ID: 1079416063

View in Genome Browser
Species Human (GRCh38)
Location 11:20237808-20237830
Sequence GGCAGAACAACCTCTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079416054_1079416063 26 Left 1079416054 11:20237759-20237781 CCCTCAAACCACAAGACAAAGCC No data
Right 1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG No data
1079416056_1079416063 18 Left 1079416056 11:20237767-20237789 CCACAAGACAAAGCCCTTCTGTC No data
Right 1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG No data
1079416055_1079416063 25 Left 1079416055 11:20237760-20237782 CCTCAAACCACAAGACAAAGCCC No data
Right 1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG No data
1079416058_1079416063 4 Left 1079416058 11:20237781-20237803 CCTTCTGTCTTCTCTCCCCTTTT No data
Right 1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG No data
1079416057_1079416063 5 Left 1079416057 11:20237780-20237802 CCCTTCTGTCTTCTCTCCCCTTT No data
Right 1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079416063 Original CRISPR GGCAGAACAACCTCTCCCAG TGG Intergenic
No off target data available for this crispr