ID: 1079429358

View in Genome Browser
Species Human (GRCh38)
Location 11:20374119-20374141
Sequence ATGGGAAAGGAGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1685
Summary {0: 1, 1: 1, 2: 13, 3: 180, 4: 1490}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079429351_1079429358 18 Left 1079429351 11:20374078-20374100 CCTCCAGGTGGTGGATATAGTTA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG 0: 1
1: 1
2: 13
3: 180
4: 1490
1079429352_1079429358 15 Left 1079429352 11:20374081-20374103 CCAGGTGGTGGATATAGTTAAAA 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG 0: 1
1: 1
2: 13
3: 180
4: 1490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079429358 Original CRISPR ATGGGAAAGGAGGATGAGGA AGG Intronic
900510126 1:3054966-3054988 ACTGGAAATGAGGATGATGACGG + Intergenic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
901277557 1:8004495-8004517 AGGAGAAAGCAGGATGACGATGG - Intronic
901459748 1:9384450-9384472 ATGGGAGAGGAGGAGGAGGGTGG - Intergenic
901839947 1:11947928-11947950 ATGGGAATGGAGGATGAGGGAGG - Intronic
901897313 1:12325202-12325224 ACTGGAAAGGAGGCTGAGGCAGG - Intronic
901953771 1:12769752-12769774 AGGGGAAAGGAGGGAGAGGAAGG + Intergenic
902054295 1:13587470-13587492 ACGGGGGAGGAGGAGGAGGAGGG + Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902871012 1:19313523-19313545 AGGGGAGAGGAGGAGGTGGAAGG + Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903292123 1:22320878-22320900 ATGGGGAATGAGGGAGAGGAGGG + Intergenic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
904008998 1:27379454-27379476 AGGGGAAAGGAGGATGCAGAGGG - Exonic
904021719 1:27471711-27471733 CTGACAAAGGAGGATCAGGAAGG + Intronic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904332215 1:29767467-29767489 ATGGGGCACGAGGGTGAGGAAGG - Intergenic
904357158 1:29947779-29947801 ATGAGAAAAGGGGAAGAGGAAGG - Intergenic
904371502 1:30050336-30050358 AGGGGCAGAGAGGATGAGGAAGG + Intergenic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904534535 1:31190501-31190523 ATGGGACAGGTGGCTGAGAAAGG - Intronic
904597448 1:31655791-31655813 TGGGGAGAGGAGGCTGAGGAAGG - Intronic
904983354 1:34524848-34524870 ATGGGGAAGAAAGGTGAGGATGG - Intergenic
905164595 1:36071577-36071599 AGGGGAAGGGAAGATGAGGAGGG - Exonic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905423490 1:37864237-37864259 ATGAGAAATGAGGTTGAGGAGGG - Intronic
905740004 1:40361752-40361774 AAGGGAAAGGAAGAGGGGGAAGG + Intronic
905912925 1:41666042-41666064 ATGGGGATGGAGGATGGAGAGGG - Intronic
906069961 1:43008920-43008942 ATGGGAATGTGGGAGGAGGAGGG + Intergenic
906261080 1:44390689-44390711 ATGTGAAAGGAGGAAGTGAAGGG + Intergenic
906287901 1:44599790-44599812 ATGGGATAGGAGGCTGGAGAGGG + Intronic
907009203 1:50947195-50947217 AGGGAAAAAGAGGATGGGGAGGG + Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907359747 1:53904894-53904916 AGGTGGAAGGAGGAAGAGGAGGG + Intronic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907539333 1:55198345-55198367 ATGGAAATGGAGGATGAAGTCGG + Intronic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907782556 1:57580473-57580495 ATGTGAAAGAAGGATGAGATTGG - Intronic
908104832 1:60830737-60830759 AAGGGAAAGAAGGAAGAGCAAGG - Intergenic
908278036 1:62497520-62497542 ATGAGAGGGGAGGATGAGTAGGG - Intronic
908364651 1:63408165-63408187 TTGGGAAAGGAGGAGGGAGAAGG - Intronic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
909604958 1:77498736-77498758 TGAGAAAAGGAGGATGAGGATGG + Intronic
909685110 1:78339294-78339316 ATGGGGAGGTGGGATGAGGAAGG - Intronic
909970962 1:81989173-81989195 ATAGGAAAAGAGGTTTAGGAGGG - Intronic
910188156 1:84567928-84567950 ATGAGAAAGGAAGATGAGTAAGG - Intronic
910220177 1:84881738-84881760 ATTGGAAAGGGGGAAGAGGAGGG + Intronic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911182660 1:94875123-94875145 ATCGCAAAAGAGAATGAGGAAGG + Intronic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
912897900 1:113612443-113612465 TGGGGAGAGGAGGATGAGAAGGG + Intronic
913246172 1:116871821-116871843 ATGGGAAAGAAGGGTCAGGCAGG - Intergenic
913609969 1:120501412-120501434 ATGGAAATGGAGGCTGAGGGAGG + Intergenic
914581219 1:149020829-149020851 ATGGAAATGGAGGCTGAGGGAGG - Intronic
914677925 1:149917937-149917959 AGGAGAAAAGAGGATGGGGAGGG + Intergenic
914959595 1:152194668-152194690 AGGGGAGAGGGGGATGGGGAGGG - Intergenic
915036872 1:152935186-152935208 ATGGAAAAGGAGGAGGAAAAAGG + Intergenic
915114671 1:153589208-153589230 ATGGGATAGGAGGGTGTGAAAGG + Intergenic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
915549516 1:156624292-156624314 ATGGGAGCGGAGGGGGAGGAAGG - Intronic
915574411 1:156766263-156766285 ATTGGAAAGGTTGATGAGGAGGG - Intronic
915601172 1:156924144-156924166 GTGGGAAGGGAGGCTGAGGATGG - Intronic
915673512 1:157510033-157510055 ATGGGAAGGGAGGCTGAGGCCGG + Intergenic
915685900 1:157633707-157633729 ATTGGACAGGAGGGTGATGATGG + Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916013593 1:160728455-160728477 AAGTGAAAGGAGGTTGGGGATGG + Intergenic
916143835 1:161722959-161722981 ACAGGAAAGAAGGAAGAGGAAGG - Intronic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916336694 1:163679108-163679130 AGAAGAAAGGAGAATGAGGAAGG + Intergenic
916988062 1:170213038-170213060 AAGGGAAAGGAGGAGTAAGATGG - Intergenic
916989914 1:170231825-170231847 ATTGGAAAGAAGGAAGAGAACGG + Intergenic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917879087 1:179315822-179315844 ATGGGAGAGGAGGATTGGTAAGG - Intronic
918045711 1:180939828-180939850 ATGAGAAAGGGGGAAGAGGCAGG - Intronic
918164737 1:181934377-181934399 GTGGGAAAGAAGGATGGAGAAGG + Intergenic
918171406 1:182001201-182001223 ATGGGAAAGGTAGCTGAGAAGGG - Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918404727 1:184200491-184200513 ATGTGAATGGAGGATGGGAAGGG - Intergenic
919233281 1:194804219-194804241 TTGGGAAAGGGGGATGAAGATGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919791982 1:201297761-201297783 ATGGGAAGGGAGGAAATGGAGGG - Intronic
919959588 1:202452568-202452590 ACGGGAGAGGAGGAGGGGGAGGG + Intronic
920165435 1:204032311-204032333 AAGGGAAAGGAGGTTCAGAATGG - Intergenic
920219566 1:204386874-204386896 ATTGGAAAACAGGATGTGGATGG - Intergenic
920254827 1:204647544-204647566 AGGGGAGAGGAGGTGGAGGATGG + Intronic
920279124 1:204829686-204829708 TTGGGAAACTAGGATGGGGAAGG + Intronic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920371215 1:205480641-205480663 ACGGGAAAGAGGGATGAGGCTGG + Intergenic
920681557 1:208077008-208077030 CAGGGAAAGGAGGATGGGGTAGG + Intronic
920689809 1:208137331-208137353 ATGGGAAAAGAGTATAGGGATGG - Intronic
920707684 1:208266505-208266527 CTGGGAAAGGTGGGAGAGGAGGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920871859 1:209801475-209801497 ATGGGAAAGGTGGCTGGGAAGGG - Intronic
920972210 1:210752645-210752667 TAGGGAACAGAGGATGAGGAGGG + Intronic
921050658 1:211509010-211509032 AAGGGCAAGGAGGATGAGAAAGG + Intergenic
921219728 1:212964778-212964800 ATTGGAAGGGTGGATGGGGACGG - Intronic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
921956845 1:220993754-220993776 AGGGGAAAGGAAGAAGAGGAGGG - Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922360444 1:224816903-224816925 ATGGGAAGGCAAGATGTGGAAGG + Intergenic
922427696 1:225514784-225514806 ATGGGAGTGGAGGAGGTGGAGGG + Exonic
922621476 1:226991944-226991966 AGGGAAGAGGAGGATGGGGAGGG + Exonic
922824942 1:228511467-228511489 GAGGGAAAGGAAGATGAGGAAGG + Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923051374 1:230393254-230393276 AGGGAAAAGGGGGAGGAGGAGGG + Intronic
923276432 1:232400801-232400823 ATGGGAGTGGGGGTTGAGGAGGG - Intronic
923302569 1:232655491-232655513 CTGGGAAAGGAAGGTAAGGAAGG - Intergenic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
923784407 1:237053784-237053806 AGAGGAAAGGATGTTGAGGAGGG + Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
1062763404 10:44667-44689 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063235598 10:4112322-4112344 ATGGAAAATGAGGATAAGAAGGG + Intergenic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1064216812 10:13407278-13407300 AAGGGAAAGGAGGAAGATGCCGG + Intergenic
1064380305 10:14836172-14836194 ATAAGAAAGGAGGCTGAGGAGGG + Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1064767437 10:18688939-18688961 AAGGAAAAGGAGGAAGAAGAAGG - Intergenic
1065024193 10:21526033-21526055 CCGGGAATGGAGGATTAGGAAGG - Intergenic
1065050376 10:21785806-21785828 ATGGAAAAGGAGGAGGGGAAGGG + Intronic
1065204539 10:23344304-23344326 GATGGAAAGGAGGATGGGGAGGG + Intronic
1065259721 10:23912027-23912049 ATGGAAGAGGAGGAAGAGAAGGG - Intronic
1065368700 10:24960042-24960064 ATGGGAAAGGGGGTGGGGGATGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1067063883 10:43092927-43092949 AGGGGAAGGGAGTAAGAGGACGG - Intronic
1067083823 10:43227921-43227943 ATGGCAGAGAAGGAGGAGGAGGG - Intronic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067475749 10:46564817-46564839 ACGGAAAAGGCGGAAGAGGAGGG - Intergenic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1067618988 10:47776958-47776980 ACGGAAAAGGCGGAAGAGGAAGG + Intergenic
1067657555 10:48207891-48207913 ATGGGAAAGGAGCCTGAGAGAGG - Intronic
1067976486 10:51031527-51031549 ATGGGAAAGAATGAGGAAGAAGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068248567 10:54406458-54406480 AGGAGAAAGGAGGAGGAAGAGGG - Intronic
1068326908 10:55502322-55502344 CTGGGCAAAGAGGATGAGAAGGG - Intronic
1068631394 10:59301969-59301991 GTGGGAGAGGAAGAGGAGGAAGG + Intronic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1069023961 10:63521085-63521107 GTGGGGCAGGAGGCTGAGGAAGG - Intergenic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069536630 10:69258325-69258347 ATGGGCAAGGAAGAAGAGGGTGG + Intronic
1069606517 10:69742187-69742209 GAGGGAAAGGAGGCTGGGGAGGG + Intergenic
1069692268 10:70361709-70361731 ATGGGATGGGAGGGTGAGGGTGG - Intronic
1069773513 10:70913875-70913897 AGGTGAATGGAGGAGGAGGAGGG + Intergenic
1070094181 10:73320617-73320639 ATGGGAAAGAAGGCTGGGCATGG - Intronic
1070199135 10:74186236-74186258 AGGGGAAAGGCGGAAGGGGAAGG - Intronic
1070205145 10:74251278-74251300 AAGAGAAAGGAGGAGGAGTAGGG + Intronic
1070228892 10:74542605-74542627 ATGGGGAATGAGGAAGATGAGGG - Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070680556 10:78446093-78446115 AGGAGAAGGGAGGAGGAGGAGGG + Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071026265 10:81117632-81117654 CGGGGAAAGGAGGAAGGGGAGGG + Intergenic
1071119700 10:82263196-82263218 GTGGGAAAGAAAGATGTGGATGG + Intronic
1071230119 10:83576633-83576655 ATGGCAAAGGAGGCTGGGCACGG - Intergenic
1071536859 10:86440619-86440641 ACAGGAAAGGAGGAAGAGGCAGG - Intronic
1071973435 10:90931147-90931169 TTTGGGAAGGCGGATGAGGAGGG - Intergenic
1072348553 10:94534274-94534296 ATGAGTAAAGAAGATGAGGATGG - Exonic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072645673 10:97251633-97251655 AGGGAAAAGGAAGAAGAGGAGGG + Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073203200 10:101753041-101753063 ATGGGAGAGGAGCATGGGAATGG - Intergenic
1073288440 10:102401940-102401962 TCGGGAAAGGAGGCTGGGGAGGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1073597785 10:104817582-104817604 AGGGGATAGGAGGAGGGGGAGGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073607896 10:104914505-104914527 ATTGGGAAGGAGGCTGAGGTGGG + Intronic
1074226854 10:111493431-111493453 AAGGGAAGGGAGGAGAAGGAAGG - Intergenic
1074330537 10:112503249-112503271 GGGGGAGAGGAGGATGAAGAGGG - Intronic
1074342056 10:112641674-112641696 ATGGGAAAGGAACATTTGGAAGG - Intronic
1074552173 10:114454469-114454491 ATGAGAAAGGAGGGTGTGGAAGG + Intronic
1075153234 10:119953703-119953725 GGGGGCAAGGAGGAAGAGGAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075595178 10:123724037-123724059 CTGGGAAGGGAGCATGAGGGAGG - Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076208211 10:128620139-128620161 ATGGGTCAGGTGGATGATGAAGG - Intergenic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1076318935 10:129564354-129564376 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077339192 11:2018466-2018488 ATGGGCAAGGAGGGGGAGGTGGG + Intergenic
1077475939 11:2790525-2790547 ATGGGAAGGGGGGATGGGAAAGG - Intronic
1077503725 11:2920650-2920672 GCGGGAGAGGAGGCTGAGGAGGG + Intronic
1077598670 11:3557018-3557040 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1077634373 11:3832032-3832054 CTGGAAAAGGATGATGAGTATGG + Intronic
1077698613 11:4418697-4418719 ATATGAAAGCATGATGAGGAAGG - Intergenic
1078305664 11:10183268-10183290 ATTGGAAAGGAGGAGGACGCTGG - Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078657188 11:13252677-13252699 ATGGGAAGGGAGGATGGAGTGGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078893299 11:15576862-15576884 TTGGCAAAGGAGGGTGAGGTAGG - Intergenic
1078920048 11:15821854-15821876 AGGGAAAAGGATGATGAGAAAGG - Intergenic
1079407390 11:20158574-20158596 GTGGGAAAGGAGTATGAGAAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080119275 11:28657710-28657732 ATGGAAAAAGATGAAGAGGAGGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080405145 11:31972030-31972052 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1080603218 11:33841331-33841353 AAGGGAAAGGAGGAGGGAGAAGG - Intergenic
1080728117 11:34917106-34917128 ATTGGAAAGGGGGCTGAGGGAGG - Intronic
1080837298 11:35951182-35951204 ATGGGAAAGGAAGATGAAGGAGG - Intronic
1081197686 11:40181223-40181245 ATGGGAGAGGAAGAAGAGAAAGG - Intronic
1081328841 11:41779433-41779455 ATGGGAAAAGAGGGAGAGTATGG - Intergenic
1081731389 11:45374227-45374249 AAGGGAATGGAGGTTCAGGATGG + Intergenic
1081797685 11:45832787-45832809 ATGGAAATGGAGGAACAGGATGG - Intergenic
1082570254 11:54729626-54729648 ATGGGAAAGGAGCACAAAGATGG - Intergenic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1082971752 11:59030159-59030181 ATGGGTGAGAAGGATGAGAAGGG - Intronic
1083105522 11:60354642-60354664 ATGGAAATGGAGGATGAAAAGGG + Intronic
1083154064 11:60811579-60811601 ATAAGAAGGAAGGATGAGGAGGG - Intergenic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083544437 11:63538192-63538214 GAGGGAGAGGAGGGTGAGGAAGG + Intronic
1083672591 11:64307330-64307352 AAGGAAGAGGAGGATGGGGAGGG + Exonic
1083800676 11:65044677-65044699 ATGGCAGAGGAGGAAGATGAGGG + Exonic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1084069723 11:66726633-66726655 ATGGGAGAGGAAGATGAAGATGG + Intronic
1084254745 11:67932890-67932912 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084457226 11:69274891-69274913 ATGGGAAAGCAGCATTAGGGAGG + Intergenic
1084476082 11:69390565-69390587 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084760683 11:71268748-71268770 AGGAGAAGGGAGGAGGAGGAGGG + Intergenic
1084818128 11:71662997-71663019 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085362491 11:75903093-75903115 AAGAGAGAGGAGGAGGAGGAAGG - Intronic
1085376322 11:76065310-76065332 ATGGGAGAGGAAGATTAAGAAGG - Intronic
1085508745 11:77074664-77074686 AGGGGAGAAGAGGTTGAGGAAGG + Intronic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1085824886 11:79834934-79834956 AAGGGAAAGGAGGAGTAGGGAGG - Intergenic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1086678320 11:89637350-89637372 AGGGGAAAGGAGGGGAAGGAAGG - Intergenic
1086944951 11:92835909-92835931 ATGGGGAAGGATGGTGAGGAGGG - Intronic
1087289812 11:96307939-96307961 AGGGGAAAGGAAGAGGAGGGTGG + Intronic
1087665264 11:101038168-101038190 AAGGGAGAGGAGGAGGAGGGAGG - Exonic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088440051 11:109860242-109860264 ATGAGAAACAATGATGAGGAAGG + Intergenic
1088644095 11:111902552-111902574 TTGGATAAGGAGGATGAGAAAGG - Intergenic
1088789383 11:113211053-113211075 GAGAGAAAGGAGGATGAGAAGGG - Intronic
1088929965 11:114341508-114341530 ATGGGAAAGGAAGATGATGCAGG - Intergenic
1089288002 11:117420017-117420039 CTGGGGAAGGAGGCTGAGGTGGG + Intergenic
1089293013 11:117449887-117449909 GAGGGAAGGGAGGATGGGGATGG - Intronic
1089324442 11:117647656-117647678 AAAGGGAAGGGGGATGAGGAGGG + Intronic
1089362814 11:117902278-117902300 ATGGGAGAAGAGGGTGAGGGTGG + Intronic
1089714517 11:120345172-120345194 AACGGAAAGAGGGATGAGGAAGG + Intronic
1089760693 11:120720855-120720877 AGAGGAATGGAGGGTGAGGATGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1089981007 11:122772499-122772521 AGAGGGAAGGAGGAAGAGGAGGG + Intronic
1090158004 11:124461735-124461757 AAGGGAAAGAAGGAAAAGGAAGG - Intergenic
1090183112 11:124718205-124718227 ACGGGAACAGAGGATGGGGACGG + Intergenic
1090217060 11:124977987-124978009 GGGTGAAAGGAGGGTGAGGATGG - Intronic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090408629 11:126492537-126492559 AGTGGGAAGGAGGAGGAGGAGGG + Intronic
1090625299 11:128603232-128603254 ATGTGTATGGAGGATGAGGCTGG - Intergenic
1090631159 11:128649838-128649860 AAGGGAGAGGAGGAGGAGAAGGG + Intergenic
1090687678 11:129141471-129141493 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1090862449 11:130666130-130666152 AAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1090887634 11:130893155-130893177 ACAGGAAAGGAGGATGGGAAGGG + Intronic
1091170759 11:133517914-133517936 ATGGGCAAGGAGGATGACTGGGG + Intronic
1091238265 11:134035988-134036010 ATAGAAAAGGAAGACGAGGATGG + Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091356473 11:134941597-134941619 TTGGGAAAGGAGGACCGGGATGG - Intergenic
1202822176 11_KI270721v1_random:73648-73670 ATGGGCAAGGAGGGGGAGGTGGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091416840 12:295247-295269 AGGGGAAAGGAGAAAGGGGAAGG + Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091840517 12:3617151-3617173 GTGGGGAAGGATTATGAGGAAGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091933452 12:4415888-4415910 ATGGGGAAGGAAGAGCAGGAAGG + Intergenic
1092092182 12:5812290-5812312 AGGGGAAAGAAAGAAGAGGAAGG + Intronic
1092237422 12:6818943-6818965 AGGGGAAAGGGGGAGGGGGAGGG + Intronic
1092266318 12:6983469-6983491 ATGGAAGAGGTGGATGAGGTAGG + Exonic
1092312531 12:7374025-7374047 AGAGGAAAGAGGGATGAGGAAGG - Intronic
1092396081 12:8128082-8128104 ATGAGAAAGACGGATAAGGATGG + Intronic
1092424810 12:8366365-8366387 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092782490 12:11999926-11999948 AAGGAAAAGGAGTATCAGGATGG - Intergenic
1093360632 12:18222249-18222271 AATGGAAAGGAAGAGGAGGAAGG - Intronic
1093512588 12:19946739-19946761 TGGGGAAAGAATGATGAGGAAGG + Intergenic
1093517965 12:20013368-20013390 ATGGGGACTGAGGTTGAGGAGGG - Intergenic
1095099467 12:38165663-38165685 AAAGGAAAGGAGGAATAGGAAGG - Intergenic
1095244935 12:39908592-39908614 GTGGCTGAGGAGGATGAGGAGGG + Intronic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095563064 12:43588373-43588395 AAAGGAAAGGAGAATGATGAGGG + Intergenic
1095927210 12:47591140-47591162 ATGAGCAAGGAGGAAAAGGAAGG + Intergenic
1096059570 12:48685314-48685336 ATGGGAAACTAGGAAGAGTATGG - Intergenic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096544271 12:52327024-52327046 ATCAGAAAGGTGGATGTGGAGGG + Intergenic
1096601222 12:52731098-52731120 AGTGGAAATGAGGATGAGAAAGG + Intergenic
1096748923 12:53746562-53746584 AATGGAAGGGAGGCTGAGGAGGG + Intergenic
1097779340 12:63685735-63685757 TTGGCAGAGGAGGAAGAGGAGGG - Intergenic
1097903064 12:64892261-64892283 ATAGGAAGGAAGGATGATGAAGG + Intergenic
1098416558 12:70241931-70241953 AGGAGAAAGCAGGAAGAGGAAGG + Intergenic
1098976494 12:76907744-76907766 ATGGCAAAGGAGAATTAAGATGG + Intergenic
1099121905 12:78700724-78700746 AGGGGAGAGGAGGGAGAGGAAGG + Intergenic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099701381 12:86086804-86086826 ATGGGAGAGGAGGGTAAAGAGGG - Intronic
1100189709 12:92177347-92177369 GAGGGAAGGGAGGCTGAGGAAGG + Intergenic
1100256292 12:92886525-92886547 ATGGGAGGGGAGGGAGAGGAGGG + Intronic
1100330955 12:93581800-93581822 ATGAGAAAGGATGGAGAGGATGG + Intronic
1100360738 12:93877572-93877594 AGGGGAAAGGAAGAGGAGGAAGG - Intronic
1100892093 12:99137009-99137031 CTTGGAAACGAGAATGAGGAAGG - Intronic
1101440873 12:104703542-104703564 GTGGGAGAGGAGGTGGAGGATGG - Intronic
1101673217 12:106896415-106896437 AGGGGAAGGGAGGAAGAAGAGGG + Intergenic
1101673241 12:106896472-106896494 AGGGGAGGGGAGGAAGAGGAGGG + Intergenic
1101673249 12:106896491-106896513 AGGGGAGGGGAGGAAGAGGAGGG + Intergenic
1101909412 12:108850506-108850528 ATGGGAGAGGAGCTTGGGGAGGG + Intronic
1101970191 12:109307443-109307465 AGGGAAAAGGAGGAAAAGGAAGG - Intronic
1102079398 12:110085874-110085896 ATGGGAAAGGAATTGGAGGAAGG + Intergenic
1102147934 12:110668912-110668934 ATGGTACAGGAAGCTGAGGAGGG - Intronic
1102423498 12:112822546-112822568 ATGGCAAAGGAGGAGAAGGGAGG + Intronic
1102746220 12:115251269-115251291 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102866206 12:116377051-116377073 ATGGGAAAGGGGGAATAGGTAGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1103156073 12:118686023-118686045 AGGGGGAAGGAGGAAGAGAATGG - Intergenic
1103284503 12:119788988-119789010 ATGGGATTGGAGGATGAGGCTGG + Intronic
1103463499 12:121123551-121123573 ATGGGAAAGGAATTGGAGGAAGG - Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104316225 12:127704390-127704412 ATGGAAGAGGAGGAGGAGGGAGG + Intergenic
1104579507 12:130000207-130000229 ATGGGCAAGGAGGTGGAGGGCGG - Intergenic
1104705681 12:130945085-130945107 TGGGGTCAGGAGGATGAGGAGGG - Intergenic
1104781279 12:131422101-131422123 AGGGGACAGGTGGAGGAGGAGGG - Intergenic
1105269088 13:18854175-18854197 AAGAGAAAGAAAGATGAGGAGGG - Intergenic
1105344574 13:19561086-19561108 AAGGAAGAGGAGGATGGGGAGGG - Intergenic
1105379113 13:19870473-19870495 AAGGGAAAGGAGGGGAAGGAAGG - Intergenic
1105656204 13:22441649-22441671 AGAGGAATGGAGCATGAGGAGGG - Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1106104377 13:26721493-26721515 ATGTGAGAGGAGTATAAGGACGG - Intergenic
1106124019 13:26885384-26885406 AGGGGAAAGTAGCAGGAGGAAGG + Intergenic
1106263860 13:28092320-28092342 ATGGGAAATGAGGGAGAGGGAGG - Intronic
1106456159 13:29929190-29929212 ATGGGAAATGGGGAGGAGGGAGG + Intergenic
1106835554 13:33630792-33630814 AAGGTGAAGGAGGATTAGGATGG - Intergenic
1107377501 13:39820530-39820552 ATTGAAAAGGAGGCTTAGGAAGG - Intergenic
1107946302 13:45420008-45420030 AGGGGAAAGGAGAAAGAGGGAGG + Intergenic
1108166560 13:47699416-47699438 AAGGGAGAGGAAGAGGAGGAGGG - Intergenic
1108327006 13:49343593-49343615 AGGGGAGAGGAGGGAGAGGAGGG + Intronic
1108685084 13:52812626-52812648 ATGGGAAAATATGGTGAGGAGGG - Intergenic
1108712589 13:53048530-53048552 TTGGGTGAGGAGGATGGGGAGGG + Intronic
1108962448 13:56251673-56251695 ATGGGTAGGGAGGATGGTGATGG - Intergenic
1109284260 13:60393727-60393749 AAGAGAAAGGAGGCTGAGGCAGG - Intergenic
1109921137 13:69061220-69061242 AGGAGAAAGGAGGAAGAGGAGGG + Intergenic
1109994575 13:70107434-70107456 AAGGAAGAGGAGGAAGAGGACGG + Exonic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110526242 13:76541453-76541475 AGGTGAAAGGAGGAAGTGGAGGG + Intergenic
1110738353 13:78964917-78964939 ATGGCAAAGGTGGAAGAGGCAGG + Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1110872507 13:80468886-80468908 ATGGGAGATGAGGCTGGGGAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111108852 13:83681251-83681273 ATGGGAAGGGATGGTGAGGAAGG + Intergenic
1111158585 13:84362066-84362088 AGAGGAAAGGAATATGAGGAGGG - Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111350833 13:87028787-87028809 ATGGGATAGTAGAATGTGGAAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111741147 13:92207179-92207201 ATGGGAAAGGAAAGAGAGGAGGG - Intronic
1111979432 13:95001724-95001746 ATTGGAAAGGAGGAAGAACACGG - Intergenic
1112460845 13:99602550-99602572 ATGGGAAAGAAGGATGGGGCGGG - Intergenic
1112687891 13:101852719-101852741 CTGGGAAAGGTGGATCAGGTAGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113284302 13:108829627-108829649 ATGAGAAAAGACTATGAGGAGGG + Intronic
1113326528 13:109287444-109287466 CAAGGAAAGGAGGATGAGAAAGG + Intergenic
1113589648 13:111489381-111489403 AGGGGAGAGGAGGAGGAGGAGGG + Intergenic
1113639917 13:111949856-111949878 ATGGGGAAGAAGGATGAGCCAGG + Intergenic
1114173752 14:20300410-20300432 CTGGGAAAGGAAGATGATGATGG - Intronic
1114507476 14:23228535-23228557 ATGAGCAGGGAGGATGAGCAGGG + Intronic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1114527546 14:23376157-23376179 ATGGGAAAAGAGGAAGAGACAGG - Exonic
1115305884 14:31933038-31933060 AAGGGAAAGGAGAATGATGGAGG - Intergenic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116937565 14:50757893-50757915 ATAGGAGAGGAGGAGGTGGAAGG - Exonic
1117010798 14:51468297-51468319 ATGGGAGAGGGGGAGGGGGAGGG + Intergenic
1117160456 14:52984444-52984466 ATGGGAAAGGATCTTGAGGCTGG + Intergenic
1117602442 14:57390124-57390146 AGGGGCAAGGAGGATGGGGGAGG - Intergenic
1117679170 14:58185593-58185615 GTGGGAAAGAAAGATGATGAAGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118668454 14:68096482-68096504 ATCGAAAAGGAGTAGGAGGAAGG - Intronic
1118798423 14:69166824-69166846 AAGGGAAGGTAGGATGAGGCTGG + Intergenic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1118979099 14:70701695-70701717 AGGGGAAAGGAGGAAGAGGAGGG + Intergenic
1119039974 14:71264727-71264749 AAGGGAAAGAAAGCTGAGGAAGG - Intergenic
1119180369 14:72601002-72601024 GGGGGAGAGGAGGAGGAGGAGGG + Intergenic
1119185893 14:72642308-72642330 ATGGCAAAGGAGGAACAGTAAGG + Intronic
1119186176 14:72644042-72644064 ATGGAAAATGAGGATGATGATGG + Intronic
1119557043 14:75561202-75561224 CTGGGAAAGGAGGATGCAGGAGG - Intergenic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1119999852 14:79290411-79290433 AAGGGAAAGGAGGAGGAGACAGG + Intronic
1120316904 14:82905909-82905931 GTGGCAAAGGCAGATGAGGAAGG + Intergenic
1120519239 14:85507431-85507453 ATGGGAAGGGAGGTTCAGCATGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120895407 14:89527028-89527050 ACAGGAAAGGAGGATAGGGAGGG + Intronic
1121098272 14:91233063-91233085 AGGGGAAGGGAGACTGAGGAAGG + Exonic
1121186145 14:91971544-91971566 AGGGGAAAGGAGGGAGAGGGAGG + Intronic
1121241102 14:92430698-92430720 AAGGGAAAGGAGGGACAGGAGGG - Intronic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121654959 14:95588406-95588428 AGGGGAGACCAGGATGAGGAGGG + Intergenic
1121664359 14:95660661-95660683 ATGGGAGGGGAGGAGGGGGAAGG - Intergenic
1121727933 14:96166512-96166534 GTGGGGAAGGAGGAAGAGAAGGG + Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121760303 14:96439308-96439330 TTAGGAAAGGAGGTTGAGAAGGG + Intronic
1121941430 14:98074574-98074596 GTGAGAAAGGAGGGTGAGGAAGG - Intergenic
1122206021 14:100148434-100148456 ATGAGAAAGGAGGAAGGGGAAGG - Intronic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1123955783 15:25333065-25333087 ATGGGAAAGAAGGTGGAGGGAGG - Intergenic
1124231151 15:27947422-27947444 ATGGCAAAGAAGGGTGAGCAAGG - Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125440426 15:39696842-39696864 AGAGGAAAGGAGGAGGGGGAAGG + Intronic
1125531588 15:40416901-40416923 ATGGGAAAGGGAGATGTGGCTGG + Intronic
1125731320 15:41894158-41894180 CGGGGAAGGGAGGATGATGAAGG - Intergenic
1126388772 15:48122482-48122504 CTGGGAAAGGAAGATGGGGAGGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1126684204 15:51233181-51233203 ATAGGGAAGGAGGATGGGGGAGG - Intronic
1126687301 15:51259557-51259579 AGGGGAAGGGAGGGTGAAGATGG + Intronic
1126778454 15:52119084-52119106 ATGGGAAGGGAGGAGGAGGGAGG + Exonic
1127407934 15:58672481-58672503 ATGGCAAAGGGGGACAAGGATGG + Intronic
1127413884 15:58737535-58737557 ATGAGAGAGGAGGATCAGGGAGG - Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128241781 15:66106179-66106201 ATGGGAAACAATGATGGGGAAGG + Intronic
1128351954 15:66896850-66896872 AGGAGAAAGGAGGAGGGGGAAGG + Intergenic
1128610639 15:69070409-69070431 AGAGGAGAGGAGGAAGAGGAGGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128866424 15:71118092-71118114 ATGGGAAAGGCTGGTGGGGAGGG + Intronic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129705378 15:77791230-77791252 GAGGGACAAGAGGATGAGGAGGG + Intronic
1129765581 15:78164256-78164278 AAAGGAGAGGAGGAAGAGGAAGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129991724 15:79970875-79970897 ATGGAAAAGGAGTTTGAAGACGG - Exonic
1130182452 15:81644283-81644305 ATGGGAAAATCAGATGAGGAAGG + Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130529305 15:84733991-84734013 AAGGAAAAGGAGGAGGAGAAGGG + Intergenic
1130550300 15:84886371-84886393 ATGGGAAGGAAGGAGGGGGAGGG + Intronic
1130819743 15:87482095-87482117 ATGACAAAGGAGCATGGGGATGG + Intergenic
1130925870 15:88385396-88385418 CTGAGAAAGGAGGGTGAGGTCGG - Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131229175 15:90647493-90647515 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1131229224 15:90647628-90647650 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1131284727 15:91047849-91047871 ATGAGGAAGGAGGAGGAGTAGGG - Intergenic
1131759135 15:95600936-95600958 TTGGGAAAGGAGGAGAGGGAAGG + Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132068961 15:98758605-98758627 CTGGGACAGCAGGATGAGCAGGG + Intronic
1132240470 15:100253534-100253556 AGGGGAAGGGAAGATGAGGGAGG + Intronic
1132262134 15:100434958-100434980 GTTGGAAAGGAGGGTGAGGGAGG - Intronic
1132351372 15:101141702-101141724 ATGGGTGAGGAGGTTGAGGGCGG - Intergenic
1132580046 16:680529-680551 AAGGGCAAGGAGGAGAAGGAGGG + Exonic
1132765779 16:1533488-1533510 CTGGGACAGGAAGATGGGGAGGG + Intronic
1132855480 16:2042872-2042894 ATGGGGGAGGAGGGTGGGGAGGG - Intronic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1132970109 16:2682974-2682996 CTGGGAGGGGAGGGTGAGGATGG + Intronic
1132989798 16:2786859-2786881 ATGGGGGAGGGGGATGAGGGAGG - Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133110217 16:3543555-3543577 AAGGGAACGGAGTATGCGGAGGG - Intronic
1133242939 16:4426372-4426394 ATGGGAAAGGAAGAGGACGAGGG - Intronic
1133373427 16:5263669-5263691 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1133417290 16:5616550-5616572 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133417302 16:5616588-5616610 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133717884 16:8466870-8466892 GTGGGAAAGAAAGAAGAGGAAGG + Intergenic
1133736861 16:8622275-8622297 ATCAGAAAGAAAGATGAGGAGGG + Intronic
1134122817 16:11596757-11596779 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1134241979 16:12513134-12513156 AGAGGAAGGGAGGATGAGGGAGG - Intronic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134610262 16:15602604-15602626 AGAAGAAAGGAGGAGGAGGAAGG + Intronic
1134692065 16:16197613-16197635 AGGGGGAAGGAGGAAAAGGAAGG + Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135107546 16:19663365-19663387 ATTGGAGTGGTGGATGAGGATGG - Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135164774 16:20129567-20129589 AAGGGAAGGGGGGATGGGGAGGG - Intergenic
1135178887 16:20255763-20255785 GTGGGCAAGGAGGAGGAAGAAGG - Intergenic
1135554137 16:23421737-23421759 ATGTGTCAGGAGGCTGAGGAAGG + Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135795971 16:25442858-25442880 AAGGGAAAGGAGAAGGAGAAGGG - Intergenic
1135877398 16:26215900-26215922 AAAGGAGAGGAAGATGAGGAGGG + Intergenic
1135999111 16:27277200-27277222 AGGGGAAAGGAAGATTGGGATGG + Intronic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137290916 16:47051350-47051372 ACGATGAAGGAGGATGAGGAAGG + Intergenic
1137386510 16:48047531-48047553 AAGGGAAAGGAACAGGAGGAAGG + Intergenic
1137514611 16:49132359-49132381 AGGGAATATGAGGATGAGGAAGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1138326444 16:56175019-56175041 GTGGGAAAGGGGGAGGATGAGGG - Intergenic
1138624260 16:58236658-58236680 ATGGGGAAGGGGGTTGAGGGAGG + Intronic
1138890330 16:61135392-61135414 GAGGGAAAGGAGGAAGAGAAGGG + Intergenic
1139215848 16:65123368-65123390 ACGGGGAAGGAGGCTGCGGAGGG + Intronic
1139413925 16:66790308-66790330 AAGGGAAAGGAGGGAGGGGAAGG + Intronic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139486482 16:67259683-67259705 AATGGAGAGGAGTATGAGGAAGG - Intronic
1139946308 16:70644822-70644844 AGGAGGAAGGAGGAAGAGGAAGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140104433 16:71946805-71946827 ATGAGAGAGGGGGAGGAGGAGGG + Intronic
1140143921 16:72286936-72286958 ATTGGAAGGGAGGAGAAGGAAGG - Intergenic
1140155982 16:72427186-72427208 ATGGGAGTGAAGGAGGAGGAGGG + Intergenic
1140215158 16:73001153-73001175 AAGGGAGAGGAGGAGGAGAAGGG - Intronic
1140465355 16:75176791-75176813 AAGGGAAAAGAGGAATAGGAAGG + Intergenic
1140738000 16:77915851-77915873 ATGGGAAAGTTAGACGAGGAAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141523189 16:84594968-84594990 AGGGGAAGGGTGGATGTGGAGGG - Intronic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141640494 16:85338181-85338203 ATGAGAAAGGAGGATGAAGCAGG - Intergenic
1141703590 16:85653217-85653239 AGGGGGGAGGAGGAGGAGGAGGG - Intronic
1141703620 16:85653289-85653311 AGGGGGTAGGAGGAGGAGGAGGG - Intronic
1141840622 16:86571966-86571988 AGGTGGAAGGAGGTTGAGGATGG + Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141932236 16:87213593-87213615 ATGGTAAATGATGATAAGGATGG + Intronic
1142423168 16:89985567-89985589 ATGGGTGAGGAGGATGGCGAAGG + Intergenic
1142514491 17:418287-418309 AAGGGAAAGGAAGAAAAGGAAGG + Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143356999 17:6337753-6337775 ATGGGAAAGCAGGTTGGGCATGG + Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391516 17:6561609-6561631 AGAGGGAAGGAGGAAGAGGAGGG - Intergenic
1143391533 17:6561661-6561683 AAGGGAGAGGAGGAAGAGGAGGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1144041377 17:11414069-11414091 AGGGGAGAGGAGGAAGAAGAGGG - Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144176887 17:12716231-12716253 ATGGGTAGAGAGGAAGAGGAGGG + Intronic
1144418543 17:15074399-15074421 ATGGTAGAGGTGGATGAGGTTGG - Intergenic
1144579597 17:16450871-16450893 GTGGGCAGGGAGGGTGAGGAGGG + Intronic
1144580437 17:16456077-16456099 GAGGGAGAGGAGGAGGAGGAAGG + Intronic
1144704789 17:17361453-17361475 AGTGGAAATGGGGATGAGGATGG + Intergenic
1144764112 17:17723696-17723718 GGGGGAAGGGAGGAGGAGGAGGG - Intronic
1144864622 17:18327231-18327253 AGTGGAAAGGAGGAGGAGGCAGG + Intergenic
1145016551 17:19402577-19402599 AGGAGAGAGAAGGATGAGGAAGG + Intergenic
1145376705 17:22356389-22356411 ATGGGAAAAGAGATTAAGGAAGG - Intergenic
1145781988 17:27569438-27569460 GTGGGAAAGGAGGAGGAGCCAGG + Intronic
1146032367 17:29377167-29377189 AAGAGAAAGAAGGATCAGGAAGG - Intergenic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146554033 17:33807659-33807681 ATGTGTGAAGAGGATGAGGAGGG - Intronic
1146660665 17:34663315-34663337 ATGGGGCAGGAGGAGGAGGCTGG + Intergenic
1147560053 17:41503107-41503129 ATGGGAAAGGAAGATGTGTGAGG + Intronic
1147967292 17:44200009-44200031 AAGCGAAAGAAGGAAGAGGAAGG - Intronic
1147969986 17:44214040-44214062 ATTGGAAAGGAGGAACAAGAAGG - Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148352382 17:46950349-46950371 AAGGGCCAGGAGGGTGAGGATGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148614674 17:48991234-48991256 AGGGGCAGGGAGGAAGAGGAAGG + Intergenic
1148768896 17:50055900-50055922 TGGGGTAGGGAGGATGAGGAGGG + Intergenic
1148787448 17:50152225-50152247 TAGGAAAAGGAGGAAGAGGATGG - Intergenic
1148829489 17:50421744-50421766 AGGGGAGAGGAAGTTGAGGAAGG - Intergenic
1148854403 17:50570816-50570838 ATGGGGTAGGAGGAGGGGGAGGG + Intronic
1148885107 17:50766809-50766831 ATGGGACAGGGGGCTGGGGAAGG - Intergenic
1149273165 17:55004726-55004748 AGGGGGAAGGAGGAGGAGGCGGG + Intronic
1149429335 17:56584834-56584856 ATGGGAGGTGGGGATGAGGATGG + Intergenic
1149540626 17:57465536-57465558 AGTGGAGTGGAGGATGAGGAAGG + Intronic
1149891084 17:60391531-60391553 ATGGCAATGAAGGATGAGGGGGG + Intronic
1150929872 17:69573066-69573088 AGGGGACAGGAGGAGAAGGAAGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151272323 17:73006462-73006484 AAGGGAGAAGAGGATGGGGAGGG + Intronic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1151680959 17:75622480-75622502 GGGAGAACGGAGGATGAGGATGG + Intergenic
1151823835 17:76512639-76512661 ACGGGGAAGGATGATGAGGGTGG - Intergenic
1152010127 17:77707780-77707802 ATGGGAGGGGAGGAAGAGGGTGG + Intergenic
1152184763 17:78848394-78848416 AGGGGCTAGGAGGAGGAGGACGG + Intergenic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152474600 17:80509843-80509865 ATGAGAAAGGCGGAGCAGGAGGG - Intergenic
1152859107 17:82685269-82685291 AGGGAAAAGGAGGGTGGGGAGGG + Intronic
1152870470 17:82751054-82751076 ACGGGGATGGAGGATGGGGACGG - Exonic
1152930744 17:83108259-83108281 ATGGGAGAGGAAGATGCAGAAGG + Intergenic
1152956313 18:44998-45020 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1153776601 18:8459647-8459669 ATCTGACAGGAGGATGGGGAGGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154490354 18:14917387-14917409 AAGGGAAAGATGGAAGAGGAAGG - Intergenic
1154498174 18:14977707-14977729 TTGGGATAGGAGGACCAGGATGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155686454 18:28558008-28558030 ATGGTATAGGGGGATGAGTATGG - Intergenic
1155718728 18:28982481-28982503 GTGGGCAAGGAGGATTGGGAGGG + Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155755726 18:29493123-29493145 ATGGGATAGGATGAAGAGGTGGG - Intergenic
1156080577 18:33329822-33329844 AAAGGAAAAGAGGAAGAGGAAGG - Intronic
1156114967 18:33776560-33776582 GTGGCAAATGAGGATGAGCAAGG - Intergenic
1156447512 18:37248551-37248573 GTGGGAAAAGAGGATGGGGTAGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1157145554 18:45158977-45158999 GAGGGAAAGGAGGAGGAGAAAGG - Intergenic
1157215644 18:45781034-45781056 AAGGGAAAGGAGGTAGAGGATGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157624954 18:49043560-49043582 ATGAGAAAAGATGATGAGGCAGG - Exonic
1157811634 18:50701178-50701200 ATGGCCAAGGAGGATGGGGGTGG - Intronic
1158038285 18:53061539-53061561 AAGGGAAAGGAGGGTTAGAAAGG + Intronic
1158203406 18:54964319-54964341 ATGGGAGAGGAGGAAGAAGTTGG - Intergenic
1158287084 18:55895771-55895793 ATGGGAGAGGAGGTTAAGCAGGG + Intergenic
1158538871 18:58334276-58334298 AAGGGAAAGGAACATGTGGACGG - Intronic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159682498 18:71372353-71372375 ATGAGTAAGGGGGATGAGGGTGG - Intergenic
1159843623 18:73430969-73430991 GTGGGCAAGGAGGAGAAGGAAGG - Intergenic
1159962845 18:74568775-74568797 AAGGGATGGGAGGATGAAGAAGG + Intronic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160283772 18:77519073-77519095 ATAGGAGAGGAGAATGGGGAGGG - Intergenic
1160676381 19:393580-393602 GTGGGAAAGGATGATGGAGAAGG + Intergenic
1160676393 19:393622-393644 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676438 19:393799-393821 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676474 19:393954-393976 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676476 19:393967-393989 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676504 19:394078-394100 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676508 19:394091-394113 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676531 19:394177-394199 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676585 19:394414-394436 ATGGGGAAAGATGATGGGGAAGG + Intergenic
1160676615 19:394562-394584 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676728 19:395069-395091 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676774 19:395256-395278 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676799 19:395356-395378 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676824 19:395456-395478 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160692010 19:464494-464516 ATGTGTATGGAGGATGGGGAAGG - Intronic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695200 19:480512-480534 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695204 19:480525-480547 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695373 19:481434-481456 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695394 19:481509-481531 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160874962 19:1292643-1292665 TGGAGAGAGGAGGATGAGGAGGG + Intronic
1160965689 19:1746077-1746099 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965720 19:1746158-1746180 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965734 19:1746195-1746217 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160965798 19:1746366-1746388 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1161166805 19:2792046-2792068 TGGGGACAGGAGGAGGAGGAAGG - Intronic
1161235189 19:3194131-3194153 ATAGTAAAGGAGGCTGAGGCGGG + Intronic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161653144 19:5497535-5497557 ATGGGAGAGAAGGAGGAGGGAGG + Intergenic
1161688817 19:5718946-5718968 ATGGGACAGGAGGCTTAGGAGGG - Intronic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1162232795 19:9281627-9281649 AGGGTAAAGAAGGATGGGGAAGG + Intergenic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162734842 19:12740918-12740940 ATGGGATAGAAGTTTGAGGAGGG + Intronic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1162875260 19:13616693-13616715 AAGGGAGATGAGGATGAGGGAGG + Intronic
1162964594 19:14149981-14150003 ATGGGGAAGGAGGAGGAGAGAGG + Exonic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163340801 19:16705593-16705615 CTGGGAAGGGAGGCTGAGGCAGG + Intergenic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163401372 19:17095129-17095151 ATTGGAAGGGAGGCTGAGGCAGG + Intronic
1163463080 19:17450702-17450724 AAGGAAGAGGAGGAGGAGGAGGG - Intronic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1163779334 19:19238223-19238245 ATGGGATAGGAGCGTGAGGGGGG - Intronic
1163827814 19:19533447-19533469 AGGGGGCAGGAGGAGGAGGAAGG - Intronic
1164419464 19:28075924-28075946 ATGGAAGAGGAGGATGAGGGAGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164643597 19:29843383-29843405 AAGGGAGAGGAAGAGGAGGAGGG + Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1164953878 19:32363983-32364005 ATGGGAAAAGAGGCTTAGTATGG - Intronic
1165431288 19:35774945-35774967 CTTTGAAAGGAGGCTGAGGAGGG + Intronic
1165820396 19:38671192-38671214 ATGGGAAAGGGGGAGGAGTCCGG - Intronic
1165826710 19:38709772-38709794 AAGGGCAAGGTGGCTGAGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1167175310 19:47860610-47860632 AGGGGAAAGTAGGGGGAGGAGGG - Intergenic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167554794 19:50187916-50187938 ATGGGAATGAAGGGAGAGGAAGG + Intergenic
1167593439 19:50416159-50416181 AGGGGAAGCAAGGATGAGGAAGG - Intronic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925413080 2:3651196-3651218 GTGGGAAAAGAGGACGAGGACGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925539270 2:4949333-4949355 ATGGGAAGAGAGGATTATGAAGG - Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
925965686 2:9063065-9063087 AAGAGAAAGGAAGAAGAGGAAGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926300026 2:11595858-11595880 ATGGTAAAGGATGAAGGGGAAGG - Intronic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926887696 2:17613040-17613062 AGGACAAAGAAGGATGAGGATGG - Intronic
926963517 2:18385517-18385539 ATGGGACAGAAGGCTGAGGCTGG - Intergenic
926974990 2:18505951-18505973 AAGGGAGAGGAAGATGAAGAGGG + Intergenic
927291014 2:21405088-21405110 TTGGGAATGGAGAATGAAGAGGG + Intergenic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
927662305 2:25003265-25003287 AGGGGACAGGAGCATGAGAATGG + Intergenic
927851770 2:26504044-26504066 ATGGCAAAGGCGGAAGTGGAGGG - Intronic
927889306 2:26738523-26738545 CTGGGAAGGGAGGATCAGGAAGG - Intergenic
928102962 2:28450104-28450126 GGGGGAAAGAAGGAGGAGGAGGG - Intergenic
928109351 2:28494126-28494148 ATGTGAAAGGAGTTAGAGGAAGG + Intronic
928204127 2:29271988-29272010 AGGGGTAGGGAGGTTGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928840305 2:35598278-35598300 ATGTGAAAAGAGTAAGAGGAAGG + Intergenic
929191353 2:39143198-39143220 ATTGGAAAGGGGCATAAGGAGGG - Intergenic
929582106 2:43087931-43087953 ATGGGCAAGGCAGAAGAGGAGGG + Intergenic
929656788 2:43740981-43741003 ACAGGAAAGGATGATGGGGAAGG - Exonic
929882949 2:45853156-45853178 ATAAGAAAGGAGAATGGGGAGGG - Intronic
929904765 2:46036217-46036239 AGGGGAAAGTGGGATGAGGTGGG + Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930231769 2:48850523-48850545 ATTGGTAAGGAGGAAGAGGGAGG - Intergenic
930358502 2:50348350-50348372 ATGGGAAGAGAGGAAGAGAAGGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
930749002 2:54914442-54914464 ATGGTAGAGGAGGATGAGGCTGG + Intronic
931025429 2:58108910-58108932 ATGAGAAAAAAGGATGAGTAAGG - Intronic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
931797749 2:65727947-65727969 GGGGGAAGGGAGGATAAGGAAGG + Intergenic
932133939 2:69212208-69212230 AGGGGAGGGGAGGAGGAGGATGG + Intronic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932564064 2:72894637-72894659 ATGGGAAAGGACGAAGGTGAAGG - Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
933036825 2:77410551-77410573 ATGGGAAAGTACATTGAGGATGG + Intronic
933129013 2:78649737-78649759 TTGGGAGAGGAGGAAGAGGAGGG - Intergenic
933450441 2:82442712-82442734 ATTGGAAAAGTGGAGGAGGAGGG + Intergenic
933759037 2:85661832-85661854 ATGGAAAAGGGGGATGGGAAGGG - Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934069485 2:88370876-88370898 ATGGGAAGGGAGTTTGGGGAAGG - Intergenic
934089166 2:88536185-88536207 AAGGGAAGGGAGGAAAAGGAAGG + Intergenic
934161872 2:89257462-89257484 AGAGGAAGGGAGGATGAGGCTGG + Intergenic
934205410 2:89924900-89924922 AGAGGAAGGGAGGATGAGGCTGG - Intergenic
934652356 2:96099849-96099871 AGGGGAGAGGAGTAGGAGGAAGG + Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934653271 2:96104243-96104265 TGGGGAAAGGAGGGAGAGGAAGG - Intergenic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
934885580 2:98021509-98021531 CTGGGAATGGAGGTTGGGGAAGG - Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935046218 2:99485880-99485902 ATGAGGCAGGAGGATGAGGCAGG + Intronic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
935225104 2:101046396-101046418 ACAGGACAGGAGGAAGAGGATGG - Intronic
935279653 2:101506452-101506474 GTGGAAGAGGAGGATGGGGAAGG + Intergenic
935351136 2:102152608-102152630 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
935356859 2:102209442-102209464 AAAGTAAAGGAGGGTGAGGAGGG + Intronic
935441554 2:103103919-103103941 ATGGAAAAGGAGGAAGAGAAAGG - Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935622799 2:105144034-105144056 GAGGGAGAGGAGGAGGAGGACGG - Intergenic
935901130 2:107794998-107795020 GTGGGATAGTGGGATGAGGAGGG + Intergenic
935916284 2:107954476-107954498 ATGAGGAAGGAGGTTGAGGCTGG + Intergenic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936234615 2:110732498-110732520 AGGGGAGAGGAAGGTGAGGAGGG + Intergenic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936596715 2:113855101-113855123 TTGAGAAAGGAGGGTGATGAGGG + Intergenic
936805067 2:116321406-116321428 CTGGGAAAGGAGGGTGGAGAAGG + Intergenic
937153888 2:119704616-119704638 GGAGGAAAGGAGGAGGAGGAAGG + Intergenic
937325149 2:120985827-120985849 AAGGGAAAGGATGACCAGGAGGG - Intronic
937382826 2:121396245-121396267 ATGGGAAAGGAGAATTAGTGGGG + Intronic
937432203 2:121848455-121848477 ATGGGAAGGGAGGAGGAGAAAGG + Intergenic
937509801 2:122582945-122582967 AGGGGAAAGGAGGACCAGGGAGG + Intergenic
937509853 2:122583104-122583126 AGGGGAAGGAAGGAAGAGGAAGG + Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
937833247 2:126445951-126445973 ATGGGAACAGAGGAAGAGAAAGG + Intergenic
937847342 2:126595447-126595469 TTGGGAAAGGAAGATGGGCACGG - Intergenic
937972967 2:127564537-127564559 GGGGGAAAGGTGGGTGAGGAAGG + Intronic
938120089 2:128627001-128627023 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
938215156 2:129505108-129505130 ATTGGAAAGGAGTATGAAGCAGG - Intergenic
938399987 2:130982599-130982621 AGAAGAAAGGAGGAGGAGGAGGG - Intronic
938611632 2:132953601-132953623 ATGCCAAAGGAGGGAGAGGAAGG + Intronic
938707566 2:133945583-133945605 ATGGGAAGGGAGGAAAAGAAGGG + Intergenic
938743134 2:134251884-134251906 AGGAGAGAGGGGGATGAGGAGGG - Intronic
938960001 2:136332211-136332233 GTGGGAAAGGTGCATGTGGAAGG + Intergenic
939056111 2:137366240-137366262 ATGGGGTGGGGGGATGAGGATGG + Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939254433 2:139724122-139724144 AAGGGAAAGGAGGAATAGGGTGG - Intergenic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940014019 2:149084793-149084815 ATGGGAAAGGTGGACTAAGAGGG - Intronic
940031717 2:149270462-149270484 TTGGGAATGGGAGATGAGGATGG + Intergenic
940122250 2:150279635-150279657 ATAGGAAAGGAAGGAGAGGAAGG - Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940363232 2:152818081-152818103 ATGTAAGAGGAGGATGGGGAGGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
942507354 2:176657062-176657084 ATAGAAAGGGAGGAGGAGGAGGG + Intergenic
942895763 2:181052337-181052359 AGAGAAAAAGAGGATGAGGAAGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943332623 2:186577624-186577646 AAGGGAAAGGAGAATAGGGAAGG + Intergenic
943361032 2:186919608-186919630 CTTGGAAAGGAGTATGTGGATGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943644591 2:190396179-190396201 AAGGAAGAGGAGGAAGAGGAGGG - Intergenic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944217075 2:197267332-197267354 ATTAGAAAGGTGGAGGAGGATGG - Intronic
944555404 2:200883390-200883412 ATGGGAAAGGAAGAAGGTGAGGG - Intronic
944667494 2:201969622-201969644 ATGGCAGAGAAGGATGAGGAAGG - Intergenic
944772714 2:202930835-202930857 AAGGGAGAGGAAGAAGAGGAGGG - Intronic
944851205 2:203721460-203721482 CTGGGCAAGGGAGATGAGGAGGG - Intronic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946010441 2:216560006-216560028 AGGGGAAAGGAAGAGGAAGATGG - Intronic
946147513 2:217742132-217742154 CTGGAAAAGGAGGATGGTGATGG - Intronic
946237387 2:218332535-218332557 ATGGGGAAGGAGGAAGGGAAGGG - Intronic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946788832 2:223277778-223277800 GTGGGTGAGGAGGATGATGAAGG - Intergenic
946978390 2:225178421-225178443 AAGGGAAAAGGGGATGAGGGTGG - Intergenic
947092038 2:226522618-226522640 ATGAGAAAGGAGCTTGTGGAAGG - Intergenic
947324095 2:228955824-228955846 AGAGAAAAGGAGGCTGAGGATGG + Intronic
947744668 2:232501407-232501429 GTGGGAGAGGAGGAGGAAGATGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948091854 2:235301952-235301974 AGGAGGGAGGAGGATGAGGAGGG - Intergenic
948091859 2:235301968-235301990 AGGAGGGAGGAGGATGAGGAGGG - Intergenic
948091890 2:235302069-235302091 AGGGAAAAGGAGGAGGAGGGAGG - Intergenic
948091938 2:235302199-235302221 AGGGGGGAGGGGGATGAGGAGGG - Intergenic
948492561 2:238322385-238322407 ATGGGAGAGGAGGAGGAACATGG + Intronic
948558666 2:238835860-238835882 ATGGGACAGGAGGCAGCGGAGGG - Intergenic
948681255 2:239636217-239636239 AAGGCACAGGAGGTTGAGGAGGG - Intergenic
948790160 2:240372733-240372755 ATGGGTGTGGAGGATGAGCACGG + Intergenic
948893005 2:240916227-240916249 ATGGGAGAGGAGGGGAAGGAAGG - Intergenic
949052974 2:241907340-241907362 TGGGGAAACGTGGATGAGGACGG + Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168958336 20:1850077-1850099 GTGGGGAAGGAGGATGGGGTTGG + Intergenic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169208663 20:3753866-3753888 GTGGGAGAGGAGGACGAGGGAGG + Exonic
1169248004 20:4038958-4038980 AGGGGAGAGGAAGAGGAGGAAGG - Intergenic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169709654 20:8547524-8547546 ATGGGCAATGAGGAAGAGGGAGG - Intronic
1169765581 20:9144674-9144696 AGGGGGAAGGAGGGGGAGGAGGG + Intronic
1169850034 20:10037992-10038014 ATGGTAAAGTGTGATGAGGAGGG + Intronic
1170016783 20:11790664-11790686 TTATGAGAGGAGGATGAGGAAGG - Intergenic
1170711968 20:18799349-18799371 ATAGGGAAGGAGGAGGAGCAAGG - Intergenic
1170948108 20:20910005-20910027 AAGGGAAAGGGGGAGGAGAAGGG + Intergenic
1171080454 20:22177300-22177322 ATGGGAAAGGAGGAGGAGCCAGG - Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171151909 20:22834893-22834915 AAAGGAATGGAGGAAGAGGAGGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1171307274 20:24117204-24117226 ATGAGAGAGGGGGAGGAGGAAGG + Intergenic
1171373037 20:24673965-24673987 TTGGGAAACAAAGATGAGGAAGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172208182 20:33179574-33179596 CGGAGAAAGGAGGAAGAGGAGGG - Intronic
1172214425 20:33225069-33225091 ATGAGAGAGGAAGAGGAGGAAGG - Intronic
1172477062 20:35247070-35247092 ATAGGAAGGGAGGATGGGCATGG - Intronic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172778304 20:37420669-37420691 ATGGGGAAGGAGGAGCAGGGAGG - Intergenic
1172810270 20:37642587-37642609 ATGGGATAGGTGGATGGGGGAGG - Intergenic
1173103905 20:40113335-40113357 ATAAGAAAGGAAGAGGAGGAAGG - Intergenic
1173165332 20:40683545-40683567 ACGGAAAAGGAGGATGACGGTGG + Intergenic
1173201532 20:40958786-40958808 GTGGGAAAGCGGGATGGGGAGGG - Intergenic
1173201653 20:40959468-40959490 ATGGGAAAGGAGGGTCAAGAAGG + Intergenic
1173527062 20:43741128-43741150 ATGGGGAAGGAGGAAAAGAAAGG - Intergenic
1173607142 20:44339472-44339494 ACTGTTAAGGAGGATGAGGAGGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1173920996 20:46744487-46744509 GTGGCAGAGGAGGAGGAGGATGG + Intergenic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174250378 20:49215099-49215121 TTGGGCCAGGAGGATGAGGATGG - Intergenic
1174308727 20:49633877-49633899 AGGGGAGAGGAGAATGAGAAGGG + Exonic
1174867607 20:54152409-54152431 TGGGGACAGCAGGATGAGGAAGG - Intergenic
1175067923 20:56305825-56305847 ATGGGAAATGGGCTTGAGGAGGG + Intergenic
1175091780 20:56510839-56510861 ATGAGGTAGGAGGATGAGGTGGG + Intronic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175134794 20:56815145-56815167 ATTGGAAGAGAGGAGGAGGAGGG + Intergenic
1175231719 20:57477686-57477708 AAGAGAAGGGAGGCTGAGGAGGG - Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175705365 20:61172646-61172668 ATGGGATAGGAAGAAGAGGAAGG - Intergenic
1175853277 20:62104969-62104991 TTGGGAAAGGAGGAAGAGTTAGG + Intergenic
1175993872 20:62803870-62803892 ATGTCAAAGGTGGATGAGCAAGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177917503 21:27108190-27108212 ATGGGAAAGGATGGTGAAGAAGG + Intergenic
1178271558 21:31194399-31194421 ATGGGAAGGGAGGATAATGTAGG + Intronic
1178397119 21:32252417-32252439 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179084892 21:38207710-38207732 AGGGGAGAGAAGGAGGAGGAGGG - Intronic
1179147698 21:38782942-38782964 ATGAAAAAGGAGGCTGAGCACGG - Intergenic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1180041198 21:45281127-45281149 GTGGAAAAGGAGGCTGATGATGG - Intronic
1180076040 21:45463342-45463364 ATGGGAATGGGGGTGGAGGATGG + Intronic
1180699003 22:17771720-17771742 AGAGAAAAGGAGGAAGAGGAAGG + Intronic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181411616 22:22726105-22726127 AAGAGAAGGAAGGATGAGGAAGG + Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181569671 22:23761448-23761470 AAGGGAAAGGAGGGAGGGGAGGG + Intergenic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1182122091 22:27794878-27794900 GTGGGAGGGGAGGATGAGAAGGG + Intronic
1182741488 22:32571220-32571242 AGAAGAAAGGAGGATGAGAAGGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183328157 22:37205465-37205487 AAGGGAGAAGAGGAAGAGGAAGG - Exonic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1183496504 22:38147975-38147997 ATAGGGAAGGAGGAGGCGGAAGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183919043 22:41149088-41149110 ATGGGAACTGAGTCTGAGGAAGG - Exonic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184501788 22:44878986-44879008 ATGGGATTGGAGGACAAGGACGG + Intergenic
1184729811 22:46366048-46366070 AGGGGAAAGGTGGAGGGGGAAGG + Intronic
1184753400 22:46502283-46502305 AGGGGAAGGGAGGGTGGGGAGGG + Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1185055980 22:48578574-48578596 ATAGGAAGGTGGGATGAGGATGG + Intronic
1185089346 22:48757134-48757156 AGAGGCAAGGAGGAGGAGGAGGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
949094318 3:67739-67761 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
950208213 3:11096391-11096413 GTGGGAAAGCAGGATATGGAAGG - Intergenic
950352931 3:12374772-12374794 AGGGGACAGGAGGCTGGGGAAGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950850980 3:16062124-16062146 AAGGGAAAGGAGTATGAGAGGGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
952002350 3:28800646-28800668 AAGGGAGAGGAGGAGGAAGAAGG - Intergenic
952384827 3:32832778-32832800 CTAGGAAGGGAGGAAGAGGAGGG - Intronic
952412636 3:33063425-33063447 AGGGGAGAGGAGGAGGAGGAGGG + Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
952926866 3:38326663-38326685 AGGAGAAAGGAGGAAGAGGAGGG - Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
953145008 3:40267004-40267026 TTGGCAAAGGAGGAAGGGGAGGG - Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953871295 3:46629705-46629727 AGGAGAATGGAGGAGGAGGAGGG + Intergenic
953904528 3:46861803-46861825 AAGGGAAAGGAGGTTGGGGGAGG + Intronic
953942300 3:47110886-47110908 AGGGGAAAGGAGACTGGGGAAGG - Intronic
954090438 3:48279697-48279719 ATGGGAAAGGAGGGTTAACAAGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954258064 3:49419877-49419899 AGTGGAGAGGAGGAGGAGGAGGG + Intronic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954656139 3:52195350-52195372 AAGGGAAAAGAAGATGGGGAAGG + Intergenic
954810875 3:53246918-53246940 AGGGGAAGGGAAGATGAGGATGG + Intronic
954876441 3:53805868-53805890 ATGCGGGAGGAGGAGGAGGAGGG - Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955307457 3:57848584-57848606 AGGAGGAAGGAGGAAGAGGAGGG - Intronic
955727065 3:61944419-61944441 AGGGGAAATGAGGAAGACGATGG - Intronic
955792082 3:62598425-62598447 AGAGGAAAGGAAGATAAGGAAGG - Intronic
956140241 3:66139042-66139064 AGAGGAAAAGAGGATGGGGAGGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956291099 3:67661207-67661229 ATAAGAAAGGAGGAAGAGTAAGG + Intergenic
956390299 3:68764931-68764953 CTGGGAAAGGGGGATGATTAGGG - Intronic
956421217 3:69087669-69087691 ATTTGAAAGGAAAATGAGGAGGG - Intronic
956741563 3:72279914-72279936 GTGGGGAAGGAAGAGGAGGAGGG + Intergenic
956751921 3:72350428-72350450 AGGGGACAGGAGGCTGAGGAAGG - Intergenic
956798895 3:72739304-72739326 TGGGGGAAGGAAGATGAGGAGGG - Intergenic
957068827 3:75549473-75549495 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957288044 3:78242045-78242067 ATAGGAAGGGAAGAAGAGGATGG - Intergenic
958111478 3:89152388-89152410 ATGTGAAAGGAGGTTGTGGGTGG - Intronic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958603600 3:96330691-96330713 ATGGGAAAGTATGGTGGGGAAGG + Intergenic
958765461 3:98361746-98361768 TTGGGAAAGGATGATGATCAAGG + Intergenic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959034664 3:101346961-101346983 GGAGGAAAGGAGGAGGAGGAAGG + Intronic
959366123 3:105459896-105459918 ATGGGACAGCAGGCTGTGGAAGG + Intronic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960116833 3:113903428-113903450 AGAGGAAAGGAGGAGGAAGAAGG - Intronic
960331842 3:116369565-116369587 AAAGAAAAGGAGGAAGAGGAGGG + Intronic
960418340 3:117412707-117412729 AGAGGAAAAGAGGATGAAGAAGG - Intergenic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960707758 3:120496657-120496679 ATGGGAGAGGAGGGTGTGGTTGG + Intergenic
960945855 3:122966116-122966138 ATGGGAAGTGGGGAGGAGGAGGG - Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961029507 3:123589575-123589597 ATGGGAAAGTAGGAGGAGGCAGG + Intergenic
961184988 3:124906931-124906953 ATGGTAAAGGAAGAGGAGAAAGG - Intronic
961284585 3:125790854-125790876 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
961436015 3:126917072-126917094 AGGGGATATGAGGATGAGAAAGG - Intronic
962156344 3:132952601-132952623 ATGAGAGATGAGGAAGAGGAAGG - Intergenic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962694750 3:137937016-137937038 AGGGGAAAAGAGGATGAGGCAGG + Intergenic
962990306 3:140572014-140572036 AGGGGAAGGGAGGATGAACAAGG + Exonic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
963773889 3:149418974-149418996 ATGGGAAAGAAGGATGACAAAGG + Intergenic
963873661 3:150448063-150448085 AGGAGAAAGGGGTATGAGGAGGG - Intronic
963896049 3:150686104-150686126 CTGGGCAAGGAGGATGATGGTGG - Intronic
964349188 3:155786112-155786134 ATGGGAAAGGAGAAAGGGAAGGG + Intronic
964374428 3:156035578-156035600 AGGGGGGAGGAGGAGGAGGAAGG - Intergenic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964490724 3:157233116-157233138 AGGGGAAAGGAACAAGAGGAAGG + Intergenic
964651689 3:159018342-159018364 AAGGGAAAGGAGTATTGGGAAGG + Intronic
965312208 3:167143289-167143311 TTGGGAAGGGAGGAGGAAGAAGG + Intergenic
965365603 3:167795532-167795554 TTGGGAAAGAAATATGAGGAGGG - Intronic
965556674 3:170025640-170025662 ATGAGAACTGAGGATGAGGAAGG + Intergenic
965768756 3:172158883-172158905 GTGGGAAAGGAAGATAAGGGAGG - Intronic
965947288 3:174258851-174258873 AAGGGAAGGGAGGAAAAGGAAGG + Intronic
966005661 3:175008475-175008497 AAGGAAACGGAGGATAAGGAGGG + Intronic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966766105 3:183464029-183464051 AGGGGAAATGTGGAGGAGGAAGG - Intergenic
966804914 3:183799534-183799556 ATGGTAAAGGAGGTTTAGGTAGG + Intronic
966908581 3:184544777-184544799 AGGGGAGAGGAGGAGGAGGGGGG - Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967980343 3:195061585-195061607 CTGGGAAAGGAGGCTGAGCTGGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969218339 4:5741408-5741430 ATGGAAATGGGGGATGTGGAGGG + Intronic
969370378 4:6727773-6727795 AGGGGACAGGAGGGGGAGGAGGG - Intergenic
969445482 4:7242631-7242653 TTGGGAAAGCAGGATGAATAGGG - Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969740688 4:9023782-9023804 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
969800030 4:9556618-9556640 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
970365501 4:15354142-15354164 ATGGGACAGAAGGATGAAAAGGG + Intronic
970403912 4:15743939-15743961 ATGGGAATGGAGGGTGAGAGAGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
971261090 4:25057537-25057559 GTGGGACAAGAGGGTGAGGAGGG + Intergenic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971582296 4:28357280-28357302 ATGGGAAAGGAGGAGAGGGAAGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971662978 4:29444104-29444126 AAGGGAGAGGAGGAAGAAGATGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972138120 4:35918768-35918790 AAGGGACTGGAGGGTGAGGAAGG - Intergenic
972289570 4:37678904-37678926 ATGGGAGAGGAGGATCAGGTAGG + Intronic
972332569 4:38077717-38077739 AGGGGAAAAAAGGATGACGACGG - Intronic
972830964 4:42813346-42813368 ATGGGAAATGTGGATGAAGCTGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973263171 4:48185785-48185807 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973263183 4:48185810-48185832 ATGGGAGAGGGGGAGGGGGAGGG - Intronic
973885611 4:55318020-55318042 GAGGGCAAGGAGGAAGAGGAAGG + Intergenic
973927011 4:55748921-55748943 ATGGGAATGGTGGGTGAGGTAGG + Intergenic
974453729 4:62099409-62099431 ATGGGAAGGGAAGAAGTGGATGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976353585 4:84088192-84088214 ATGGGAAAGGAGGTTGGATAGGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
977370363 4:96126669-96126691 ATGGGAAAGGAGAAAGAAAAGGG + Intergenic
977717635 4:100199699-100199721 GTGGGATAGGAGGATAAGGATGG + Intergenic
978227396 4:106353619-106353641 ATGGGAAAAGATGAAGAGGAAGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978678874 4:111353838-111353860 ATAAGAAAGGAGGCTTAGGAGGG + Intergenic
978752621 4:112268806-112268828 ATGTGAAGGAAGCATGAGGAGGG + Exonic
978764389 4:112389570-112389592 AGGAGAATGGAGCATGAGGAAGG + Intronic
979011854 4:115380980-115381002 ATGGGAAAGCTGGCTGAGAAAGG - Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979710604 4:123774444-123774466 GAGGGAGAGGAGGATGAGAAAGG - Intergenic
980977925 4:139628818-139628840 ATGGGGAGGGAGGGTGAGGCCGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981057124 4:140374133-140374155 ATGGGAGGGGAGGCTGAGGTGGG + Intronic
981491158 4:145340792-145340814 ATGTTAAATAAGGATGAGGATGG + Intergenic
981602701 4:146508618-146508640 ATGGGTGAGGAGGATGTAGAAGG - Intronic
981814521 4:148815347-148815369 AAGGGAAAGGAAGATCATGAAGG - Intergenic
981840295 4:149103880-149103902 AGGGGAAGTGAGGATGGGGAGGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982141489 4:152324465-152324487 GTAGGAAAGGGGGAAGAGGATGG + Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982346191 4:154362742-154362764 ATGGCCGAGGAGGAAGAGGAAGG - Intronic
982445282 4:155483844-155483866 ATGGAAACGGAGGATGAGCGGGG - Intergenic
982495898 4:156091832-156091854 GTGGGTGTGGAGGATGAGGAGGG + Intergenic
982538814 4:156641363-156641385 ATGGGAAGGAAGGAAGGGGAAGG + Intronic
983068389 4:163238697-163238719 ATGGGAAGGGAAGATGGGGAGGG + Intergenic
983912167 4:173252227-173252249 ATGAGGGATGAGGATGAGGAAGG - Intronic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984731584 4:183073487-183073509 AGAGGCAAGGAGGAAGAGGAGGG + Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985026459 4:185743979-185744001 GGGGGACAGGAGGAGGAGGAGGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985301264 4:188492341-188492363 CTGGGAATGGACTATGAGGAAGG + Intergenic
985440433 4:189979843-189979865 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
985475508 5:76739-76761 ATGGGAGAGGAGGCCTAGGAGGG + Intergenic
985631571 5:1016846-1016868 TGGGGAAACGAGGATGAGGTCGG - Intronic
985822773 5:2171288-2171310 TTGGGAACTGAGGATGAAGATGG + Intergenic
985875584 5:2591557-2591579 AGGGGAAAGGAGGAAAAGGAAGG + Intergenic
986240355 5:5954899-5954921 AGGGGAAAGAAGGAGAAGGAGGG - Intergenic
986511589 5:8512752-8512774 ATGGCAAAAGATGAAGAGGAAGG + Intergenic
986658445 5:10038120-10038142 ATGGGAAGGGAGTGAGAGGAAGG - Intergenic
986683569 5:10255561-10255583 AGGAGAAAGGAGGATGGGGGTGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987206415 5:15631558-15631580 ATGGGACAGGAGGCTGAGGAAGG + Intronic
987382631 5:17299926-17299948 CTGGGAATGGAGGTTGGGGATGG + Intergenic
987453278 5:18112606-18112628 ATTGGAAAGGAGAATGACAATGG - Intergenic
988153142 5:27413885-27413907 TGGGGAAAGGAAGAGGAGGAGGG - Intergenic
988206585 5:28144142-28144164 ATGGGAAAGTAGGAGAAGGTGGG + Intergenic
988266595 5:28959471-28959493 AAGGTAAAGGAAGGTGAGGATGG - Intergenic
988443726 5:31261208-31261230 GTGGGCAATGAGGATGAAGATGG - Intronic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988883360 5:35529561-35529583 GAGGGAAAGGTGGGTGAGGAGGG - Intergenic
988994158 5:36698296-36698318 ATGGGAAAGGGTGATGGGGATGG - Intergenic
989030099 5:37109951-37109973 ATAAGAAAGAAGGATGAGGCTGG - Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989367010 5:40667473-40667495 AAGGGAAAGGAGGAAGGGAAGGG - Intergenic
989384359 5:40839710-40839732 TTGGGACAGGAGGCTGAGGCAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989678691 5:44004619-44004641 AGGGGAAACGTGGAAGAGGAAGG + Intergenic
989778289 5:45234643-45234665 AGGTGAGAGGAGGGTGAGGATGG - Intergenic
989979161 5:50621653-50621675 AGGAGAAAGGAAGAAGAGGAAGG + Intergenic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
991777464 5:70099129-70099151 ATGGGAAAGGAGGTGGCTGAAGG - Intergenic
991856752 5:70974573-70974595 ATGGGAAAGGAGGTGGCTGAAGG - Intronic
992369678 5:76130045-76130067 GTGAGAAGGGAGGCTGAGGATGG - Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992636774 5:78732285-78732307 ATGGGAAAGGAGTATGAATGGGG - Intronic
992699576 5:79328503-79328525 ATGGGAGAGGAGTAAGGGGAGGG + Intergenic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
992949538 5:81844777-81844799 AAGGAAGAGGAGGTTGAGGAAGG + Intergenic
993104798 5:83587943-83587965 CTGAGAAAGTAGGATGAGAAGGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993362223 5:86991677-86991699 ACTGGAAAGGAGAATGATGAGGG - Intergenic
993407439 5:87529113-87529135 ATGGAAAAAGAGCATGAGAATGG + Intergenic
993840903 5:92877149-92877171 CTGGGAAAGGAGGAAGAGCATGG - Intergenic
994293231 5:98055388-98055410 CTGAGAAAGGAAGCTGAGGATGG + Intergenic
994329183 5:98486346-98486368 ATAAGAAAGGAGGATGGGGTGGG - Intergenic
994397857 5:99240961-99240983 TAGGGAAGGGAGAATGAGGATGG + Intergenic
994583260 5:101674751-101674773 ATAGGAAAGGAAGAGAAGGAAGG - Intergenic
994628556 5:102252121-102252143 AAGGGAAAGAAGGAAAAGGAAGG + Intronic
994638250 5:102370060-102370082 GGGGGAGAGGAGGGTGAGGATGG + Intergenic
994864774 5:105253331-105253353 ATGAGAAAGGAAAATGAGCATGG + Intergenic
995154820 5:108898541-108898563 AAGGGAAGGGAGGAAGGGGAGGG - Intronic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
996096429 5:119404067-119404089 GGGGGCAAGGAGGAAGAGGAGGG - Intergenic
996482428 5:123989988-123990010 CTGGGAGAGGAAGAAGAGGAGGG + Intergenic
996511950 5:124326376-124326398 AAGGGAGAGGAGGCTGGGGAGGG + Intergenic
996671872 5:126127505-126127527 ATGGGGAAGGAGTCGGAGGAGGG - Intergenic
996781127 5:127187686-127187708 ATAGGAAAGGTGGAGCAGGACGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998171237 5:139873033-139873055 AAGTGAGAGGAGGAGGAGGAGGG + Intronic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
998991582 5:147823220-147823242 AAGAGAGAGGAGGAGGAGGAGGG - Intergenic
999050947 5:148523378-148523400 ATGGGCAAGGAGGAATGGGAGGG + Intronic
999320981 5:150614923-150614945 ATGGCAAAGCAGGATGTGAATGG - Intronic
999329380 5:150662309-150662331 ATGGAACAGGAGGAAGAGAAGGG + Intronic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
1000190745 5:158908443-158908465 ATGGGAAAGGAAAAAGATGAGGG - Intronic
1000268949 5:159664726-159664748 GTGGAAAAGGAGCATGAGGGAGG - Intergenic
1000458428 5:161482081-161482103 ATGGGAAAGGAGTTTGAGACAGG - Intronic
1000584915 5:163085633-163085655 TGGGGAAAGGAACATGAGGAGGG - Intergenic
1000915432 5:167075424-167075446 TTGGGAAAGTAGGTAGAGGATGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001132958 5:169079713-169079735 AGGGAAGAGGAGGAGGAGGAGGG + Intronic
1001152840 5:169247240-169247262 ATGGAAAAGGAAGACGAGAAGGG - Intronic
1001249255 5:170133714-170133736 ATTAGAAAGGAGGCTGATGAAGG + Intergenic
1001317904 5:170657351-170657373 CTGGGAAATGAGGGTGAGGAGGG + Intronic
1001527896 5:172441715-172441737 GCGGGAAGGGAGGATGAGGCTGG - Intronic
1001690846 5:173631429-173631451 ATAGGAGATGAGGAGGAGGAGGG - Intergenic
1001861920 5:175063359-175063381 TTGGGAAAGGAGGCACAGGAAGG - Intergenic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1002065174 5:176648124-176648146 AAGGGAAAGGAGGCCGGGGAAGG - Intronic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1002555086 5:180030963-180030985 AGGGGGTAGGAGGAAGAGGACGG - Intronic
1002633892 5:180597785-180597807 GTGAGGAAGGAGGCTGAGGAAGG + Intergenic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003105943 6:3216016-3216038 AAGGAAGAGGAGGAAGAGGAGGG + Intergenic
1003145069 6:3503481-3503503 ATTGGGAAGGTGGAGGAGGAGGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003413350 6:5885725-5885747 ATGGAAAACGTGCATGAGGAGGG - Intergenic
1004002050 6:11604821-11604843 AGGGGAGAGGAGGAGGGGGAAGG + Intergenic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004292699 6:14382944-14382966 AAAGGAAAGGAAGAAGAGGAAGG - Intergenic
1004751596 6:18567516-18567538 GAAGGAAAGGAGGAGGAGGAAGG - Intergenic
1004915166 6:20325111-20325133 AAAGGAAAGGAGGAGGAGAAAGG + Intergenic
1005076308 6:21911298-21911320 ATGGGAGAGGAGGAAGAGCTTGG - Intergenic
1005803059 6:29446330-29446352 ATGGGATTGGGTGATGAGGAGGG - Intronic
1005828993 6:29655573-29655595 ATGGGAGATCAGGATGAGGGTGG - Intergenic
1006173757 6:32109725-32109747 ATGGGAGAGGAGCATGGGGGAGG - Intronic
1006303605 6:33206870-33206892 AAGGGAAAGGAGGGGGAGGTGGG - Intergenic
1006371409 6:33646233-33646255 AGGGGAAAGGAGGTTGAGTGAGG - Intronic
1006513156 6:34532438-34532460 CTGGGCGAGGAGGATGAGCAGGG + Exonic
1006520322 6:34567542-34567564 AAGGGAATGGAGGGTGAGGTGGG + Intergenic
1006938322 6:37733924-37733946 ACAAGAAATGAGGATGAGGATGG + Intergenic
1006951984 6:37830249-37830271 TGGGGCAAGGGGGATGAGGATGG + Intronic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007191823 6:40025822-40025844 ATGGGAGGGGAGCATTAGGAAGG - Intergenic
1007341527 6:41194066-41194088 AGGTGAAAGGAGGATCAGGAAGG - Intronic
1007380858 6:41489162-41489184 AGGGGAAAGGGGGTTGAGGAAGG - Intergenic
1007421470 6:41722420-41722442 ATGGGAGAGGAGGAGGATGGAGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007874417 6:45079467-45079489 AGGGGAAAGGAGGAGGAAGGAGG + Intronic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008370374 6:50724127-50724149 ATGGGGGAGGAGGGTTAGGAAGG + Intronic
1008497208 6:52145468-52145490 ATGGGAGAGGAGGAAAGGGAGGG + Intergenic
1008501457 6:52187570-52187592 ATGGGAAAGGAGAGAGAGGTTGG - Intronic
1008793952 6:55277068-55277090 TTGGGAAAGGAGAATGATAAAGG - Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009788509 6:68369240-68369262 ATGGGAAAGGGAGATGAGAAGGG + Intergenic
1010250065 6:73697841-73697863 ATGGGAGAAGGGGAAGAGGATGG + Intronic
1010381969 6:75235859-75235881 GTGGGATGGGTGGATGAGGAAGG + Intergenic
1010524413 6:76882759-76882781 AAGGGAAAGGTGGAAGAGGGAGG - Intergenic
1010906045 6:81490376-81490398 ATGGGAGAGGAAGCTGAGCAGGG + Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011659451 6:89581716-89581738 TTCGGAATGGAGGATGGGGAAGG - Intronic
1011798438 6:90982949-90982971 ATGGGGAAGGATGAAAAGGAGGG - Intergenic
1012271841 6:97222695-97222717 ATGAAAAAGGGGGATGGGGAGGG + Intronic
1012383680 6:98652059-98652081 AATGGAAATGAGGATGAGCAAGG + Intergenic
1012390213 6:98729669-98729691 ATGAGCAAGGAGGATTGGGAAGG + Intergenic
1013036301 6:106387330-106387352 AGGGAAAAGGAAGCTGAGGAAGG + Intergenic
1013287548 6:108694002-108694024 ACAGGAGAGGAGGAGGAGGAAGG - Intergenic
1013360852 6:109392665-109392687 ACAGGAAAGGAAGATGGGGAGGG + Intronic
1013670456 6:112396702-112396724 ATAAGAAAGGAGAATGAGGTTGG - Intergenic
1014323144 6:119957296-119957318 GTGGGAAAAGAGGAACAGGAAGG + Intergenic
1014494367 6:122102254-122102276 AAGAGAAAGGAGGAGGAGAAAGG + Intergenic
1014913316 6:127118621-127118643 ATAGGGGAGGAGGAGGAGGAGGG - Exonic
1014914966 6:127135559-127135581 ATTGGAGAAGAGGATAAGGAGGG + Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015198609 6:130552738-130552760 GTGTGAAAGGATCATGAGGAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015427597 6:133090080-133090102 ATGGCAAAGGAGTAAGAAGAGGG + Intergenic
1015477514 6:133670355-133670377 ACAAGAAAGGAGGAGGAGGAGGG - Intergenic
1015626163 6:135182293-135182315 GAGGGAGAGGAGGAGGAGGAGGG + Intronic
1015726608 6:136305994-136306016 AGGGGAGAGGAGGAAGAGGATGG - Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016492919 6:144627153-144627175 ATGGGATAGGAGGGTGGGGTGGG + Intronic
1016509138 6:144820147-144820169 ATGGGATAGGATGATGGGGTGGG + Intronic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017315702 6:153028587-153028609 ATGGGAAAAGTGGATGGGGGGGG + Intronic
1017822949 6:158061935-158061957 GAGGGAAGGGAGGACGAGGAGGG - Intronic
1018048240 6:159983903-159983925 ATGGGAAGAGAGGTTGTGGAAGG + Intronic
1018176542 6:161183025-161183047 ATGGGAGAAGAGGATGAGGAAGG + Intronic
1018298663 6:162376854-162376876 AGGGGAAAGGGGGAGGAAGAGGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018613119 6:165662399-165662421 AGGTGAAAGGCAGATGAGGAGGG + Intronic
1018683026 6:166280566-166280588 CAGGGAGAGGAGGATGAGGGTGG - Intergenic
1018783821 6:167092745-167092767 ATGGGAAGCGAGGCTGGGGACGG + Intergenic
1018792336 6:167158007-167158029 TTGGGGAAAGAGGATGAGCAGGG + Exonic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019159073 6:170057611-170057633 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019159097 6:170057658-170057680 AAGGGAAAGGGGGAGGGGGAGGG - Intergenic
1019287273 7:229983-230005 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1019419071 7:942360-942382 AAGAGAGAGGAGGAGGAGGAAGG + Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1020050332 7:5077059-5077081 ATGGGAAAGGAAGAAAAGGAAGG - Intergenic
1020061519 7:5155992-5156014 AGGGCAAAGGAGGGTGAGGCTGG + Intergenic
1020166638 7:5812668-5812690 AGGGCAAAGGAGGGTGAGGCTGG - Intergenic
1020473199 7:8563512-8563534 ATAGGAAAGGAGGATGCAGAAGG + Intronic
1020506332 7:8993380-8993402 ATGGGAAAGGAGACTGACTAGGG - Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1020814030 7:12882280-12882302 TTTGGGAAGGAGGTTGAGGAAGG + Intergenic
1021128263 7:16880067-16880089 AGGGGAAAGAAGGAAGGGGAAGG - Intronic
1021576262 7:22108721-22108743 ATGGGAAAAAAGGGTGAAGAAGG + Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021833495 7:24642906-24642928 ATAGGAAAGGAGGATGGGTTGGG + Intronic
1021919465 7:25469925-25469947 ATAGGAAAGTAGGAAGAAGAGGG - Intergenic
1022466507 7:30656030-30656052 ATGGGAAAGAGGGAAAAGGAAGG + Intronic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023098787 7:36691522-36691544 AATGGAAAGGAGGAAAAGGAAGG + Intronic
1023214112 7:37842667-37842689 ATGGAAATGTAGGATGAGTATGG - Intronic
1023383898 7:39635621-39635643 AGGGGAAATGGGGAGGAGGATGG + Intronic
1023420991 7:39979598-39979620 ATGGAAGAGGAGGATGTGGTAGG + Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024157614 7:46640592-46640614 ATGGGAAGGATGGCTGAGGAGGG + Intergenic
1024522864 7:50322291-50322313 ATGGGAAAAGAGGATGATTTAGG - Intronic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025035985 7:55592717-55592739 AGGGGAAAGGATGAAGAGGTTGG + Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026162781 7:67884417-67884439 ATGGGATAGGATGAAGAGCATGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026324721 7:69299163-69299185 AAGGGAGAGGAGGAAGAGAAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026772391 7:73210838-73210860 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026821146 7:73549928-73549950 GAGGGACAGGAGGAAGAGGATGG + Intronic
1026849132 7:73714060-73714082 ATGGGAGAAGAGGAGGAAGATGG - Intronic
1027013259 7:74764237-74764259 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1027074781 7:75181797-75181819 ATGGGGAAAGAGGAAGGGGACGG - Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027888086 7:83935261-83935283 ATGGGAAACGAGGGTTAGGTGGG + Intergenic
1027900657 7:84110130-84110152 ATGGAAAAGGAGGAGAAGGCTGG + Intronic
1028022759 7:85797358-85797380 CTGGGAAGGGAAGGTGAGGATGG + Intergenic
1028164755 7:87525700-87525722 AAGGAAAAGGAGGAAGAAGAGGG + Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028562929 7:92195299-92195321 ATGGGAAATAAGGAAGAGGTAGG - Intergenic
1028628298 7:92903246-92903268 TTGGGAATGGTGGATGCGGAGGG + Intergenic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028705475 7:93839915-93839937 TTGGGGAAGGAGGATCATGAGGG + Intronic
1028941541 7:96527178-96527200 ATGAGAAAGGAGGATGGCGGAGG + Intronic
1029071809 7:97905647-97905669 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1029221803 7:98995932-98995954 ATGGGACGGGAGTGTGAGGACGG - Intronic
1029221814 7:98995970-98995992 ATGGGATGGGGGTATGAGGATGG - Intronic
1029238458 7:99142910-99142932 ATGGGAAGCGAGGAGAAGGAGGG + Intronic
1029514137 7:101015565-101015587 GTAGGCAAGGAGGCTGAGGAGGG - Intronic
1029571990 7:101376052-101376074 TTGGGAGAGGAGGCTGAGGTGGG + Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029729955 7:102433019-102433041 AGGGGAAAGGAAGGTGGGGAGGG - Intergenic
1029812603 7:103064463-103064485 ATGGGAAAGGAAGAAGAAAAGGG + Intronic
1029843711 7:103391963-103391985 TTTGGAAAGGAGGCTGAGCAGGG - Intronic
1030021431 7:105278767-105278789 AGGGGAAAGGAGAAAGGGGAAGG + Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030676708 7:112392317-112392339 ATTGGAAGAGAGGATCAGGAAGG - Intergenic
1030800302 7:113841992-113842014 ATGGGCACAGAGCATGAGGAGGG - Intergenic
1030869084 7:114733522-114733544 ATGGGGAGGGAGGAGGAGAAGGG + Intergenic
1030994034 7:116335974-116335996 ATTGGAAAGAAGGATCAGGGAGG + Intronic
1031280609 7:119795635-119795657 AAGGGAAGGGAAGATTAGGAAGG - Intergenic
1031349556 7:120713034-120713056 AAGGGAAAGGAGGCTTAGCAAGG - Intronic
1031504551 7:122565299-122565321 ATGGGAAAGGAAGATGGACAGGG + Intronic
1031628555 7:124019119-124019141 AGAGGAGAGGAGGAAGAGGAGGG - Intergenic
1031733202 7:125323260-125323282 TGGGGAGGGGAGGATGAGGAGGG - Intergenic
1031866131 7:127039989-127040011 AAGGGAGGGGAGGGTGAGGAGGG + Intronic
1031926909 7:127647654-127647676 ATGGGAAAGAAGGAAGGGGGAGG + Intergenic
1032151010 7:129429759-129429781 ATGGGCAAGTAGGATAGGGAGGG - Exonic
1032165214 7:129539922-129539944 ATAGGAGAGAGGGATGAGGAGGG + Intergenic
1032179698 7:129664124-129664146 ACGGGAAAGGGGGAGGGGGAGGG + Intronic
1032345306 7:131110714-131110736 TTGGGGAAGGAGGATGGTGAGGG - Intronic
1032466876 7:132151571-132151593 AGGAGAAAGGAGGAGGAGAAAGG + Intronic
1032489645 7:132314549-132314571 TAGGGAAGGGAGGAAGAGGAAGG + Intronic
1032626928 7:133601564-133601586 GTGGGAAAGGAACATGAAGATGG - Intronic
1032746312 7:134790130-134790152 AGGGAAAAGGGGGAAGAGGAGGG + Intronic
1032948713 7:136882427-136882449 AGGGGGAAGGAGGAGGAGAAAGG - Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033415627 7:141158957-141158979 AAGGGAAATGAGGAAGAGGTTGG + Intronic
1033435439 7:141329382-141329404 ATGGGAAAGAATAATGAGAATGG - Intronic
1033442828 7:141395768-141395790 ATGGGAGAGAAGGATGGGCATGG + Intronic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034220009 7:149436724-149436746 ATGGGACAGGTGGAAGAGCACGG - Exonic
1034264255 7:149773516-149773538 ATGGGAGAGGGGGTGGAGGAGGG + Intergenic
1034348343 7:150400594-150400616 ATGGGAAAGGAGGGTGGGGGTGG + Intronic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035329089 7:158084884-158084906 ATGGGCATCGAGGATGTGGATGG - Intronic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036245889 8:7116350-7116372 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1036254899 8:7198116-7198138 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1036362588 8:8089391-8089413 ATGGGAAAGGCAGAGGAAGAGGG + Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1036812672 8:11878355-11878377 GTAGGCAATGAGGATGAGGAGGG + Intergenic
1036895974 8:12635780-12635802 ATGGGAAAGGCAGAGGAAGAGGG - Intergenic
1036938617 8:13030235-13030257 ATAGAAAAGGAGCATGAAGATGG - Intronic
1037218336 8:16485295-16485317 ATGGAAATGGTGGATGAGGTGGG - Intronic
1037394155 8:18424362-18424384 ATGGGACAGGAAAATGAGGTGGG + Intergenic
1037568085 8:20134690-20134712 AGGGGAGAGGAGGAAGAAGAAGG + Intergenic
1037674127 8:21039690-21039712 AAGGGAAAGATGGATGGGGATGG - Intergenic
1037760410 8:21738159-21738181 ACGGGGGAGGGGGATGAGGAGGG - Intronic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1037901722 8:22692729-22692751 AGGGGAGAGGAAGAGGAGGAGGG - Intronic
1038072265 8:24030242-24030264 ATGAGAAGTGAGGATGAAGAGGG + Intergenic
1038161364 8:25042162-25042184 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1038171199 8:25134458-25134480 ATGGGAAAGGTGGACAGGGAAGG + Intergenic
1038304924 8:26391323-26391345 TTGTGGATGGAGGATGAGGATGG - Exonic
1038390922 8:27200092-27200114 ATGGAAATGGATGAAGAGGAAGG - Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038701732 8:29855489-29855511 GAGGGCAAGGAGGATGAGAAAGG - Intergenic
1038766276 8:30431073-30431095 ATGGGAGAGGAGGAAGATGTGGG + Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039248159 8:35632417-35632439 ATGGTTATGGAGGCTGAGGAAGG + Intronic
1041192730 8:55369437-55369459 AAGGGAAAGGAGGAACGGGAGGG + Intronic
1041250981 8:55934773-55934795 TTGGGAAAGGGGGGTGAGGTGGG - Intronic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041646019 8:60253511-60253533 ATGGGAAAAAAAGATGTGGATGG - Intronic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1041746160 8:61211358-61211380 AAGGGAAAGAAGGAGAAGGAGGG - Intronic
1041755134 8:61305312-61305334 GTGGGAAGGGAGGATGAAGGGGG - Intronic
1041898557 8:62955492-62955514 ATGTGATAAGAGGATGATGAAGG + Intronic
1042148165 8:65754389-65754411 ATGGGAAAGGAGGTATATGATGG - Intronic
1042241375 8:66667385-66667407 AGAGGAGAGGAGGAAGAGGACGG + Intergenic
1042322750 8:67495246-67495268 ATGGGAATGGAAGAGGAGGATGG - Intronic
1042785666 8:72544268-72544290 ATGGGAGACGAGGCTGAAGAAGG + Intronic
1042817397 8:72892427-72892449 ATGGGAAAAAAGGATGAAGTAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042865227 8:73350903-73350925 ATGGGAATGGAGGAGGAGATAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043520733 8:81042642-81042664 AAGAGAAAGGGGGGTGAGGAAGG + Intronic
1043750603 8:83929263-83929285 AAGGGAAAGGAAGAGCAGGAAGG - Intergenic
1043935437 8:86137159-86137181 AAGGGAAAGGGAGAAGAGGATGG - Intronic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044729042 8:95215654-95215676 ATGGGAGGGAAGGATGGGGAAGG - Intergenic
1044914360 8:97096709-97096731 ATGGCAAAGGAGTAAGATGAAGG + Intronic
1044953159 8:97452940-97452962 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045016681 8:98006788-98006810 ATGGGAAAGAAGGCTGGGCATGG + Intronic
1045085404 8:98677528-98677550 AAGACAAAGGAGGAAGAGGAAGG + Intronic
1045543688 8:103109546-103109568 CTGGGAAGGAAGGATGAAGAAGG + Intergenic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045905373 8:107338447-107338469 GTGGAACAGGAGGGTGAGGAGGG + Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046395246 8:113632635-113632657 ATGGGAAGAGAGGATGGAGAGGG - Intergenic
1046555487 8:115768460-115768482 AAGGGAAGGGAGGAAGAGAAGGG - Intronic
1046555503 8:115768517-115768539 AAGGGAAGGGAGGAAGAGAAGGG - Intronic
1046632531 8:116635587-116635609 AGGGAAGAGGAGGAGGAGGAGGG - Intergenic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1046855766 8:119030009-119030031 AGGCCAAAGGAGGATGAGTAGGG - Intronic
1046936471 8:119889638-119889660 AGGGGAGGGGAGGATGGGGAGGG + Intronic
1047042424 8:121011205-121011227 ATAGGAAAGGATGAAGAAGATGG - Intergenic
1047371122 8:124256937-124256959 AAGGGGAAGGAGGATGAGTCTGG - Intergenic
1047489596 8:125363595-125363617 AGGAGAAAGGAGGAGGGGGAGGG + Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047622550 8:126622756-126622778 AAGGGAAAGGATGATGGGCAGGG - Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048201441 8:132377496-132377518 AAGGGGCAGGAGGATGAGGCTGG + Intronic
1048248818 8:132840260-132840282 ATGGGAAGGGAAGGAGAGGATGG - Intronic
1048302595 8:133262501-133262523 ATGGAAAGAGAGGATCAGGAGGG - Intronic
1048362031 8:133705775-133705797 ATTGGAAAGGCTGGTGAGGAGGG + Intergenic
1048363846 8:133721128-133721150 ATGGGAAAGGAAGAGGTGGGCGG + Intergenic
1048381651 8:133870647-133870669 AGCTGAAAGGAGGGTGAGGAAGG - Intergenic
1048861234 8:138725526-138725548 AGGGGACAGGAGGATGAGGTGGG + Intronic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049119898 8:140726204-140726226 TGGGGAGAGGAGGAAGAGGAAGG + Intronic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049361048 8:142212781-142212803 ATTGGAGAGAAGGAGGAGGAGGG - Intronic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050078642 9:1891418-1891440 ATGGCAACTGAGGCTGAGGATGG + Intergenic
1050143093 9:2537263-2537285 GTGCTAAAGGAGCATGAGGATGG + Intergenic
1050151359 9:2622065-2622087 AGGGGAAAGGGGGAGAAGGAGGG - Exonic
1050603608 9:7277827-7277849 ATGGGATGGGGGGATGAGGGAGG - Intergenic
1051148775 9:14058492-14058514 ATGGCAGAGGAGGAGAAGGAGGG + Intergenic
1051604765 9:18908419-18908441 CTGGGAAAGGAGGACGGGGTCGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052370865 9:27663173-27663195 AAGGGAAAGGAGGATGGGGGAGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052594007 9:30536120-30536142 ATGGGAGGGGAGGGTGGGGAGGG - Intergenic
1052654287 9:31335284-31335306 ATGAGAAGGGAAGCTGAGGAAGG - Intergenic
1052756241 9:32545300-32545322 ATGGGAAAGGATAATAGGGAAGG - Intronic
1053017007 9:34667616-34667638 CTGGGAAAGGAAGGAGAGGAAGG + Intergenic
1053209031 9:36211958-36211980 GAGGGAGAGGAGGAAGAGGAAGG + Exonic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054752551 9:68922606-68922628 AAGGGAAAGGAGGTGGATGAAGG - Intronic
1054822609 9:69538536-69538558 ATAGGAAAGGAAGTTGGGGATGG - Intronic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055402847 9:75942754-75942776 ATAGGAAAAGAGTATGATGAGGG + Intronic
1056239742 9:84632567-84632589 ATAGCAAAGGGAGATGAGGAGGG - Intergenic
1056513629 9:87329454-87329476 ATAGGAAAGGAGGAGAAGGAAGG - Intergenic
1056743989 9:89284051-89284073 ATGGAAAAGGAGGTTGAGAAGGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057226845 9:93297022-93297044 AGGTGAAAGGAGGATGCTGAGGG - Intronic
1057713972 9:97474056-97474078 ATGGGTAAGGAGGAAGATGAAGG - Intronic
1057775198 9:98002174-98002196 GTGGTTAATGAGGATGAGGATGG - Intronic
1057897969 9:98924744-98924766 TTGGGAAAGGAGGGGGAGGGAGG + Intergenic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058144969 9:101400420-101400442 ATGGGGAAGGAGGAGGATGTGGG - Intronic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059228521 9:112695766-112695788 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1059415537 9:114160052-114160074 ATTGGAGAGGATGAAGAGGAAGG + Intronic
1059423214 9:114205621-114205643 ATGGAACAGGAGGAAGGGGAGGG - Intronic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059745035 9:117191933-117191955 ATGGAAAAGGATCATGAGGGAGG + Intronic
1060196283 9:121625635-121625657 ATGGGATGGCAGGATCAGGAGGG + Intronic
1060291442 9:122306813-122306835 ATGAGAAAGGAGGTTAAGGTCGG - Intronic
1060765351 9:126291650-126291672 GTGGGGAAGAAGGATCAGGAGGG - Intergenic
1060994993 9:127870824-127870846 ATGGGAATGGGGCATGGGGATGG + Intronic
1061189168 9:129071633-129071655 ATGGGAAAGGGGTCTGGGGATGG + Exonic
1061370146 9:130193363-130193385 ATGGGAAAGTGGGATGGGGTGGG + Intronic
1061433032 9:130543222-130543244 AGGGCAGAGGTGGATGAGGATGG + Intergenic
1061544565 9:131297027-131297049 CTGAGAAAGGAGGCTGGGGAGGG - Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061657889 9:132106794-132106816 ATGGCAAAGGCGGAAGAGCAAGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061764818 9:132875069-132875091 AGGGGAAGGGAAGACGAGGAGGG + Intronic
1061798930 9:133103842-133103864 TTGGGGTAGGAGGATGAGCAAGG + Intronic
1061832239 9:133303550-133303572 ATGGGAGAGGAAGGTGAGGCTGG - Intergenic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062151653 9:135022445-135022467 ATGAGAAAGGCCGAGGAGGAAGG - Intergenic
1062190918 9:135247434-135247456 AGGGGAGTGGAGGAAGAGGAGGG + Intergenic
1062236889 9:135514651-135514673 ATGGGAGAGGAAGGTGAGGCTGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062483237 9:136762132-136762154 ATGGGAAGGGAGGGAGAGGCTGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1185611580 X:1396498-1396520 TTGGGAAAGGAGGATCAGGTGGG + Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185727636 X:2435134-2435156 ACGGGAGAGGAGGTTGAGGTAGG + Intronic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1185928742 X:4176308-4176330 ATGGGAATGGGGGATGAGGGAGG + Intergenic
1186039917 X:5464393-5464415 ATGAGAAAGGAAGAACAGGAAGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186423959 X:9448960-9448982 AGGGGAAAGGAGGGAAAGGAAGG - Intergenic
1186465124 X:9779091-9779113 CTGAGAGAGGAGGCTGAGGATGG - Intronic
1186498572 X:10032267-10032289 ATGGGCCAGGAGGAGGATGATGG + Intronic
1186576805 X:10775339-10775361 ATTGGAAAGAAGGAGGAAGATGG + Intronic
1186659422 X:11653967-11653989 ATGGGTGAGGATGATGATGATGG - Intronic
1186761742 X:12730211-12730233 ATGGGGCAGGAGGATGAGGTGGG + Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187025729 X:15433863-15433885 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025761 X:15433998-15434020 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025765 X:15434018-15434040 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025774 X:15434061-15434083 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025780 X:15434081-15434103 AGGAGAAAGGAGGAGGAGGGAGG + Intronic
1187025785 X:15434101-15434123 AGGAGAAAGAAGGAGGAGGAGGG + Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187753866 X:22498153-22498175 GTAGGAAAGGAAGATGAGGTTGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188172437 X:26943910-26943932 AGTGGAAAGTAGGAGGAGGAGGG + Intergenic
1188260479 X:28016930-28016952 ATGGGATAGGTGGCTGTGGAAGG + Intergenic
1188730894 X:33645456-33645478 AAGAAAAAGGAGGATGAGAAAGG + Intergenic
1189129808 X:38485887-38485909 GTGGGAAAGGAGGGTGGTGAGGG - Intronic
1189207503 X:39254437-39254459 CTAGAAAAGGAGGAGGAGGATGG + Intergenic
1189286099 X:39853580-39853602 ATGGAAAGGGGGGAAGAGGAGGG + Intergenic
1189332149 X:40151011-40151033 AGGGGAAAGGAGGCTAAGGCTGG + Intronic
1189720350 X:43909653-43909675 TTGGGCCAGGAGGATCAGGAAGG - Intergenic
1189846419 X:45142769-45142791 ATTGGAAATGAGCATGTGGAAGG + Intergenic
1189984663 X:46543622-46543644 ATGGGAAAGGAGGAAGTGGTGGG - Intronic
1190393707 X:49958120-49958142 ATTAGAAATGAGGAGGAGGAAGG - Intronic
1190916997 X:54818340-54818362 GTGGGAAGGGAGGAAGAGGCGGG - Intergenic
1191867828 X:65719816-65719838 ATGGCTGTGGAGGATGAGGAAGG + Intronic
1191896460 X:65998337-65998359 AAAGGAAAGTAGGATGGGGAGGG - Intergenic
1191912341 X:66164293-66164315 CTGGGATGGGAGGATGAGGGAGG - Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192140170 X:68640099-68640121 ATGGGAAACTAGAATGAGAAAGG - Intergenic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192327734 X:70147452-70147474 AGGGGAAGAGAGGAAGAGGATGG + Intronic
1192435610 X:71141817-71141839 TTGGGAAAGGAGGTTGAAGAAGG + Intronic
1192594622 X:72393671-72393693 TGGGAAAAGGAGGATGGGGAGGG + Intronic
1192673159 X:73167637-73167659 CTGGGAAAGGAGGCTGAGTGGGG + Intergenic
1192787344 X:74348073-74348095 ATGGGAAAAGGGGGTGAGGGTGG - Intergenic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1193268647 X:79504288-79504310 TTGGGAAAAGAGATTGAGGAAGG + Intergenic
1193291603 X:79779580-79779602 AAGGAAAAGGAGGAAAAGGAGGG - Intergenic
1194135517 X:90135781-90135803 AGGAGAAAGGAGGAAAAGGAAGG + Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1194719330 X:97322426-97322448 AAAGGAAATGAGGATGGGGAAGG + Intronic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195158913 X:102152465-102152487 CTGGGAGAAGGGGATGAGGAAGG + Intergenic
1195374560 X:104214097-104214119 AGGGGAAGAGAGGATGAGGGAGG + Intergenic
1195679001 X:107529804-107529826 AGGCGAAAGGAGGACGAGGAAGG - Intronic
1195689328 X:107610927-107610949 TTTAGCAAGGAGGATGAGGATGG - Intergenic
1195769884 X:108339364-108339386 AAAGGAAAGGAGGATGAAAAGGG - Intronic
1196083367 X:111657601-111657623 ATGAGAAAGGAGGAGGAGAGAGG - Intergenic
1196119744 X:112036984-112037006 ATGGGAAAGGAAATTGAGCAAGG + Intronic
1196409716 X:115402698-115402720 AGGGGAAAGGATGGTGGGGAGGG - Intergenic
1196733967 X:118968581-118968603 AGGGGAACTGAGGATGAGGTAGG + Intergenic
1197138506 X:123090437-123090459 GTGGGAAAGGTGGATAAAGAAGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197673687 X:129307373-129307395 AAGAGAAGGGAGGATGAGAAAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198054399 X:132979402-132979424 ATGGGAAAAGGGGGTAAGGAAGG + Intergenic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198383383 X:136105083-136105105 AAGGAAAAGGAGGAAGGGGAGGG + Intergenic
1198928938 X:141831341-141831363 CTTGGAAATGAGGATGGGGAAGG - Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199453686 X:148002763-148002785 GTGAGAAAGAAGGATAAGGAAGG + Intronic
1199527695 X:148810882-148810904 CTGGGAGAGGGGGATCAGGAGGG - Intronic
1199715752 X:150506336-150506358 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1200045101 X:153396949-153396971 CCGGAAAACGAGGATGAGGATGG - Intergenic
1200481283 Y:3705862-3705884 AAGAGAAAGGAGGAAAAGGAAGG + Intergenic
1200754053 Y:6973239-6973261 ATGGGGGAAGATGATGAGGAGGG - Intronic
1200776314 Y:7173120-7173142 ATGGTAAAGGACCTTGAGGATGG - Intergenic
1201146480 Y:11067715-11067737 AGAGGAAAGGAGGGAGAGGAAGG + Intergenic
1201258285 Y:12132144-12132166 AAGGAAAAGGAGGGAGAGGAAGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic