ID: 1079428830

View in Genome Browser
Species Human (GRCh38)
Location 11:20369094-20369116
Sequence GTGTACAATATAAAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079428830 Original CRISPR GTGTACAATATAAAGTTGGG AGG Intronic
901355187 1:8640266-8640288 GTTTAAAAAAAAAAGTTGGGAGG - Intronic
902936125 1:19766138-19766160 GGGTGCAATAGAAAGATGGGTGG - Intronic
910230640 1:84983228-84983250 GTGTACATTATTAAATTTGGGGG - Intronic
910578224 1:88791621-88791643 GTGTAAAATTTAAAGCAGGGAGG + Intronic
916954055 1:169813157-169813179 GTGTGTATTATAAACTTGGGTGG + Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
918478195 1:184948733-184948755 GTTTACAATATAATGTGGAGTGG + Intronic
919030105 1:192231269-192231291 GTATAAAATATTAAATTGGGAGG + Intergenic
919718351 1:200804324-200804346 GTGTACAATATAAAATTGAGTGG - Intronic
920872157 1:209803849-209803871 GTTTACAATATGAAGTTGTGGGG + Intronic
921229322 1:213052094-213052116 GGGCACATTTTAAAGTTGGGAGG + Intronic
923865619 1:237936061-237936083 GTCTACATTATAAAGTGGGCTGG + Intergenic
1063495449 10:6503371-6503393 GTGTGAAATAGAAAGTTGGCAGG + Intronic
1068039969 10:51811491-51811513 GAGTAGAATATAAAGTTGTGAGG + Intronic
1068518170 10:58049239-58049261 GTGAGCAAAATAAATTTGGGTGG + Intergenic
1068618194 10:59145307-59145329 TTGTACAAGATAGAGTTGAGTGG + Intergenic
1069405574 10:68094759-68094781 GTGTAAAATATAAAGCATGGGGG + Intergenic
1076020836 10:127071373-127071395 GTGCACAGTATAAATGTGGGTGG - Intronic
1076334602 10:129697121-129697143 GTGTATAATAGAAAGTAGGTTGG + Intronic
1079428830 11:20369094-20369116 GTGTACAATATAAAGTTGGGAGG + Intronic
1082185527 11:49175946-49175968 GTGTCCAATAGAAAAATGGGTGG - Exonic
1084415755 11:69032156-69032178 GCGTACATTATCAAGGTGGGAGG - Intergenic
1086147752 11:83572111-83572133 GTTTACTATATAAAATTAGGAGG - Intronic
1087783389 11:102326294-102326316 GGTTACAATATTAAATTGGGTGG + Intronic
1096645467 12:53032108-53032130 GTGTATAATATAAATTTGGCAGG - Intronic
1099472278 12:83066086-83066108 ATGTACAATCTAATGTGGGGAGG + Intronic
1106841718 13:33691372-33691394 CTGGACAATAAAAAGTTGAGGGG - Intergenic
1108889875 13:55244295-55244317 GTGAACAGAATAAATTTGGGAGG + Intergenic
1110882924 13:80595244-80595266 GTGTATAAAATGAAGTTTGGAGG + Intergenic
1111030109 13:82585905-82585927 GTGTGCACTTTAAACTTGGGAGG + Intergenic
1111863745 13:93741886-93741908 GTGAAAACTATAAAATTGGGAGG - Intronic
1115199899 14:30841652-30841674 GTGTACATTAAGAAGCTGGGTGG - Intergenic
1116750348 14:48875330-48875352 GTGTAAAATAGAATATTGGGAGG + Intergenic
1120314831 14:82878201-82878223 GTGTAGAATATGGAGTTGGGTGG + Intergenic
1120540624 14:85746026-85746048 GTGTATAATATAATGTTAAGTGG - Intergenic
1121440106 14:93943338-93943360 GTGTTCAATGTAAATTTGGATGG + Intronic
1124555592 15:30722365-30722387 GGGTATTATAGAAAGTTGGGTGG + Intronic
1126526376 15:49659578-49659600 GTGTATAATACTAATTTGGGGGG + Intergenic
1128826078 15:70718638-70718660 GTCTATAATATAAAGTTAGTGGG + Intronic
1131574135 15:93569377-93569399 ATGTACAATATTAGGTTGGCAGG - Intergenic
1134094278 16:11408958-11408980 TTGTATAATAAAATGTTGGGGGG + Intronic
1143286497 17:5793775-5793797 GGGTACAATCTAAAGGTGAGAGG - Intronic
1147173307 17:38634629-38634651 GTGTACACTATTCAGTTGAGGGG - Intergenic
1148628749 17:49090607-49090629 GAGCAAAAGATAAAGTTGGGAGG + Intergenic
1150526569 17:65929496-65929518 ATGTACAATTTAAAATTGAGTGG - Intronic
1153855575 18:9142488-9142510 GTGTACAATATGAATTTGGTGGG - Intronic
1159566829 18:70060707-70060729 GGGTACAAAATACAGTTAGGAGG - Intronic
1160292566 18:77607737-77607759 TTGTACAATTTAAATGTGGGAGG - Intergenic
1162286176 19:9740785-9740807 ATGTAAAATAAAAAATTGGGGGG - Intergenic
1163876550 19:19874573-19874595 GTGTATAGTATAAAGTTGACAGG + Intronic
925628009 2:5861590-5861612 GTGTAGAAGAAAAATTTGGGGGG - Intergenic
925773697 2:7310385-7310407 TTGTGCAAGATAATGTTGGGTGG - Intergenic
929979678 2:46666619-46666641 ATGTTCAACACAAAGTTGGGGGG - Intergenic
931942514 2:67267962-67267984 GTTTAAAAAATAAAGTTGGGCGG + Intergenic
932517163 2:72363721-72363743 CTGAACAATATAAAGATGAGAGG - Intronic
935605086 2:104963944-104963966 ATCAACAACATAAAGTTGGGAGG - Intergenic
938201525 2:129376675-129376697 GGGCAGAATAAAAAGTTGGGGGG - Intergenic
940893869 2:159061939-159061961 GTCTATAATATAAAGTAGGCCGG + Intronic
943079263 2:183238024-183238046 GTGTACAACATAATGTTTTGTGG + Intergenic
946628110 2:221636802-221636824 GGGTAAAATATAATATTGGGAGG + Intergenic
947652689 2:231800441-231800463 CTGTACAAAATGAGGTTGGGAGG + Intronic
1170535121 20:17333542-17333564 GTGAAGATTATCAAGTTGGGAGG - Intronic
1173319992 20:41978837-41978859 GTGTACAGTCTCAAGTTGGGAGG + Intergenic
1174942706 20:54948224-54948246 GGGTGCAATATAAAGGTGTGTGG - Intergenic
1177513221 21:22117097-22117119 GTGTTCAACATAAATTTGGCTGG + Intergenic
1182111958 22:27730254-27730276 TTGTATAATATAAAGATGAGTGG + Intergenic
950269940 3:11605671-11605693 GAGCACAAAATAAAGTAGGGAGG - Intronic
950585233 3:13887557-13887579 ATACACAATGTAAAGTTGGGGGG - Intergenic
954056582 3:48031035-48031057 GAGTACAATATGAAAATGGGAGG + Intronic
954350715 3:50041196-50041218 GTGTCCAATGTAAGGTTGAGGGG - Intronic
955725395 3:61927208-61927230 GTGGAGAATATATAGCTGGGAGG - Intronic
957753815 3:84460367-84460389 GAGTACAGTATAAAATTGTGGGG - Intergenic
957756124 3:84490659-84490681 TTGGAAAATATACAGTTGGGGGG - Intergenic
958039131 3:88205544-88205566 GTGTTCAATATATAATTGGAAGG + Intergenic
963309141 3:143689088-143689110 GTAGACAATAAAAACTTGGGGGG - Intronic
964548349 3:157859610-157859632 GTGTTCCATATAAATTTGGCCGG - Intergenic
964644779 3:158947391-158947413 GTGCAGAATAGAAAGTGGGGTGG + Intergenic
964988184 3:162771381-162771403 GTGTACAATTTAAAGTGGCCTGG - Intergenic
965500977 3:169456288-169456310 TTGTACAATATAGAGATGGGGGG + Intronic
967315893 3:188152231-188152253 GTGTACATTAGATAGTTGAGAGG + Intergenic
967340600 3:188392974-188392996 GGGTACAATGTAAAGGTGGAAGG - Intronic
967519193 3:190408401-190408423 GTATCCAATATAAATTTGGTTGG + Exonic
967692796 3:192496266-192496288 TTGTACAATATAATCTCGGGGGG + Intronic
974211750 4:58786338-58786360 GTGTACATTATAAATTTGATTGG - Intergenic
975695275 4:77006748-77006770 GTGTATAATATACAGTTTTGAGG - Intronic
978403134 4:108351491-108351513 GTGCAGAATCCAAAGTTGGGAGG - Intergenic
978854183 4:113374326-113374348 GTGTATAATATAAAATTTTGAGG - Intronic
980495249 4:133581455-133581477 GTGTACAATATATAGTTATCTGG + Intergenic
981955737 4:150470923-150470945 GTGTGTAAGATAAATTTGGGTGG - Intronic
982573391 4:157076941-157076963 GTGTAAAAGATAAATATGGGGGG + Intronic
982793642 4:159620782-159620804 TTGTATAATAAAAGGTTGGGTGG - Intergenic
988270535 5:29009449-29009471 GTGTGTAATGTAAAATTGGGGGG + Intergenic
993479489 5:88406574-88406596 GTGTAAAAGATATAGTTAGGGGG - Intergenic
994994680 5:107044962-107044984 GTTTACAACATAAAATTAGGTGG - Intergenic
996084281 5:119288217-119288239 GTGTACAAAATAATGTTAAGAGG - Intronic
998360184 5:141578974-141578996 ATGTAAAATATATAGTTGGGAGG + Intronic
1000840906 5:166216956-166216978 TTGTATAATACAAAGTGGGGAGG + Intergenic
1004049364 6:12060058-12060080 GTGAACAATATAAACGTGGTGGG - Intronic
1004109949 6:12707955-12707977 AAGTACAATGTCAAGTTGGGGGG + Intergenic
1005276300 6:24222154-24222176 GTGTACAAATTAAACTTTGGAGG + Intronic
1006176545 6:32125776-32125798 GTTTATAATAAAATGTTGGGTGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006966762 6:37994860-37994882 GTGTACACCAGAAATTTGGGGGG - Intronic
1009342838 6:62578799-62578821 GGGTACAATAGAAAGGTGTGTGG + Intergenic
1009499093 6:64389217-64389239 GTGTACAATATATACTTAGGTGG + Intronic
1011359225 6:86504295-86504317 GAGTACAAAATATAGTTGGATGG - Intergenic
1011563782 6:88651749-88651771 GTTTAAAATAAAAATTTGGGGGG - Intronic
1012745661 6:103084094-103084116 GTGTATAATATGATGTTGTGAGG + Intergenic
1013683969 6:112557089-112557111 GTATAGAATATAAAGTTAGCAGG - Intergenic
1015142069 6:129946574-129946596 GTGTGCTATATAAAGTCGGCAGG + Intergenic
1016434814 6:144025033-144025055 GTGTACATTATAGAGGGGGGAGG + Intronic
1028879258 7:95860968-95860990 GTTTTCAATATAAATTTTGGAGG + Intronic
1033055514 7:138049493-138049515 GTTGAATATATAAAGTTGGGAGG - Intronic
1033783356 7:144699374-144699396 TTATACAAGATAAAGTTGAGAGG + Intronic
1037041316 8:14238728-14238750 ATGTACAATATAATGTTCTGGGG + Intronic
1037188240 8:16090770-16090792 CTATACAATATAAACTTCGGGGG - Intergenic
1046178770 8:110614579-110614601 GTGCACAATCAAAATTTGGGGGG + Intergenic
1046218304 8:111179290-111179312 GAGAGCAATATAAAGTTGGTAGG + Intergenic
1046297261 8:112236401-112236423 GAATACAATATTAAGTTGGAAGG + Intronic
1048007105 8:130428284-130428306 GTCTAAAATATAAAATTGGAAGG + Intronic
1050173090 9:2843224-2843246 GAGTACAAGATAAAGTTAGCCGG - Intronic
1050205195 9:3189014-3189036 TTCTAAAATATAAATTTGGGGGG - Intergenic
1051866323 9:21687292-21687314 TTGAACAAAATCAAGTTGGGAGG + Intergenic
1058459622 9:105170872-105170894 GTGTACAATATCTAGTTATGTGG + Intergenic
1061024619 9:128040314-128040336 GTCTAAAAAAGAAAGTTGGGGGG - Intergenic
1190467935 X:50745767-50745789 TTCTGCAACATAAAGTTGGGAGG + Intronic
1191152340 X:57233262-57233284 GTTTACAATAGAAAGAGGGGAGG - Intergenic
1191838838 X:65494484-65494506 GTATAAAATATAAAGTTGGCTGG + Intronic
1192962470 X:76145229-76145251 GTGCACAAAATAAACTCGGGCGG + Intergenic
1192963063 X:76149858-76149880 GTGCACAAAATAAACTCGGGCGG - Intergenic
1194248773 X:91546750-91546772 GTTTACAATTTAAACTTTGGTGG + Intergenic
1194835674 X:98679532-98679554 ATTTATAATATAATGTTGGGGGG + Intergenic
1195691175 X:107626867-107626889 GAGTACAATTTTAAGTAGGGTGG - Intergenic
1198673502 X:139107095-139107117 GAGTACACAATAAAGTAGGGAGG + Intronic
1199252817 X:145683763-145683785 CTGTATAATCTCAAGTTGGGGGG - Intergenic
1199299627 X:146197742-146197764 GTGTACCATATGAAGTTGCCTGG - Intergenic
1199549821 X:149046924-149046946 TTGTACATTTTTAAGTTGGGTGG + Intergenic
1199888429 X:152047841-152047863 GTGTACAATATGTAGTTGGCTGG + Intergenic
1200567783 Y:4788269-4788291 GTTTACAATTTAAACTTTGGTGG + Intergenic
1200815809 Y:7531260-7531282 GTTTACTATATAAATTTGGTGGG - Intergenic
1200916062 Y:8572254-8572276 GGATACAATATAAAGAGGGGTGG + Intergenic
1201851734 Y:18490637-18490659 GTGTAAAAAATAAAGTTAGAAGG - Intergenic
1201881586 Y:18829743-18829765 GTGTAAAAAATAAAGTTAGAAGG + Intergenic
1202024749 Y:20509596-20509618 GTGTACAATCTCAATTTGTGAGG + Intergenic