ID: 1079423085

View in Genome Browser
Species Human (GRCh38)
Location 11:20312883-20312905
Sequence CCTCATAAGCAACTAGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079423081_1079423085 23 Left 1079423081 11:20312837-20312859 CCTTTCTATAAAATATCTTGAGG No data
Right 1079423085 11:20312883-20312905 CCTCATAAGCAACTAGTACAAGG No data
1079423083_1079423085 -8 Left 1079423083 11:20312868-20312890 CCAGACTTAATTTATCCTCATAA No data
Right 1079423085 11:20312883-20312905 CCTCATAAGCAACTAGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079423085 Original CRISPR CCTCATAAGCAACTAGTACA AGG Intergenic
No off target data available for this crispr