ID: 1079403057

View in Genome Browser
Species Human (GRCh38)
Location 11:20121781-20121803
Sequence TCTAACAAGCTCCACAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079403057_1079403062 30 Left 1079403057 11:20121781-20121803 CCACTCCTGTGGAGCTTGTTAGA No data
Right 1079403062 11:20121834-20121856 ATGAATCACCAGGGATCTAGTGG No data
1079403057_1079403060 20 Left 1079403057 11:20121781-20121803 CCACTCCTGTGGAGCTTGTTAGA No data
Right 1079403060 11:20121824-20121846 CTCAGACTTTATGAATCACCAGG No data
1079403057_1079403061 21 Left 1079403057 11:20121781-20121803 CCACTCCTGTGGAGCTTGTTAGA No data
Right 1079403061 11:20121825-20121847 TCAGACTTTATGAATCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079403057 Original CRISPR TCTAACAAGCTCCACAGGAG TGG (reversed) Intergenic
No off target data available for this crispr