
969515152 4:7643338-7643360 CAGGCACAGAGGAAACAGGCTGG - Intronic
969719780 4:8887167-8887189 CAGGCAAAGAAGCAACAGAGAGG - Intergenic
971101934 4:23476502-23476524 CAGGGAAAGAAGGAGCCCTCTGG - Intergenic
971125744 4:23752144-23752166 GAGGCTAAGAAGAAACAGTATGG + Intergenic
971167492 4:24199027-24199049 CAGGGAAAGAAGGAAGAGTAGGG - Intergenic
971471431 4:27031115-27031137 CAGGCAGAGATGGAACAGTCAGG + Intergenic
972626834 4:40807667-40807689 CAGGCAGAAGAGGAACACTCGGG - Intronic
975795383 4:78001228-78001250 TAGGAAAAGAAGGAATATTCTGG + Intergenic
975897454 4:79110364-79110386 CAGACTGAGAAGCAACAGTCTGG + Intergenic
976174260 4:82336150-82336172 CAGGCCAAAAAGGAAAAGTGAGG - Intergenic
976179342 4:82384370-82384392 CAGGCAGATAAGAAACATTCTGG - Intergenic
977403936 4:96572131-96572153 CAGGCAGAAAAGCAACAGTCTGG + Intergenic
977621940 4:99147990-99148012 CAGGAAAAAAAGAAACAGTGAGG - Intronic
977787932 4:101061172-101061194 AAAGCAAAGAAAGAAAAGTCAGG + Intronic
979868509 4:125786349-125786371 GGGGGAAAGAAGGAACAGTGAGG - Intergenic
979978443 4:127225075-127225097 CACGGAGAGAAGGAACAGTGTGG - Intergenic
980308763 4:131100218-131100240 CAGGCCAAGTTGGAACAGTTTGG + Intergenic
981086391 4:140689014-140689036 CAAGCACAGATGGAACAATCGGG - Intronic
981361809 4:143854718-143854740 CAGGCAGGGAAGGAGCAGTTGGG + Intergenic
981372540 4:143975621-143975643 CAGGCAGGGAAGGAGCAGTTGGG + Intergenic
981381635 4:144078823-144078845 CAGGCAGGGAAGGAGCAGTTGGG + Intergenic
984842482 4:184081017-184081039 CAGGCAAAGAAGCTGCATTCTGG + Intergenic
984873091 4:184344717-184344739 CAGCCCATGAAGGAACAATCAGG - Intergenic
985355483 4:189114889-189114911 GAGGCTAAGAAAGAAAAGTCTGG - Intergenic
987379252 5:17269399-17269421 TAGGCAAAAAAGGACCAGGCTGG + Intronic
988396968 5:30707851-30707873 CAGGAAGATAAGGAAAAGTCTGG + Intergenic
989190786 5:38667707-38667729 CAGGCAAAGCAGGAAAACACAGG - Intergenic
990367815 5:55088282-55088304 CAGGCCAAAAAGGAAAAGTGAGG - Intergenic
990504452 5:56430772-56430794 CAGGCAAGAAAGGAAGGGTCAGG - Intergenic
991129943 5:63110804-63110826 CAAGGAAGGAAGGAACAGTAAGG - Intergenic
992497492 5:77308255-77308277 CAGACCAAGAAGGAAAAGGCAGG + Intronic
993329464 5:86579930-86579952 CAAGCAAGGAAGAAAAAGTCAGG + Intergenic
995875657 5:116786648-116786670 CAGGCAAAGAACAAACAGGGTGG - Intergenic
996258887 5:121441079-121441101 AAGGCAAAGCAGGAGCAGACAGG - Intergenic
997174111 5:131756235-131756257 CATGTAAAAAAGGAACAGTGAGG + Intronic
997270755 5:132535769-132535791 CAGGCAAAAAGGGAACAATAAGG + Intergenic
997286357 5:132681482-132681504 GAGACAAAGAAGGAACAGTGAGG + Intronic
997844734 5:137276245-137276267 CAGGCACAGAAGGAATAGCATGG - Intronic
998063666 5:139139079-139139101 CAGGGAGAGTAGGAACAGCCGGG + Intronic
998449932 5:142226367-142226389 CATGCAAAGAAGGAACAATGAGG - Intergenic
998787431 5:145727845-145727867 CAGGTAAACAAGCAACATTCAGG + Intronic
999287772 5:150404503-150404525 CAAACCAAGAAGGAACAGACAGG + Intronic
1001331563 5:170766168-170766190 GAGGGAAAGAAGGAAGAGTTGGG + Intronic
1002092731 5:176814405-176814427 AAGGCAAAGGAGCTACAGTCTGG - Intronic
1002919948 6:1560968-1560990 CAGGCATTGAATGAACAGTCAGG + Intergenic
1003777349 6:9383212-9383234 CAGGCCCAGAAGGAATATTCTGG + Intergenic
1004242410 6:13936798-13936820 CAGGCAAATATGGGACAGTTTGG + Intronic
1004446270 6:15701824-15701846 AAGGCAATGAAGGAACAGTAAGG - Intergenic
1004777469 6:18863868-18863890 AAGGCAAAGGGGGAACAGGCAGG - Intergenic
1005150923 6:22749576-22749598 CATGTGAAGAAGGAACAGACTGG - Intergenic
1007389359 6:41541389-41541411 CAGGGAATGGAGGAACAGTGGGG + Intergenic
1008258253 6:49331819-49331841 CAGTCAAGGAAGGGACAGACCGG + Intergenic
1010720723 6:79280440-79280462 GAGACCAAGAAGGAACTGTCAGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013374531 6:109501601-109501623 CAGGCAAAGAATCATCAGTGTGG + Intronic
1014708670 6:124780207-124780229 AAGGCCAAGAAGGAACTTTCGGG + Intronic
1015268909 6:131318950-131318972 AAGGCATAGAAGGAAAAATCAGG - Intergenic
1016202669 6:141431047-141431069 CAGGCAGAGATGGAACACTTTGG - Intergenic
1016204424 6:141454382-141454404 GAGGGAAAGAAGGAAGATTCGGG - Intergenic
1016380295 6:143470682-143470704 AAGGAAAACAAGGAAAAGTCTGG - Intronic
1017406313 6:154123411-154123433 CAGGCAAAAATGGAGCAGCCTGG - Intronic
1019653009 7:2170799-2170821 CAGGCTGAGAAGGGAAAGTCGGG + Intronic
1021114074 7:16729043-16729065 CAGCCAAAGAAAGAAGACTCGGG - Intergenic
1021331866 7:19348046-19348068 CAGGAAAAGAATGAAAAGTTTGG + Intergenic
1022146742 7:27550568-27550590 CAGGCAAAGAAGGCAGAGAAGGG - Intronic
1022756008 7:33290878-33290900 CTGGCAAAGATGTAACAGTCTGG - Intronic
1023030709 7:36088306-36088328 AAGGCAAAGGGGGAACAGGCAGG - Intergenic
1023093801 7:36640385-36640407 GAAGCAAAGAGGGAGCAGTCAGG + Intronic
1023461316 7:40400389-40400411 AAGGCAAAGGAGGAGCAGGCAGG + Intronic
1023779581 7:43643421-43643443 AAGGCAAGGAAGCAACAGACAGG + Intronic
1023866530 7:44241069-44241091 CAGGAAAAGAAGGGGCTGTCAGG - Intronic
1023953287 7:44865103-44865125 CAGGCAAAGTAGGACCAGGAAGG + Intergenic
1025211521 7:57021576-57021598 CAGGCACAGAAGGAAGAATGGGG + Intergenic
1025557865 7:62332192-62332214 CAGTCAAAGAAAGAACAATGAGG - Intergenic
1025660434 7:63555271-63555293 CAGGCACAGAAGGAAGAATGGGG - Intergenic
1028971439 7:96863061-96863083 CAGGCAGAGAAAGAACAGGAGGG + Intergenic
1030303014 7:107993011-107993033 CATGCCAAGAAGGAGCAGGCAGG + Intronic
1031224577 7:119019331-119019353 CAGACAAAGAATAAACTGTCAGG + Intergenic
1031615429 7:123873962-123873984 CAGGCAAAGAAGCAACGTTAAGG - Intronic
1031619686 7:123920984-123921006 CAGGAAAAGAAGGAACTTTGAGG - Intergenic
1034372640 7:150613396-150613418 CAGGTAAACAAGCAACAATCAGG + Intergenic
1034700357 7:153090099-153090121 CAGGTAACGAATGAACAGGCTGG - Intergenic
1034939056 7:155218645-155218667 AAGGCACAGGAGGAACATTCTGG + Intergenic
1036084851 8:5602331-5602353 CAAACAAAGAAGGAAAGGTCAGG + Intergenic
1037552064 8:19984437-19984459 CAGGTAAGGAAGGAGCAGGCTGG + Intergenic
1037840731 8:22243778-22243800 CAGGGAAAAAAGAAACAATCAGG + Intergenic
1038544319 8:28413483-28413505 GAGGGAAGGAAGGAAAAGTCAGG - Intronic
1038980302 8:32752188-32752210 CAGGGAGAGAAGGACCAGTGGGG + Intronic
1039057936 8:33551302-33551324 CAGGCAGAGAAGGAAGCTTCTGG + Intronic
1040387157 8:46921322-46921344 CAGGGGAAGGAGGAACAGGCTGG + Intergenic
1040561634 8:48527951-48527973 CAGGGAAGGAAGGAACAGGATGG - Intergenic
1046330098 8:112702751-112702773 CAGGCAAAGAAGGAACTGAGGGG - Intronic
1046808255 8:118504084-118504106 CAGGAAAAGAGGGAAGAGTAAGG - Intronic
1046925235 8:119779905-119779927 GAGGCAGAGATGGAATAGTCAGG - Intronic
1047026012 8:120825369-120825391 AAGGCAAAGAATAAACATTCTGG - Intergenic
1047781213 8:128112728-128112750 CAGGTAAAGAAGGAAGTCTCTGG + Intergenic
1048135364 8:131742272-131742294 CAGGGAAAGAAGGAAGATTTGGG - Intergenic
1048184668 8:132228918-132228940 CAGGGAGAGAGGGAACAATCAGG + Intronic
1048782862 8:138021121-138021143 CAGGCAGAGTTGGAACAGTTTGG + Intergenic
1049270032 8:141690649-141690671 ATGACAAGGAAGGAACAGTCAGG + Intergenic
1050258222 9:3815334-3815356 GAGGGAAAGAAGGAACATTTGGG + Intergenic
1050737967 9:8786375-8786397 CAGACAAAAAAGGAAAAGTTTGG + Intronic
1051977067 9:22963489-22963511 CAGGCATGGAAGGAACAGAGTGG - Intergenic
1052245561 9:26329920-26329942 CAGGCAAAGAAGCAAAAGCATGG - Intergenic
1052361672 9:27567840-27567862 AAGGCAAGAAAGGAACACTCAGG + Intronic
1052943846 9:34151518-34151540 CCGGCAAAGAAGGGGCACTCTGG - Intergenic
1053259300 9:36647798-36647820 GAGGCAAAGAAAGGACAGTAAGG - Intronic
1054155073 9:61634405-61634427 CAGGCAAAGAGGGCGCAGTCAGG + Intergenic
1054914227 9:70480975-70480997 CAGACAAAGAGGGAAAAGACAGG + Intergenic
1054951615 9:70858396-70858418 GAGGTAAAGAAGGAACAGGTTGG + Intronic
1055030105 9:71765635-71765657 AAGCCAGAGAAGGAACAGTTGGG - Intronic
1056461514 9:86813676-86813698 CTGGCAAAGAAGGCACAGTGAGG + Intergenic
1057482938 9:95460067-95460089 AAGGCAGAGAATGAACAATCTGG + Intronic
1057585190 9:96322633-96322655 CAGGCAAAAGAGGAAGAGTGGGG + Intronic
1057955356 9:99403075-99403097 GAGGGAGAGAAGGAACAGCCTGG + Intergenic
1058240116 9:102547579-102547601 CAGGCAGAGATGGAACAGTTTGG + Intergenic
1058299116 9:103347610-103347632 CAGGCAAAGGAGAAAAATTCAGG + Intergenic
1058562408 9:106243948-106243970 CAGGCAGAGAAGGAAAAAGCAGG - Intergenic
1059378625 9:113906357-113906379 AAGCCAAAGGAGGAACAGCCAGG - Intronic
1059843416 9:118243785-118243807 CAGGCAGAGGTGGAACAGTTTGG - Intergenic
1060166895 9:121424842-121424864 ATGGCAAAGAAGAAACAATCTGG + Intergenic
1060312486 9:122475098-122475120 CAGGCAGACAAGGAGCAGCCTGG + Intergenic
1062358345 9:136175699-136175721 CAGGCTAAGGAGGACCAGCCTGG - Intergenic
1187682467 X:21781151-21781173 CAGGAAAAGAAAGAAGATTCAGG - Intergenic
1189106377 X:38239915-38239937 TAGGCATTGTAGGAACAGTCAGG - Intronic
1190248085 X:48704002-48704024 CAGGCACAGAGAGAACATTCAGG + Intronic
1190641763 X:52487092-52487114 CACCTAAAGAGGGAACAGTCAGG + Intergenic
1190645909 X:52525773-52525795 CACCTAAAGAGGGAACAGTCAGG - Intergenic
1191180019 X:57552461-57552483 AGGGCAAAGAAGAAACAGTTAGG - Intergenic
1191736882 X:64396649-64396671 GAGTCAGAGAAGGAACAGTTGGG - Intergenic
1193796455 X:85880870-85880892 CAGGAAAAGCAGGAACGGTAAGG - Intronic
1194464813 X:94220429-94220451 CAGAAAAAGAATGACCAGTCAGG - Intergenic
1195456171 X:105072440-105072462 CAGGCAGAGTTGGAACAGTTTGG + Intronic
1196413337 X:115443821-115443843 CAAACTAAGAGGGAACAGTCAGG - Intergenic
1201742945 Y:17343260-17343282 CAGGAAGAGAAGGAAGAGTCTGG + Intergenic