ID: 1079403061

View in Genome Browser
Species Human (GRCh38)
Location 11:20121825-20121847
Sequence TCAGACTTTATGAATCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079403057_1079403061 21 Left 1079403057 11:20121781-20121803 CCACTCCTGTGGAGCTTGTTAGA No data
Right 1079403061 11:20121825-20121847 TCAGACTTTATGAATCACCAGGG No data
1079403058_1079403061 16 Left 1079403058 11:20121786-20121808 CCTGTGGAGCTTGTTAGAACTGT No data
Right 1079403061 11:20121825-20121847 TCAGACTTTATGAATCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079403061 Original CRISPR TCAGACTTTATGAATCACCA GGG Intergenic
No off target data available for this crispr