ID: 1079403062

View in Genome Browser
Species Human (GRCh38)
Location 11:20121834-20121856
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079403059_1079403062 -10 Left 1079403059 11:20121821-20121843 CCTCTCAGACTTTATGAATCACC No data
Right 1079403062 11:20121834-20121856 ATGAATCACCAGGGATCTAGTGG No data
1079403058_1079403062 25 Left 1079403058 11:20121786-20121808 CCTGTGGAGCTTGTTAGAACTGT No data
Right 1079403062 11:20121834-20121856 ATGAATCACCAGGGATCTAGTGG No data
1079403057_1079403062 30 Left 1079403057 11:20121781-20121803 CCACTCCTGTGGAGCTTGTTAGA No data
Right 1079403062 11:20121834-20121856 ATGAATCACCAGGGATCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079403062 Original CRISPR ATGAATCACCAGGGATCTAG TGG Intergenic
No off target data available for this crispr