ID: 1079409223

View in Genome Browser
Species Human (GRCh38)
Location 11:20171445-20171467
Sequence CCACACTCACTCACAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079409216_1079409223 12 Left 1079409216 11:20171410-20171432 CCATATGAAGAAAGGCCTGGGCT No data
Right 1079409223 11:20171445-20171467 CCACACTCACTCACAAGGATGGG No data
1079409219_1079409223 -3 Left 1079409219 11:20171425-20171447 CCTGGGCTTTGGCAGGACTTCCA No data
Right 1079409223 11:20171445-20171467 CCACACTCACTCACAAGGATGGG No data
1079409212_1079409223 30 Left 1079409212 11:20171392-20171414 CCAGGTGTGCATGTTTAGCCATA No data
Right 1079409223 11:20171445-20171467 CCACACTCACTCACAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079409223 Original CRISPR CCACACTCACTCACAAGGAT GGG Intergenic
No off target data available for this crispr