ID: 1079402652

View in Genome Browser
Species Human (GRCh38)
Location 11:20118306-20118328
Sequence CAGGGTGATGTGGGGGATGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 510}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079402652_1079402665 24 Left 1079402652 11:20118306-20118328 CCTGCATCCCCCACATCACCCTG 0: 1
1: 0
2: 6
3: 42
4: 510
Right 1079402665 11:20118353-20118375 CAGCCACAGCCTTAGAGCTGCGG 0: 1
1: 0
2: 5
3: 28
4: 280
1079402652_1079402666 25 Left 1079402652 11:20118306-20118328 CCTGCATCCCCCACATCACCCTG 0: 1
1: 0
2: 6
3: 42
4: 510
Right 1079402666 11:20118354-20118376 AGCCACAGCCTTAGAGCTGCGGG 0: 1
1: 0
2: 3
3: 28
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079402652 Original CRISPR CAGGGTGATGTGGGGGATGC AGG (reversed) Exonic
900430788 1:2602229-2602251 CAGGGGCATGTGGGGGCTTCTGG + Intronic
900973734 1:6005373-6005395 GAGGGTGAACTGGGGGATGTGGG + Intronic
900974095 1:6006651-6006673 GAGGGTGAAGTGGGGGATGTGGG - Intronic
900974107 1:6006691-6006713 GAGGGTGAAGTGGGGGATGTGGG - Intronic
901060875 1:6471383-6471405 CTGGGGGAGGTTGGGGATGCTGG + Intronic
901234199 1:7658836-7658858 CAAGGTGCTTAGGGGGATGCTGG + Intronic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
901871509 1:12141416-12141438 CAGTCTGATGTGGGGGCTTCTGG - Intronic
902237040 1:15064161-15064183 CAGAGTGAGGAGGGGGCTGCAGG + Intronic
902573280 1:17360687-17360709 CGGGGTGATGCAGGGGATGGAGG + Intronic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
903639329 1:24847990-24848012 CAGCAGGAGGTGGGGGATGCAGG - Intergenic
903753220 1:25643003-25643025 CAGGGTTCTGTGGGGGACGTAGG + Intronic
904040931 1:27584724-27584746 CAGAGTGCTGTGGGGGAAACAGG - Intronic
904325243 1:29723849-29723871 GATGGTGATGTTGGTGATGCTGG - Intergenic
904384868 1:30134633-30134655 GAGGGTGATGTGGGGGGTGCTGG - Intergenic
904493288 1:30873171-30873193 CAGGGTGGTGTTGAGGCTGCAGG + Exonic
904603179 1:31684611-31684633 CAGGGTGATGCTGGGAATCCTGG - Exonic
905348984 1:37331536-37331558 GAGGGGGATGGGGAGGATGCAGG - Intergenic
905744261 1:40400557-40400579 CTTGGTGATGTGGGGGCTGAAGG + Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906237700 1:44221798-44221820 CAGGTTGGTCTGGGTGATGCTGG + Intronic
906319029 1:44805421-44805443 CAGGGTGCTGGGGAGGAAGCTGG + Intronic
907283190 1:53363808-53363830 AAGGGTGAGGTGGGGGATCCAGG - Intergenic
907510519 1:54954608-54954630 GAGTGTGAGGTGGGGGCTGCAGG + Intergenic
907906079 1:58784461-58784483 GACGGGGATGCGGGGGATGCAGG + Intergenic
908271425 1:62426390-62426412 GCGGGTGCTGAGGGGGATGCAGG - Intergenic
908738506 1:67302654-67302676 CAGGGCGAGGTGGGAGGTGCAGG + Intergenic
909925005 1:81428581-81428603 GAGAGGGAAGTGGGGGATGCAGG + Intronic
911167980 1:94742166-94742188 CAGGCTGATGGGGAGGATGTGGG - Intergenic
912401540 1:109397709-109397731 CGGGGTGAGCTGGGGGCTGCGGG - Exonic
912433072 1:109639924-109639946 CTGGGTGGAGTGGGGGCTGCTGG - Intergenic
912789019 1:112632555-112632577 CAGGGGGATGTGGGGCAGGGAGG + Intronic
913235976 1:116783897-116783919 CAGGGTGCTATGGGGAATTCAGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914816318 1:151065573-151065595 CAGGGTGTTGGGGGAGATGCTGG + Intronic
915312847 1:155013014-155013036 CAGGGTGATTTGAGGGAGGGAGG + Intronic
915498014 1:156294861-156294883 CAGGGTGCTGTGGGGGGTGTTGG + Exonic
916901773 1:169232548-169232570 CAGGGTGTTGGGGGGGGGGCAGG + Intronic
917794395 1:178522134-178522156 CAGGGTGTCTTGGGTGATGCAGG + Intronic
918239539 1:182609582-182609604 CAGGGAGAGGTGGAGGAAGCTGG - Intergenic
918243124 1:182637421-182637443 CAGGGTGTTGTCAGGGGTGCTGG - Intergenic
919422149 1:197383163-197383185 CAGGGATATGTGTGGGATGAAGG - Intronic
919618113 1:199832707-199832729 CAGCATGATGTGGGAGATGGAGG - Intergenic
919823017 1:201484688-201484710 CAGGGTGTGGTGGGTGATGGTGG + Exonic
919870884 1:201820334-201820356 GAGGGAGATCTGGGGGAGGCAGG + Exonic
920173223 1:204084319-204084341 CAGGCAGCTGTGGGGGGTGCAGG + Intronic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
922608937 1:226909991-226910013 CAGGGGCTTGTGGGGGTTGCAGG - Intronic
922784873 1:228277855-228277877 AAGGGTGAGGTGGGGGCTGAGGG + Exonic
923016138 1:230127980-230128002 AAGGGCTGTGTGGGGGATGCAGG + Intronic
924628588 1:245715989-245716011 AAGGGGGATGTTGGGGAAGCTGG - Intergenic
1062929149 10:1340987-1341009 CAGGGTTCTCTGGTGGATGCTGG - Intronic
1064490563 10:15851381-15851403 AAGGGTGAAGAGGGAGATGCAGG - Intronic
1067538902 10:47137478-47137500 AAGGGTGAGGTGGGGTCTGCTGG - Intergenic
1069995664 10:72340775-72340797 CAGGGTGATGTGAGTGAGGAGGG - Exonic
1070004386 10:72409080-72409102 CAGCATGATGTGTGGGAAGCGGG - Intronic
1070056094 10:72935974-72935996 CATGGTGGTGTGGGGGGTTCTGG - Intronic
1070162405 10:73874208-73874230 CAGGGCGCGGAGGGGGATGCGGG + Intronic
1070341561 10:75502944-75502966 CAGGGTGGTGTGGGCTGTGCAGG - Intronic
1070707401 10:78650436-78650458 CAGGATGATTTGGTGGATGGAGG + Intergenic
1070721983 10:78763230-78763252 CAAGGTGATGTGGGGCATGCGGG - Intergenic
1070824235 10:79381554-79381576 CACGGTGATGGGGAGGAGGCAGG - Intergenic
1071137408 10:82468208-82468230 CAGCGTGATGTGGTGGAGGGAGG - Intronic
1072761536 10:98060834-98060856 CAGAGAGATGTGGGGTATCCAGG + Intergenic
1072782636 10:98260962-98260984 CAGGGTGGTGTGCGGGATGCTGG - Exonic
1073036580 10:100567910-100567932 CTGGGGGAAGTGGGAGATGCAGG - Intergenic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073119489 10:101112926-101112948 CAGGGCGACGTGGGGGCTGAGGG - Intronic
1074185123 10:111094448-111094470 CAGGGTCATGTGTGGGATGGAGG + Intergenic
1074401501 10:113144537-113144559 CAGGATGAGGTGGGGGGTCCTGG - Intronic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076196073 10:128519310-128519332 CGGGGTGAAGTGGGGGCTGTAGG - Intergenic
1076255225 10:129017834-129017856 AAGGGTGATGTTGGGGGTCCTGG + Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076715993 10:132364059-132364081 CAGGGTGATGGGGGGTTAGCGGG - Intronic
1076850340 10:133089282-133089304 CAGGGTGGCGTGGAGGAGGCCGG - Intronic
1076908076 10:133373127-133373149 TGGGGTCAGGTGGGGGATGCGGG + Intronic
1077094695 11:794374-794396 CAGGGAGCGGTGGGGGAGGCAGG - Intronic
1077145644 11:1043075-1043097 CAGAGGGTTGTGGGGGATGCTGG + Intergenic
1077210363 11:1368364-1368386 CAGGGTGAAATGGGTGTTGCGGG - Intergenic
1077484026 11:2830700-2830722 CACGGAGATGTGGGGGTTCCTGG - Intronic
1077488897 11:2851460-2851482 CAGGGTGAGGATGGGGAAGCTGG - Intergenic
1077498461 11:2897991-2898013 AAGGGTGATGTGGAGGGAGCGGG - Intronic
1077934168 11:6765695-6765717 TAGGGGGATTTGGGAGATGCTGG + Intergenic
1077996698 11:7458728-7458750 GAGAGTAATGTGGGGGATGCAGG + Intronic
1078097809 11:8311358-8311380 GAGGGGGATGTGGGGGATATGGG - Intergenic
1078433069 11:11302468-11302490 CAGGCTGGTCTGGGGGGTGCAGG - Intronic
1078528485 11:12118634-12118656 CAGGGGCATGTTGTGGATGCAGG + Intronic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1081671990 11:44947563-44947585 CTGGGTGAGTTGGGGGAGGCAGG + Intronic
1081864718 11:46353227-46353249 CAGTGTGAGCTGGGGGATCCTGG - Intronic
1082093716 11:48109830-48109852 CTGGGTTATGTGGGGGCTGGCGG - Intronic
1082130762 11:48486414-48486436 CACGGTGGTGTGAGAGATGCAGG + Intergenic
1082134009 11:48526775-48526797 CACGGTAATGTGGGAGCTGCAGG - Intergenic
1082564269 11:54657287-54657309 CATGGTGGTGTGAGAGATGCAGG + Intergenic
1082567026 11:54693161-54693183 CACGGTAATGTGGGAGCTGCAGG - Intergenic
1082614657 11:55343910-55343932 CACAATGATGTGGGAGATGCAGG - Exonic
1082618265 11:55389238-55389260 CACAGTGATGTGGGAGCTGCAGG - Intergenic
1082621810 11:55432156-55432178 CACGGTTATGTGGGGGCTGCAGG - Intergenic
1082624585 11:55467480-55467502 CACGGTGATGTGCGAGCTGCAGG - Intergenic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1082838148 11:57666993-57667015 TTGGGTGAGGTGAGGGATGCGGG + Intergenic
1083018201 11:59478145-59478167 CACAGTGATGTGGGAGGTGCAGG - Exonic
1083019499 11:59492367-59492389 CACAGTGATGTGGGAGGTGCAGG - Intergenic
1083021837 11:59515628-59515650 CACGGTGATGTGGGAGGTGCAGG - Exonic
1083023747 11:59532500-59532522 CACAGTGATGTGGGAGGTGCAGG - Intergenic
1083148144 11:60773677-60773699 CAGGGTGAAGGGGAGGGTGCAGG + Intronic
1083167926 11:60902904-60902926 TAAGGTGAGGTGGGGGGTGCAGG + Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1084603476 11:70159896-70159918 CAGGGTGTGGTGAGGGCTGCAGG + Intronic
1085517592 11:77120630-77120652 CATGGTGGTGAGGGGGAGGCGGG + Intronic
1086461657 11:87011806-87011828 CAGAGTGAGGTGGGGCATGGTGG + Intergenic
1087600173 11:100304528-100304550 CAGGGTTAAGTGGGTGATGACGG + Intronic
1087724790 11:101704979-101705001 CATGGTGATGTGTGGGAGGTTGG - Intronic
1088397308 11:109382782-109382804 CAGGGCCAGGTGGAGGATGCGGG + Intergenic
1088595474 11:111437414-111437436 TTGGGGGATGAGGGGGATGCTGG + Intronic
1088798782 11:113286879-113286901 AAGGGTGATGTAGGGGATGATGG - Intergenic
1089379037 11:118014664-118014686 CTGGGTGAGGTGGGGGTTGGGGG - Intergenic
1089568358 11:119385086-119385108 CGGATTGATGTGGGGGAAGCTGG + Intergenic
1089649271 11:119901788-119901810 CAGGGAGTAGTGGGCGATGCAGG + Intergenic
1090037266 11:123259885-123259907 CAGAGGGATGTGTGGGATGGAGG - Intergenic
1090170765 11:124602183-124602205 AAAGCTGATGTGGAGGATGCTGG - Intergenic
1090663782 11:128901621-128901643 CAGGGTGTTGACGAGGATGCAGG - Exonic
1091230640 11:133985906-133985928 CAGGGAGCTGTCGGGGATTCTGG + Intergenic
1091903564 12:4164866-4164888 CATAGTGATGTGGGAGATCCGGG - Intergenic
1091963371 12:4718162-4718184 GAGGGGAAGGTGGGGGATGCAGG + Intronic
1092284588 12:7121477-7121499 CAGGGTCATGTGGGAGGTGGAGG + Intergenic
1094721352 12:33067773-33067795 CAGGGGCCTGTGGGGGATGGGGG - Intergenic
1095233076 12:39765296-39765318 AAGGGTGATGGGGTGGATGAGGG + Intronic
1095665179 12:44788978-44789000 CAGGTTGCTGTGGGGGTTGGGGG - Intronic
1095969950 12:47894726-47894748 CAGGGTGGGGCGGGGGAGGCTGG + Intronic
1096588462 12:52641522-52641544 CAGGGAGAAGGAGGGGATGCTGG + Intergenic
1096839231 12:54370530-54370552 CAGGGAGAGGTGGGGTTTGCAGG - Intronic
1097178233 12:57155979-57156001 CAGGATGAATTGGGGAATGCAGG + Intronic
1097218908 12:57435345-57435367 CAGAGGGATGTGGGGGTTGTCGG - Intronic
1097267351 12:57754035-57754057 GAGGCTGAAGTGGGGAATGCTGG - Intronic
1097385979 12:58950431-58950453 ACGGGTGCTGTGGGGGATGAGGG + Intergenic
1097466645 12:59934195-59934217 CAGGGTGTTTTTGGGTATGCTGG - Intergenic
1097699831 12:62808725-62808747 CAGGGTGAAGTAGGGGCTTCTGG - Intronic
1098341422 12:69455613-69455635 CCGGGTGTGGTGGGGTATGCCGG - Intergenic
1098489567 12:71059697-71059719 CGGGGAGAGGTGGGGGATGAAGG + Intronic
1098960933 12:76739162-76739184 GTGGCTGATGTGGGGGATGGGGG + Intergenic
1100221217 12:92506233-92506255 GAGGGTGGAGTGGGGGATGGGGG + Intergenic
1100610440 12:96187515-96187537 CACGGTTCTGTGGGGGATGTAGG + Intergenic
1101701672 12:107179649-107179671 CAGGGTCCTCTGTGGGATGCTGG - Intergenic
1101740269 12:107494951-107494973 CACGGGACTGTGGGGGATGCAGG + Intronic
1102472279 12:113166032-113166054 CAAGGTGCTGTGTGGGGTGCAGG - Exonic
1102473853 12:113175982-113176004 GAGGGGGATGTGGGGGAAGTGGG - Intronic
1102526909 12:113519152-113519174 GAGGGTGATGTGGGGGAGTCTGG + Intergenic
1102590773 12:113955316-113955338 CAGGGGGAGCTGGGGAATGCTGG + Intronic
1102707709 12:114896332-114896354 AGGGGTGAGGAGGGGGATGCGGG + Intergenic
1103239891 12:119404428-119404450 CAGGGTGGTGGGGGGGAGGTAGG - Intronic
1104071972 12:125353721-125353743 CAGTGAGCTGTGGGGGATGAAGG - Intronic
1105299458 13:19119011-19119033 GAGGGTGATGGGGGGGAAGTGGG + Intergenic
1105539430 13:21302631-21302653 CAGGGTGGTATGGGGGAGGTGGG - Intergenic
1105700935 13:22935324-22935346 AAGGGTGATGTGTGGGCCGCTGG + Intergenic
1105853764 13:24358381-24358403 AAGGGTGATGTGTGGGCTGCTGG + Intergenic
1105908247 13:24835141-24835163 GAGGCTGCTGTGGGGGATGGGGG - Intronic
1106454081 13:29911627-29911649 GATGGGGATGTGGGGGATGAGGG + Intergenic
1108700545 13:52940500-52940522 CTAGGTGCTGTGGGGGATGTGGG + Intergenic
1108944148 13:56000495-56000517 CAGGGAGATGAGGAGGCTGCAGG - Intergenic
1111707539 13:91769624-91769646 CAGGGTGATGCAGATGATGCTGG + Intronic
1112578957 13:100662196-100662218 CAGGGTGAGGTGGAGGAGGGTGG - Intronic
1112578978 13:100662242-100662264 CAGGGTGAGGTGGAGGAGGGTGG + Intronic
1113561680 13:111286578-111286600 CAGGGTGCTTTGGGAGATGCTGG - Intronic
1114261833 14:21042588-21042610 GAGAGTGATGTTGGGGATGGAGG + Intronic
1114424569 14:22611370-22611392 TGGGGTGAAGTGGGGGATGGAGG - Exonic
1115395061 14:32899420-32899442 CAGAGAGATGTGTGAGATGCTGG - Intergenic
1117536935 14:56711415-56711437 CTGGGTGATGTGGCGTGTGCTGG + Intronic
1118718835 14:68579679-68579701 CAGGCTGATTTGGGAGCTGCCGG - Intronic
1119060485 14:71469245-71469267 TAGAGTGATGCTGGGGATGCTGG - Intronic
1119073367 14:71609868-71609890 CAGGGTGGGGTGGGGGGCGCAGG - Intronic
1119657709 14:76429204-76429226 CAGGCTGCTTTGGGGGAGGCTGG - Intronic
1120450920 14:84665911-84665933 GCGGCTGCTGTGGGGGATGCAGG + Intergenic
1120704733 14:87734829-87734851 CAGGGGGATGGGGGGGACGGGGG + Intergenic
1120714367 14:87824265-87824287 CAGTGTGATGAGGGGGATTGGGG - Intergenic
1120835824 14:89037567-89037589 GAGGGTGATGTGTGTGATGCTGG + Intergenic
1121119239 14:91365386-91365408 CAGGGTCATGTGGGGCGTGAGGG - Intronic
1121175158 14:91885429-91885451 CAGAGTGTTGTGGGGTAGGCAGG + Intronic
1121459855 14:94066312-94066334 GTGGGTGTTGTGGGGGATGGGGG - Intronic
1121977102 14:98415129-98415151 CAGAGAGATGTGGGGTATGAAGG + Intergenic
1122348406 14:101074238-101074260 CAGGGTGAGGTCTGGGCTGCAGG - Intergenic
1122599033 14:102912236-102912258 CAGGGCGCTGTGGTGGCTGCAGG - Intergenic
1122842539 14:104473375-104473397 AAGGGTAATGTGTGGGCTGCTGG + Intergenic
1122885878 14:104710036-104710058 CAGGGACAGGTGGGGGGTGCAGG + Intronic
1123676680 15:22715639-22715661 GAAGGTGAAGTGGGGGAAGCAGG - Intergenic
1124557126 15:30736422-30736444 GAGGCTGCTGTGGGGGATGGGGG - Intronic
1124674137 15:31669323-31669345 GAGGCTGCTGTGGGGGATGGGGG + Intronic
1125328360 15:38559903-38559925 CTGGGTGATGTGGGCCAAGCTGG + Exonic
1125600041 15:40910516-40910538 CAGGGTGCAGTGGGGGATGCTGG - Intergenic
1125610950 15:40969830-40969852 CCAGGTGATGTGGAGGCTGCTGG - Intergenic
1129096314 15:73212255-73212277 AAGGATGATATGGGGGATGGAGG - Intronic
1129158381 15:73732875-73732897 CAGGATGGGGTGGGGGTTGCAGG - Intergenic
1129689163 15:77703592-77703614 TGGGGTGATGTCAGGGATGCTGG + Intronic
1129755327 15:78094587-78094609 CAGGGTGCTGGGGGAGCTGCAGG + Intronic
1130923398 15:88367384-88367406 CAGGGAGTTCTGGGGGACGCAGG - Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132572475 16:649953-649975 CTGGGTGCTGTCGGTGATGCGGG + Intronic
1133091627 16:3408889-3408911 CATGGTGAAGTCGGTGATGCTGG - Exonic
1133386060 16:5371351-5371373 CAGAGTGATGCCAGGGATGCCGG + Intergenic
1134022235 16:10929274-10929296 GAAGGTGAAGTGGGGGAAGCAGG + Exonic
1134136761 16:11681663-11681685 CAGGGTGATGAGGGGGAGATGGG - Intronic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134905018 16:17972550-17972572 CAGGCTGACGTGGGGGCGGCCGG - Intergenic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1136074483 16:27807379-27807401 CAGGGTGCAGTGGGGGGTGGGGG + Intronic
1136099374 16:27982358-27982380 CACTGGGATGCGGGGGATGCTGG - Intronic
1136296749 16:29308384-29308406 CACCGGGATGTGGGTGATGCAGG - Intergenic
1136391081 16:29964659-29964681 CAGGGTGGTGGGGGGGGCGCGGG - Intronic
1136684657 16:31986989-31987011 CAGGATGAGGTGGGTGAAGCTGG + Intergenic
1136785281 16:32930525-32930547 CAGGATGAGGTGGGTGAAGCTGG + Intergenic
1136884501 16:33923279-33923301 CAGGATGAGGTGGGTGAAGCTGG - Intergenic
1137271597 16:46906001-46906023 CAGGGTTCTGTGGTTGATGCTGG + Intronic
1137594118 16:49712657-49712679 CAAGGTGATGTGGCGGCTGCAGG - Intronic
1137604640 16:49779416-49779438 CAGGGTGATGTTGATGCTGCTGG - Intronic
1137697158 16:50469016-50469038 CTGGGTGATGGGGGTGCTGCAGG - Intergenic
1139633649 16:68245311-68245333 CGGGGGGATGCGGGGGATGCGGG + Intronic
1139940328 16:70600959-70600981 CTGGGAGAAGTAGGGGATGCTGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1141660359 16:85438041-85438063 CAGGCTCATCTGGGGGAGGCGGG + Intergenic
1141673548 16:85505600-85505622 CAGGGTGAAGTTGGGAGTGCCGG + Intergenic
1142058371 16:88014697-88014719 CACCGGGATGTGGGTGATGCAGG - Intronic
1142175901 16:88645183-88645205 CAGGGAGACGGGGGGGATGCGGG + Intronic
1142227907 16:88886371-88886393 CACGGCGATGTGGGGCATGTGGG + Intronic
1203087938 16_KI270728v1_random:1194534-1194556 CAGGATGAGGTGGGTGAAGCTGG + Intergenic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1143108024 17:4539110-4539132 CAGGTTGATGTGCTGGCTGCAGG - Intronic
1143439692 17:6959967-6959989 CATGGTGGGGTGGGGCATGCAGG - Intronic
1143471598 17:7179107-7179129 CAGGGTGTGTTGGGGGGTGCTGG - Intronic
1143617762 17:8064051-8064073 AGGGGTGAGGTGGGGGAGGCGGG - Intergenic
1143683368 17:8494163-8494185 CGGGGTGTGGTGGGGGACGCAGG - Intronic
1143723177 17:8828020-8828042 GCCGGGGATGTGGGGGATGCGGG + Intronic
1144100485 17:11938102-11938124 CAGGGTGAGGTGTGGGTTTCAGG + Intronic
1144311242 17:14016112-14016134 CTGGGTGAAGTGGGTGAGGCAGG - Intergenic
1144631864 17:16877693-16877715 CAGGGGGACATGGGGGAGGCAGG - Intergenic
1145217854 17:21065758-21065780 CACGGTGCTGAGGAGGATGCTGG - Intergenic
1146960883 17:36977215-36977237 CCAGGTGATGTGTTGGATGCTGG + Intronic
1147145592 17:38482670-38482692 CAGGATGAGGTGGGTGAAGCTGG + Exonic
1147258237 17:39194747-39194769 CAGGGTGATGGGGTGGCTCCAGG + Intronic
1147548608 17:41422335-41422357 CAGGGTGTTGGGGGAGATGCGGG - Exonic
1147550556 17:41438759-41438781 CAGGGTGCTGGGGGAGATGCGGG - Exonic
1148260930 17:46183033-46183055 CTGTGTGATTTGGGGGATGGAGG + Intronic
1148669903 17:49402748-49402770 CAGGGAGATGGGCTGGATGCGGG + Intronic
1148717216 17:49724275-49724297 CAGGTTTGTGTGGGGGGTGCGGG - Intronic
1148773708 17:50081368-50081390 CATGTTGATGGTGGGGATGCTGG - Exonic
1149446252 17:56715594-56715616 CAGGGTCCTGTGAGGGATGTGGG - Intergenic
1149634491 17:58155869-58155891 CACGATGATGTGGGTGGTGCAGG - Exonic
1149636066 17:58170371-58170393 CACGATGATGTGGGTGGTGCAGG - Exonic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151976310 17:77485262-77485284 GATGGTGATGTGGGTGATGGTGG + Intronic
1152158825 17:78654143-78654165 CAGGGTAGTGTGCGGGATGCTGG - Intergenic
1152491902 17:80640670-80640692 CAGGATGTTGTGAGGGATGCAGG + Intronic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152650426 17:81490054-81490076 CTGGGTGTTGGTGGGGATGCTGG + Intergenic
1152800359 17:82328007-82328029 CAGGGTGGTGGGGGGGCTGGTGG - Intronic
1155029253 18:21969837-21969859 CAGGGTGCTGTGGGAAGTGCAGG + Intergenic
1155446248 18:25915834-25915856 CAGGGTGAGGCAGGGGATGAGGG - Intergenic
1157764223 18:50285287-50285309 CAGGGTGGGGTGGGGCATGCGGG - Intronic
1158401157 18:57122572-57122594 CAGGATGGGGTTGGGGATGCTGG - Intergenic
1158543768 18:58378858-58378880 CAGGGAGATGTGTGGGAATCGGG + Intronic
1158906044 18:62012852-62012874 CAGTGTGATTTGGAAGATGCTGG - Intergenic
1159948063 18:74458139-74458161 CTGGGTGGGGTGGGGGATGCTGG - Intergenic
1160175672 18:76592248-76592270 GAGGGGGATGAGGGGGATGAGGG - Intergenic
1160625535 18:80201828-80201850 CAGGGTGCTGGGTGGGAGGCGGG - Intronic
1160682038 19:416378-416400 CAGAGAGATGCGGGGGCTGCTGG + Intergenic
1160817723 19:1043766-1043788 CCGGGAGGTGTGGGAGATGCTGG + Exonic
1161078596 19:2299210-2299232 CAGGGTGCTGCCGGGGAGGCAGG + Intronic
1161087268 19:2340894-2340916 CAGGCTGTTGTTGGGGATCCTGG - Exonic
1161088029 19:2344106-2344128 CGGGGTGATGGGGGGGGTGATGG - Intronic
1161144323 19:2668512-2668534 CAGGGAGATGGAGGGGCTGCTGG + Intronic
1161198504 19:3000782-3000804 CAGGGGGAGGTCGGGGAAGCTGG + Intronic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161592610 19:5135603-5135625 CAGGGTGTTGGTGGGGGTGCCGG + Intronic
1161628559 19:5340175-5340197 CCGGGGGATGGGGGGCATGCGGG - Intronic
1161698668 19:5783756-5783778 CTGGGTTTTGTGGGGGACGCAGG - Exonic
1162055889 19:8063795-8063817 CATGGTGGTGTGGGGGCTGATGG + Intronic
1162150903 19:8645015-8645037 GAGGCTGAGGTGGGGGATGGGGG - Intergenic
1162156469 19:8681432-8681454 CAGATGCATGTGGGGGATGCTGG + Intergenic
1162203089 19:9035423-9035445 CAGGATGATGTGGAGGATGGGGG - Intergenic
1162583598 19:11545615-11545637 CAGGGAGATGAGGGAGTTGCTGG + Intronic
1163157860 19:15449215-15449237 CAGGGAGATGGTGGGGAGGCCGG + Intronic
1163237791 19:16039412-16039434 CAGGGTGGTCCTGGGGATGCAGG + Intergenic
1164601001 19:29563105-29563127 CAGGGGCATGGAGGGGATGCCGG + Intronic
1165073982 19:33270579-33270601 CAGGGTGAGGTGGGGCATTGAGG - Intergenic
1165235839 19:34420902-34420924 CAGACTGAGGTGGGGGATGTGGG + Intronic
1165355134 19:35299794-35299816 CAGGGTGGTGTTGGGGAAGGAGG - Exonic
1166053038 19:40272203-40272225 CATGGTGTTGTGGGGGAGCCAGG - Intronic
1166089982 19:40502504-40502526 CAAGGTGAGGCCGGGGATGCAGG + Exonic
1166194379 19:41196475-41196497 CAGGGTGATAGGGAGGATCCAGG + Intronic
1166231546 19:41427857-41427879 CAGGGTGAGGTGGGGGGAACGGG + Intronic
1166781754 19:45346785-45346807 CAGGGCGAGGCGGGGGGTGCTGG + Intronic
1167305130 19:48703725-48703747 CACGGTGATGTGGTGTTTGCTGG + Exonic
1167473561 19:49688136-49688158 CAGGGAGAGGTGGGGCATGAGGG - Intronic
1168059181 19:53882007-53882029 CAGGGTGGTGGGGGGGAGCCAGG + Intronic
1168267424 19:55230423-55230445 CAGGGTGATGAGGGCAATGGGGG + Exonic
925057489 2:866472-866494 CAGGGGACTGTGGAGGATGCAGG - Intergenic
925278775 2:2668885-2668907 CAGGGTGACGCGGGTGATTCTGG + Intergenic
925406267 2:3607074-3607096 CAGGGGGTTGTGGGGGTTGGGGG - Intronic
925413962 2:3656637-3656659 CAGGGCGATGCTGGGGCTGCTGG - Intergenic
926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG + Intergenic
926696535 2:15773071-15773093 CTGGGTGAGGTGGGGGTGGCTGG + Intergenic
927441079 2:23118405-23118427 CAGGCTGAGGTGTGGGTTGCAGG - Intergenic
927764929 2:25798170-25798192 GAGGGTGGTGTGGGGGAGGAGGG + Intronic
928130882 2:28649251-28649273 CAGGGTGATTTGGGGCTTGGGGG - Intergenic
928599267 2:32887121-32887143 CAGGATGATGTAGGGGAAGGAGG + Intergenic
930812122 2:55553605-55553627 CTGGGTGGTGTGGGGGGTGGTGG - Intronic
932462724 2:71893762-71893784 CAGGATGATGTATGGGCTGCGGG - Intergenic
932792914 2:74671465-74671487 CAGGCTGATGTGCTGGAAGCGGG - Intronic
933762439 2:85681605-85681627 CAGGGTCATGTGGGTCATTCTGG + Intergenic
933893709 2:86791938-86791960 CAGGGAGGTGTGGGTGATGTGGG + Intronic
935374473 2:102380691-102380713 CAGGGAGGTGTGGGAGCTGCAGG + Intronic
935698952 2:105793797-105793819 CAGGGAGCTGTGGGGGTTTCAGG + Intronic
936891726 2:117378519-117378541 TAAGGTGACGTGAGGGATGCTGG + Intergenic
938287311 2:130128862-130128884 GGGGGTGATGGGGGGGAGGCAGG - Intronic
938542562 2:132296633-132296655 CAGGATGATGTGGAGGTTGTGGG - Intergenic
938766129 2:134461639-134461661 CAGGGTGAAGTGGGGAAGTCTGG + Intronic
940430529 2:153584532-153584554 CAGGGTGGTATGGGGAATGGTGG - Intergenic
940990219 2:160088615-160088637 TAGGGTGGGGTGGGGGATGATGG + Intergenic
941048100 2:160699064-160699086 CCTGGTGATGTGGGAGCTGCTGG + Intergenic
941740374 2:169029065-169029087 CAGTGTGATGTGGGGCATGGTGG - Intronic
941978128 2:171427706-171427728 CAGGGTGATGTGCTGGAGGGTGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946396300 2:219445335-219445357 CAGGGGGATGTGGGCGGTGATGG - Intronic
946416497 2:219542803-219542825 CAGGGTGAGATGGGGGAGGGAGG - Intronic
947330548 2:229025193-229025215 CAGGGTGCTGATGGGGACGCTGG - Exonic
948375011 2:237515649-237515671 CTGGTAGTTGTGGGGGATGCAGG - Intronic
948458320 2:238117469-238117491 GTGGGTGATGTGGGTGATGTGGG + Intronic
948613905 2:239185889-239185911 CAGGGTGTGGTGGTGCATGCTGG + Intronic
948713976 2:239847101-239847123 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
949043337 2:241859247-241859269 CAGGGAGATGGGGGGGATGGGGG - Intergenic
1168814798 20:728933-728955 CAGGGAGATGAGGGCGTTGCAGG + Intergenic
1168875377 20:1168428-1168450 AGGTGTGATGTGGGGGCTGCTGG - Intronic
1169745685 20:8940270-8940292 GAGGGTGATGGTGGAGATGCTGG - Intronic
1170554413 20:17504166-17504188 CATGGTCATGTGGGGGATGGGGG - Intronic
1171209298 20:23304652-23304674 CAGGATGCTGTTGGGGAGGCGGG - Intergenic
1171489322 20:25505312-25505334 CTGGGTGGTGGGGGAGATGCTGG + Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1174058705 20:47817242-47817264 CAGGTTGGTGTGGGGCTTGCAGG + Intergenic
1174446568 20:50594908-50594930 CAGGTTGTTGTGGGGACTGCAGG - Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1175229451 20:57464429-57464451 CAGGCTGAAGCGGGGGAGGCTGG + Intergenic
1175592754 20:60206598-60206620 GAGGGTGATTAGGGGGAAGCTGG + Intergenic
1176114063 20:63423421-63423443 CAGGGTGATGTGTCGGGGGCTGG + Intronic
1177013454 21:15755862-15755884 AAGGGAGAAGTGGAGGATGCAGG + Intronic
1177083169 21:16667766-16667788 CAGGATGTTGTAGGTGATGCAGG - Intergenic
1179959146 21:44758557-44758579 CAGCCTGATATGGGGGCTGCAGG + Intergenic
1179970799 21:44836051-44836073 CGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1179970871 21:44836199-44836221 CGGGGTGGGGTGGGGGCTGCAGG - Intergenic
1180748311 22:18107474-18107496 CAGGGTGAGATGGGGGATCCAGG + Intronic
1180981376 22:19879610-19879632 CAGGGTGGTGGGGGGGGTGGGGG + Intronic
1181081902 22:20421253-20421275 GAGTGTGATGTGGGGGGTGCAGG + Intergenic
1181177936 22:21048257-21048279 CTAGGTGAAGAGGGGGATGCTGG - Intronic
1181277368 22:21695268-21695290 CAGGGGGATGTGGGAGCAGCAGG + Intronic
1181310913 22:21944262-21944284 TAGGCAGCTGTGGGGGATGCTGG + Intronic
1181319800 22:21995487-21995509 CAGGCCAATGTGGGAGATGCAGG + Intergenic
1181520756 22:23448279-23448301 CAATGTGATGCTGGGGATGCGGG - Intergenic
1183056691 22:35311090-35311112 GAGGGTGATGGGGTGGCTGCGGG + Intronic
1183087050 22:35492775-35492797 AAGGGCGATGTGGGTGGTGCAGG + Intergenic
1183219909 22:36505970-36505992 CAGAGTGACGTGGGCGATGGTGG + Exonic
1183701558 22:39454053-39454075 CATGGTGATATGGGGGAGGGTGG - Intergenic
1183701570 22:39454088-39454110 CACGATGACGTGGGGGAGGCTGG - Intergenic
1183977749 22:41523128-41523150 AGGGGTGATGTGGTGGCTGCAGG - Intronic
1184098410 22:42329012-42329034 CAGAGTGAGGTGGAGGGTGCTGG - Intronic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
1185379932 22:50503658-50503680 CAGGGTGCTGTTGGCGCTGCGGG + Exonic
950138438 3:10599432-10599454 CAAGGTGATGTGGGGGCTGGAGG - Intronic
950427987 3:12934981-12935003 CTGTGTCTTGTGGGGGATGCAGG - Intronic
950620673 3:14202869-14202891 CATGGTGTTGTGGGGGGTGAGGG + Intergenic
950626987 3:14254489-14254511 CAGGGTGTTGTGGGGAACACAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950753774 3:15155268-15155290 CTGGGTGGTGAGGGGTATGCTGG - Intergenic
952985055 3:38771533-38771555 CAAGGTGATGAGGGGGAAGAAGG + Intronic
953663570 3:44908847-44908869 CATGGTGGTGTGGGGGTGGCAGG - Intronic
953888597 3:46734180-46734202 CAGGGTGGTGAAGGGGAAGCTGG - Exonic
954133037 3:48569741-48569763 TAGGGTGATGTTGGGAGTGCAGG - Exonic
954135838 3:48581740-48581762 CAGGGAGATGTGGGGCCCGCTGG - Exonic
954327849 3:49873267-49873289 CAGGGTGGTGTGGGAAAAGCAGG - Intergenic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
954752620 3:52822198-52822220 CCGGGTGTGGTGGTGGATGCTGG + Intronic
954787996 3:53109069-53109091 CAGGGTGATGAGGGTGAGGTTGG - Intronic
955317350 3:57949829-57949851 CAGGGTGGTGTGGGGCCTGAAGG - Intergenic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
957444280 3:80294883-80294905 GAGGCTGAGGTGGGGGAGGCGGG - Intergenic
959631430 3:108511373-108511395 CATGGTGATGTGAGTGAAGCTGG + Intronic
961013233 3:123449239-123449261 CCGCGAGAGGTGGGGGATGCGGG - Exonic
962265652 3:133942622-133942644 GAGGGGGTTGTGGGAGATGCAGG + Exonic
964503859 3:157377200-157377222 GAGGTTGAGGTGGGGGATGATGG + Intronic
967237894 3:187405513-187405535 GAGTGTTATTTGGGGGATGCAGG - Intergenic
968498355 4:931683-931705 TACGGTGAGGTGGGGGATGGTGG - Intronic
968549272 4:1213992-1214014 CAAGGTGCTGTAGGGGCTGCAGG + Intronic
968973610 4:3809881-3809903 CAGGGCGATGTTGGGGCTGGAGG + Intergenic
968978192 4:3832843-3832865 CAGGGTGAGGTGGGAGTTGCAGG - Intergenic
969115380 4:4867622-4867644 GAGGGCGCTGTGGGGGAGGCAGG - Intergenic
969289541 4:6229899-6229921 CAAGGCGCTGTGTGGGATGCAGG + Intergenic
969511657 4:7621199-7621221 CAGGGTGGTGTGTGGGAAGTAGG + Intronic
969601953 4:8181979-8182001 CAGGGTGGGGTGGGGCAGGCAGG + Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970892713 4:21066509-21066531 GAGGGGGATGCGGGGGATGGGGG - Intronic
970892719 4:21066518-21066540 CCAGGGGATGAGGGGGATGCGGG - Intronic
971576389 4:28280466-28280488 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
972599056 4:40555695-40555717 CAGGATGATGTGGCGGCCGCAGG - Intronic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
980479461 4:133368883-133368905 CAGGGAGAAGTGGGGGAAGAGGG + Intergenic
980639006 4:135548899-135548921 GAGGGCGATGTGGTGAATGCTGG - Intergenic
981629109 4:146797638-146797660 CAGGGTGAGGTGGGAGAGGAAGG - Intronic
981803728 4:148688403-148688425 CAAGGTGATATGGGGATTGCTGG - Intergenic
984581415 4:181514627-181514649 TAGGGTGAGATGGGGGATTCTGG + Intergenic
985641814 5:1066981-1067003 CAGGCTGACGTAGGGGCTGCTGG - Intronic
985778589 5:1857986-1858008 AAGGACGATGTGGGGGTTGCAGG + Intergenic
985778634 5:1858190-1858212 AAGGACGATGTGGGGGTTGCAGG + Intergenic
985778657 5:1858292-1858314 AAGGACGATGTGGGGGTTGCAGG + Intergenic
985778670 5:1858343-1858365 AAGGACGATGTGGGGGTTGCAGG + Intergenic
986006419 5:3672487-3672509 ATGGGTGATGTGGGTGAAGCAGG - Intergenic
987244686 5:16037067-16037089 CAGGAGGCTGTGGGGGATTCAGG - Intergenic
987455700 5:18143319-18143341 CAGTGTGATTTGGGGGAGGGGGG + Intergenic
987647965 5:20700442-20700464 CAAGGTGAGGTGGAGGAAGCAGG - Intergenic
988113716 5:26855694-26855716 CAGAGTGGTGGGTGGGATGCGGG + Intergenic
988286119 5:29218605-29218627 GAGGTTGATTTGGGGGAGGCAGG + Intergenic
988748371 5:34168418-34168440 CAAGGTGAGGTGGAGGAAGCAGG + Intergenic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
989727462 5:44603897-44603919 GTGGCTGCTGTGGGGGATGCAGG - Intergenic
990314088 5:54567796-54567818 CAGGGTGCTCTGGGCAATGCTGG - Intergenic
992308109 5:75464434-75464456 CAGGGTGCTATGGGGGATGCGGG + Intronic
995203347 5:109450757-109450779 CGGGGTTTTGTGGGGGACGCTGG + Intergenic
996742520 5:126814036-126814058 CAGGGTGTGGTGGTGCATGCCGG - Intronic
997667286 5:135641821-135641843 CATGGTGATGAAGGGGATGATGG - Intergenic
998076572 5:139241521-139241543 AAGGGTGCTGTGGGGTGTGCAGG - Intronic
998279035 5:140787390-140787412 CACGGTGATGAGGGCGATGACGG - Exonic
998747127 5:145273466-145273488 GATGGTGATGATGGGGATGCAGG + Intergenic
998821345 5:146060389-146060411 GTGGGTGATGTTGGGGATGTTGG - Intronic
999062559 5:148652342-148652364 CTGGGTGATGTAGAGGATGGTGG + Intronic
1002021846 5:176368657-176368679 CAGGGTGGGGTGGGGGCTGTGGG + Intronic
1002087397 5:176784763-176784785 CAGGGAGGAGTGGGGGATGTGGG + Intergenic
1002170057 5:177369923-177369945 CAGCCTGATGTGGGGGTTGGGGG - Intronic
1002686777 5:181018166-181018188 AAGGATGATGTGGGGCATGATGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003833680 6:10043514-10043536 CAGAGTGATGTGGAAGATCCTGG - Intronic
1004625009 6:17366513-17366535 CTGGGGGATGTGGGGGTTTCAGG - Intergenic
1005450907 6:25971324-25971346 CAGAGTCATGTGTGGGAGGCAGG - Intronic
1005545940 6:26871522-26871544 CAAGGTGAGGTGGAGGAAGCAGG + Intergenic
1005692625 6:28322100-28322122 CAGGGTGAGTGGGGTGATGCAGG - Intergenic
1005849662 6:29812029-29812051 CGGGGAGATGTGGGGGAGGAGGG + Intergenic
1005861512 6:29906039-29906061 CGGGGCGATGTGGGGGAGGAGGG + Intergenic
1005969377 6:30749297-30749319 CATGGTGATCTGGGGGAAGATGG - Intergenic
1006031383 6:31179173-31179195 CAGGGTGTGGTGGGAGATGAGGG - Intronic
1006296235 6:33171305-33171327 CAGGGTGAGGTGGGGGACCCCGG - Exonic
1006912672 6:37573886-37573908 CAGGGAGTGGTGGGGGATGGGGG - Intergenic
1006935053 6:37711521-37711543 AATGGTGATGAGGGGGAGGCTGG - Intergenic
1007595082 6:43046262-43046284 CAGGGTGATGTAGTGGGAGCCGG + Exonic
1007619097 6:43200786-43200808 CAGGGTGATGTAGTGGGAGCCGG - Exonic
1009016653 6:57912307-57912329 CAAGGTGAGGTGGAGGAAGCAGG + Intergenic
1010926489 6:81752073-81752095 TAGGGGGATGTAGGGGCTGCAGG + Exonic
1011035902 6:82974351-82974373 CAGGTTGTTGTGGGGGGTCCTGG - Intronic
1011565995 6:88672549-88672571 CAGGGGGAAGTGTGGGATGAGGG + Intronic
1012530980 6:100236170-100236192 CAGCATGGTGTGGGGGATGCCGG - Intergenic
1014215287 6:118746899-118746921 CAGGGAGATGTGGAGGAAGCTGG - Intergenic
1015854255 6:137606537-137606559 GAGGCTGATGAGGGAGATGCTGG - Intergenic
1016641889 6:146359064-146359086 TGGGGTCATGTGGGGGATTCAGG + Intronic
1018051927 6:160016650-160016672 CAGGGTGTGGTGAGGGATGATGG - Intronic
1018426833 6:163690813-163690835 CAGGGAGAGGTGGGGAAGGCAGG + Intergenic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1019388296 7:770844-770866 CAGAGTGCTGTGGGGGAGGGAGG - Intronic
1019485502 7:1287515-1287537 CAGGGAGGTGTGGGGAGTGCAGG + Intergenic
1019590483 7:1827968-1827990 CAATGTGATGCTGGGGATGCGGG + Intronic
1019665988 7:2252617-2252639 CAGGGTGAAGGGGGGGCTGGAGG - Exonic
1019711015 7:2518374-2518396 CTGGGTGGTGTGGGGGATGGGGG - Intronic
1019928696 7:4209433-4209455 CGGGGTGATGTGGAGCCTGCTGG - Intronic
1019935143 7:4249982-4250004 CAGGGTGTTTTGGGGGCTGATGG - Intronic
1020577305 7:9949543-9949565 CAGGGTAATTTGGGGTATACGGG - Intergenic
1020634897 7:10685011-10685033 GAGGCTGCTGTGGGGGATGGGGG - Intergenic
1021178897 7:17483341-17483363 CAGGGTGGTGAGGAGGAAGCTGG - Intergenic
1022090652 7:27105996-27106018 GGGGGTGATGATGGGGATGCAGG + Intergenic
1022472245 7:30689073-30689095 CAGGGTGGTGGGTGGGGTGCTGG - Intronic
1023039696 7:36161309-36161331 CAGGATGATGTGTGGGATGAGGG + Intronic
1023863018 7:44226854-44226876 GAAGGGGATGTGGGGGATGGAGG + Intronic
1023942085 7:44775700-44775722 CAGGGTGAAGTGGGACATGGAGG + Intergenic
1025964789 7:66258584-66258606 CAGAGAGATGTGGGGAATCCAGG - Intronic
1026774116 7:73220656-73220678 CAGGGCGATGTGACGGATGAAGG - Intergenic
1027014973 7:74774042-74774064 CAGGGCGATGTGACGGATGAAGG - Exonic
1027073058 7:75171911-75171933 CAGGGCGATGTGACGGATGAAGG + Intergenic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1031975242 7:128089574-128089596 CAGGGTGACATGGGGGCAGCCGG - Exonic
1032087778 7:128892814-128892836 CAGGGTGAGCTGGGTAATGCAGG + Intronic
1032546894 7:132751349-132751371 CAGGGGGATGTGTGGGAAGGGGG - Intergenic
1033542783 7:142372569-142372591 CATGGTGAAGTGGGGGACACAGG - Intergenic
1034152352 7:148926843-148926865 CAGGGTGAAGTGGGTGATCAGGG - Intergenic
1035015690 7:155763925-155763947 CTGGCAGATGTGGGGGCTGCTGG - Exonic
1035023669 7:155813243-155813265 CAGGGTGTTGGGGGGGGGGCAGG + Intergenic
1035112018 7:156491146-156491168 GAGGGGGAGTTGGGGGATGCGGG + Intergenic
1035579191 8:729309-729331 CAGGGTCATGGGGTGGTTGCAGG - Intronic
1035723784 8:1812528-1812550 CAGGGAGCTGTGAGGGATCCTGG + Intergenic
1035746684 8:1966215-1966237 CAGGATGGTGTGGGGGCTTCAGG + Intergenic
1036655304 8:10673864-10673886 GAGTGTGATATGGGGGTTGCAGG - Intronic
1037245628 8:16831346-16831368 TAAGGTGAGTTGGGGGATGCTGG - Intergenic
1038008512 8:23455438-23455460 GAGGCTGATGTGGAGGCTGCCGG + Intronic
1038792792 8:30683435-30683457 CGGGCTGAGGTGTGGGATGCCGG + Intronic
1039365072 8:36920575-36920597 CATGTTGATGTGGGAGTTGCAGG + Intronic
1039547281 8:38419324-38419346 CAGTGTGATATGGAGGGTGCAGG + Intronic
1040545772 8:48396938-48396960 CAGAGGGATGTGGGGGCCGCCGG - Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1042561225 8:70072921-70072943 CTGGGTGATCTGTGGGTTGCAGG + Intergenic
1043133162 8:76487547-76487569 CAGGGTGATGCTGAGGCTGCTGG + Intergenic
1043563455 8:81522150-81522172 CAGGTTGATGTGGCGGTTGATGG + Intergenic
1045013615 8:97980134-97980156 AAGGGTGAGGTGGGGGTTCCAGG + Intronic
1046912790 8:119647137-119647159 CTGGGTGTTGTGGTGGGTGCCGG - Intronic
1047021212 8:120776698-120776720 CAGGCTTATGAGGGGGAAGCAGG - Intronic
1047358975 8:124150299-124150321 AAGGGTGAGGTGGGAGAAGCTGG - Intergenic
1047914441 8:129566484-129566506 CAGGGTGATGAGGGTGAGCCAGG + Intergenic
1048507438 8:135034034-135034056 AAGGGACATGTGGAGGATGCAGG + Intergenic
1048865225 8:138755810-138755832 CAGGGTGACGTGGGACCTGCGGG - Exonic
1048982769 8:139711943-139711965 CTGGGTGCTGTGCTGGATGCCGG - Intergenic
1048983584 8:139716611-139716633 CTGGGAGATGTGGGTGATTCAGG - Intergenic
1049005065 8:139849847-139849869 CAGGGCGAAGTGAGGTATGCTGG - Intronic
1049230330 8:141478458-141478480 CAGGGTGGGGTGGGGCATGGGGG + Intergenic
1049303179 8:141882613-141882635 CAGGGAGATGGAGGGCATGCAGG - Intergenic
1049790526 8:144470290-144470312 CAGAGGGATGTGTGGGATGAAGG - Intronic
1049809019 8:144554980-144555002 CAGTTTGCTGTGGGAGATGCAGG - Intronic
1050502682 9:6315272-6315294 GAGGCTGCTGTGGGGGATGAGGG - Intergenic
1052081376 9:24210011-24210033 CAGGGGGAAGTGTGGGAGGCAGG + Intergenic
1052522127 9:29562128-29562150 CAGGGAGATGTGGGGGAGCTTGG + Intergenic
1053506008 9:38643735-38643757 CAGGGAGATGCAGGAGATGCTGG + Intergenic
1056305895 9:85289962-85289984 CAGCAGGATGTGGGGGATGTGGG + Intergenic
1056808995 9:89749974-89749996 CAGGATCATGGGGAGGATGCAGG - Intergenic
1056844420 9:90025031-90025053 CAGCGTGGTGTGGGGGAAGTGGG + Intergenic
1057082747 9:92185127-92185149 AAGGGTGCTGTGGGAGATGGGGG + Intergenic
1057388729 9:94625868-94625890 CTGCGTGATTTGGTGGATGCGGG - Intronic
1058939201 9:109797672-109797694 CAGGGGCATGTGTGGGAAGCAGG + Intronic
1059575791 9:115486901-115486923 CAGGACCATGTGGGGCATGCTGG + Intergenic
1060052658 9:120388219-120388241 CACAGTGGTGTGGGGGCTGCGGG + Intergenic
1060301464 9:122376820-122376842 CAGGGTGGTGGGGGTGATGGTGG + Intronic
1060668510 9:125447950-125447972 CAGGGTCATGTGTGGCAGGCAGG + Intronic
1060850343 9:126869576-126869598 CAGGCTGGTGTGGGGGCGGCTGG + Intronic
1061192162 9:129088183-129088205 GAGGGTGTTGTGGGGGTTGGGGG + Intronic
1061383539 9:130275104-130275126 CAGAGTGATGTCCCGGATGCTGG - Intergenic
1061518654 9:131104341-131104363 CAGGGAGATGTGGGGGTAGGTGG - Intronic
1061809164 9:133152422-133152444 CTGGGTGAAGTGGAGCATGCTGG - Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062527023 9:136982052-136982074 CAGGGTGGCGTTGGGGGTGCAGG - Intronic
1185491193 X:518239-518261 CAGGCTGAGGTGGAGGATGGAGG - Intergenic
1187417083 X:19102745-19102767 CAGAGAGAGGTGGGGGAAGCGGG - Intronic
1187923250 X:24226650-24226672 AAGGGAGATTTGGGGGATGATGG - Intergenic
1188001191 X:24983923-24983945 CAGGGAGTTTTGGGGGAGGCAGG - Intronic
1188411767 X:29881491-29881513 AAGGGTCATGAGGGGGGTGCGGG - Intronic
1189010706 X:37043494-37043516 CAGGCTGATGTGGGTGTTGATGG + Intergenic
1189035697 X:37492061-37492083 CAGGCTGATGTGGGTGTTGATGG - Intronic
1192219003 X:69184396-69184418 CAGGGAGAGGTGGGTGAGGCAGG - Intergenic
1192527501 X:71860423-71860445 CAGGAGGCTCTGGGGGATGCTGG - Intergenic
1193023783 X:76821854-76821876 CTTGGGGATGGGGGGGATGCAGG + Intergenic
1194379735 X:93177674-93177696 CCAGGTGATGTGGGGGATTGAGG + Intergenic
1195325449 X:103754669-103754691 TTGGGAGAGGTGGGGGATGCAGG + Intergenic
1196978880 X:121189819-121189841 CAGGGAGATGTTTGGGAAGCAGG - Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198493515 X:137167168-137167190 CAGGGTGATGAAGGGGATTTTGG + Intergenic
1199613860 X:149639861-149639883 GAGGCTGCTGTGGAGGATGCTGG + Intergenic
1199627874 X:149757619-149757641 GAGGCTGCTGTGGAGGATGCTGG + Intergenic
1199787119 X:151115494-151115516 CCGGGAGATGTGGGGGATAGTGG + Intergenic
1200055586 X:153458316-153458338 CAAGGTGATCTGGGGGCAGCGGG + Intronic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic