ID: 1079416892

View in Genome Browser
Species Human (GRCh38)
Location 11:20246008-20246030
Sequence CCTTGAAGAAGGGCAGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079416892_1079416897 5 Left 1079416892 11:20246008-20246030 CCAAGTCCTGCCCTTCTTCAAGG No data
Right 1079416897 11:20246036-20246058 TTTAAATGCCATCCCCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079416892 Original CRISPR CCTTGAAGAAGGGCAGGACT TGG (reversed) Intergenic
No off target data available for this crispr