ID: 1079435514

View in Genome Browser
Species Human (GRCh38)
Location 11:20443769-20443791
Sequence CAAAAGACTGACAGTCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079435514_1079435515 5 Left 1079435514 11:20443769-20443791 CCAATTTGACTGTCAGTCTTTTG 0: 1
1: 0
2: 2
3: 25
4: 342
Right 1079435515 11:20443797-20443819 TAAGTGAGAGTGCCATCCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 104
1079435514_1079435516 6 Left 1079435514 11:20443769-20443791 CCAATTTGACTGTCAGTCTTTTG 0: 1
1: 0
2: 2
3: 25
4: 342
Right 1079435516 11:20443798-20443820 AAGTGAGAGTGCCATCCAGTGGG 0: 1
1: 0
2: 1
3: 21
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079435514 Original CRISPR CAAAAGACTGACAGTCAAAT TGG (reversed) Intronic
902976382 1:20091498-20091520 AAAGAGACTGAAAGTCAAAGAGG - Intergenic
903398199 1:23019095-23019117 CAAAGAACTTACAGTCTAATGGG - Intergenic
904981756 1:34509489-34509511 CAACAGACTGACAGATACATTGG - Intergenic
906223474 1:44102062-44102084 CAAAAGAGTGGAAGTCAAAATGG + Intergenic
907483596 1:54761268-54761290 GAGAAGACAGACAGCCAAATGGG - Intronic
907989704 1:59567770-59567792 CCACAGACTCACAGTCAAACTGG + Intronic
908894120 1:68879734-68879756 TAAAAGACAGACTGGCAAATTGG - Intergenic
909403527 1:75260216-75260238 TAAAAGACAGACTGGCAAATTGG + Intronic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
910071559 1:83220527-83220549 TAAAAGAATGCCAGTCATATTGG + Intergenic
911128307 1:94362286-94362308 CAAATGAATAAAAGTCAAATTGG - Intergenic
912200601 1:107453371-107453393 CCAGAAACTGACAGTCAAAAAGG + Intronic
912776138 1:112507682-112507704 CCAAAGACTGACAGTGAATTTGG + Intronic
912976591 1:114336553-114336575 CAGAAGGATGACAGACAAATGGG + Intergenic
913327080 1:117636641-117636663 AAAAAAAATGACAGGCAAATCGG - Intergenic
913931063 1:124965393-124965415 CAAAAGACAGAAAGTCAACAAGG - Intergenic
916548572 1:165828507-165828529 TAAAAGTCTGAGAGCCAAATAGG + Intronic
917406177 1:174710858-174710880 TAAAAGACAGACTGGCAAATTGG + Intronic
917471911 1:175332940-175332962 CAAAAGACTGAGATTAAATTTGG - Intronic
917585951 1:176426380-176426402 CAAAAGCCTGAAAGCCAAAATGG + Intergenic
919135113 1:193497844-193497866 CAAAAATCTCACAGTGAAATAGG + Intergenic
919311433 1:195915422-195915444 CATAAGAATGACACTTAAATTGG - Intergenic
920981851 1:210844210-210844232 CATAAAACTGGCATTCAAATAGG + Intronic
920993632 1:210965059-210965081 TAAAAAACTGTCAGTCAACTAGG + Intronic
921150009 1:212392629-212392651 TAAAAGACAGACTGGCAAATTGG + Intronic
922559229 1:226556354-226556376 CAAGAAGCTGACAGTCTAATGGG + Intronic
923483138 1:234403539-234403561 CATGTGACTCACAGTCAAATGGG - Intronic
1063324769 10:5087021-5087043 TAAAAGACAGACTGGCAAATTGG - Intronic
1063745676 10:8877880-8877902 TAAAAAACTCACAATCAAATAGG + Intergenic
1067074664 10:43169805-43169827 CAAAGGAGTGACAATCAGATTGG + Intronic
1067358218 10:45550999-45551021 GATAAGACTGACATTTAAATTGG + Intronic
1067818659 10:49506146-49506168 CAAAACACTGATATTCAAAGAGG + Intronic
1068093428 10:52460622-52460644 CAGAAGGCTGACCTTCAAATGGG + Intergenic
1069199098 10:65591044-65591066 TAAAAGACAGACTGGCAAATTGG - Intergenic
1070007374 10:72437587-72437609 TAAAAGACAGACTGGCAAATTGG + Intronic
1071916956 10:90303616-90303638 ATTAAGACTGACAGTCAAAGAGG + Intergenic
1072501370 10:96021437-96021459 TAATGCACTGACAGTCAAATTGG - Intronic
1073437167 10:103525639-103525661 CAAAAGACTTACAGTCACGATGG - Intronic
1073494603 10:103879817-103879839 CAAAAGACTTGCAGACAGATTGG + Intergenic
1073631149 10:105150479-105150501 AAAAGGACTGACAGTCAGAGTGG - Intronic
1074053598 10:109901771-109901793 CATAAGACTGACAGTTGAAAAGG - Intronic
1074730609 10:116370028-116370050 CAAAAGCCTGATAGAAAAATGGG - Intronic
1075847542 10:125556930-125556952 CAAAAGACAGACAATTAAATGGG + Intergenic
1077591665 11:3496907-3496929 TAAAAGACAGACTGGCAAATTGG - Intergenic
1077884343 11:6375030-6375052 CAAAAGACAGAAAATCAAACTGG + Intergenic
1078471212 11:11588263-11588285 CAAAAAGCTCACAGTCCAATAGG - Intronic
1078560614 11:12368131-12368153 TAAAAGACAGACTGGCAAATTGG + Intergenic
1079435514 11:20443769-20443791 CAAAAGACTGACAGTCAAATTGG - Intronic
1079797673 11:24826371-24826393 CAATTCACTGACAGTCAATTCGG - Intronic
1080046627 11:27815445-27815467 CAAAGAACTGACAGTCTAGTGGG + Intergenic
1080097371 11:28425108-28425130 CAGAAGACTGAGAGGCAGATGGG + Intergenic
1080373717 11:31682917-31682939 CAAGAAACTTACCGTCAAATGGG - Intronic
1080864193 11:36178903-36178925 CAAGACACTTACAATCAAATTGG - Intronic
1080906082 11:36546529-36546551 TAAAAGACAGACTGGCAAATTGG - Intronic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081424212 11:42907183-42907205 CAAGAGGCTCACAGTCTAATGGG + Intergenic
1081593145 11:44439501-44439523 TAAAAGACAGACTGGCAAATTGG + Intergenic
1081951762 11:47050394-47050416 CATAGAACTGACAGTCTAATAGG + Intronic
1084247501 11:67869626-67869648 TAAAAGACAGACTGGCAAATTGG - Intergenic
1084368724 11:68722223-68722245 CAAAAGAAAGAAAGTAAAATAGG + Intronic
1084825327 11:71725873-71725895 TAAAAGACAGACTGGCAAATTGG + Intergenic
1086222634 11:84467882-84467904 CAAAAGACTGATAATTCAATAGG + Intronic
1086654865 11:89341647-89341669 TAAAAAACTTACATTCAAATGGG - Intronic
1087564730 11:99839956-99839978 CATAAGACTGAAAGTTAAAAAGG + Intronic
1087952999 11:104248118-104248140 CAAAAAACTGACAATAAATTAGG + Intergenic
1088197916 11:107295882-107295904 TAAAAGACAGACTGGCAAATTGG + Intergenic
1089241021 11:117079512-117079534 CATGAGACTTACAGTCAAGTAGG + Intronic
1091084824 11:132711325-132711347 CAAAAGAATGACATTCAATAGGG + Intronic
1091717782 12:2792190-2792212 CAAAAGACTGAAATGCATATAGG - Intergenic
1091765254 12:3115973-3115995 AAAAAGACAGACAGTAAAAAGGG - Intronic
1091786088 12:3244225-3244247 CAAGAGACTGCCAGCCACATGGG + Intronic
1092417780 12:8305016-8305038 TAAAAGACAGACTGGCAAATTGG - Intergenic
1093313027 12:17615823-17615845 CATAAGAGTGACTGTGAAATGGG + Intergenic
1095158225 12:38884686-38884708 AAAAAGACTGACAATAACATTGG - Intronic
1095210765 12:39491901-39491923 CAAAAGACAGAGAGTCATTTCGG - Intergenic
1095708649 12:45265032-45265054 TAAAAGACTTACAGTCAATGAGG - Intronic
1095710156 12:45279574-45279596 CAAAAGAATTACGGTGAAATGGG - Intronic
1098143415 12:67473910-67473932 CACAGAACTTACAGTCAAATGGG + Intergenic
1098270738 12:68767710-68767732 CAAGAGACTGACTGACAAACTGG - Exonic
1098934924 12:76467644-76467666 AAAAAGACTGAATGTGAAATAGG - Intronic
1100037254 12:90267550-90267572 AAAAACACTAACAGTCTAATAGG + Intergenic
1100126831 12:91437043-91437065 CCAAAGACAGACAGACACATGGG - Intergenic
1100768903 12:97899518-97899540 CAGATGACTGACAGACAAGTAGG + Intergenic
1101041872 12:100763573-100763595 CAAATGGCTGACTTTCAAATGGG + Intronic
1101607251 12:106257014-106257036 CATAAGGATAACAGTCAAATTGG + Intronic
1105852078 13:24344024-24344046 TAAAAGACAGACTGGCAAATTGG + Intergenic
1106633441 13:31501695-31501717 AAAAAGACTTTCAGTCAAAATGG + Intergenic
1107847138 13:44526631-44526653 GAAAATACTGTCAGTCAAAAAGG + Intronic
1108264582 13:48693702-48693724 AAAAAGAGTGACATTAAAATTGG + Intronic
1109440290 13:62361902-62361924 CAAGTAACTGACAGTCAAATAGG - Intergenic
1110199495 13:72832218-72832240 TAAAAGACAGACTGGCAAATCGG - Intronic
1112903196 13:104384859-104384881 ACAAAGACAGACAGTCAATTTGG + Intergenic
1112981018 13:105384378-105384400 TAAAAGACAGACTGGCAAATTGG + Intergenic
1113113935 13:106854713-106854735 CACAGCACTGACACTCAAATGGG + Intergenic
1116029561 14:39554555-39554577 CAAGAAACTGAGAGGCAAATAGG - Intergenic
1117081877 14:52159954-52159976 TAAAAGACAGACTGGCAAATTGG + Intergenic
1117311516 14:54528882-54528904 CTAAATACTGAGAGTAAAATTGG + Intronic
1117887839 14:60383812-60383834 TAAAAGACAGACAGGCAAATTGG + Intergenic
1117918837 14:60706522-60706544 CTAAAGATTGACAGGCAAATGGG - Intergenic
1118344255 14:64924626-64924648 CAACAGACTGACAGTGAGATTGG - Intronic
1118544936 14:66875446-66875468 TAAAAGACAGACTGGCAAATTGG + Intronic
1120557872 14:85952620-85952642 AAAAAGACTGACAACCCAATAGG + Intergenic
1121314105 14:92950987-92951009 CAAAAGACAGACAGACAGACAGG + Intronic
1122358453 14:101139350-101139372 GAAAAAACTGCCAGTAAAATTGG - Intergenic
1123782241 15:23639953-23639975 AAAAACACTGACATACAAATTGG + Intergenic
1123832586 15:24156244-24156266 TAAAAGACAGACTGGCAAATTGG - Intergenic
1125301674 15:38261022-38261044 ACAAAGCCTCACAGTCAAATGGG + Intronic
1125374119 15:39010984-39011006 AAAAAGACTGTCATTAAAATAGG - Intergenic
1126197219 15:45945438-45945460 CAAAAAAATGACAGCCAGATAGG + Intergenic
1126744090 15:51807502-51807524 CAAGGGACAGACAGGCAAATAGG + Intronic
1127252808 15:57258843-57258865 GTAAAGACTGACAGGCAAATAGG + Intronic
1127593078 15:60446788-60446810 CAAAACACAGACATTCAAAGTGG + Intronic
1129937248 15:79460923-79460945 GAAAAGTTTGACAGTGAAATAGG - Intronic
1130635036 15:85610513-85610535 CAAAACACTGACAGAGAAAAAGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131513221 15:93061075-93061097 CAGAAGACTGACATGCAAGTGGG - Intronic
1131561254 15:93442725-93442747 CAAAAGACAGATAGTCAATTTGG + Intergenic
1132139530 15:99380487-99380509 TAAAAGACAGACTGGCAAATTGG - Intronic
1134113751 16:11532696-11532718 AAAAAGATTGACAGAGAAATTGG + Intergenic
1135178082 16:20249000-20249022 CAAAAAGCTCACAGTCTAATAGG - Intergenic
1135767869 16:25193448-25193470 TAAAAGACAGAAAGTCAACTAGG - Intergenic
1135978733 16:27129665-27129687 CAAAAGACAGACAGACAGACAGG - Intergenic
1142920276 17:3178579-3178601 AAAGACACAGACAGTCAAATTGG + Intergenic
1142972942 17:3625078-3625100 GGAAAGACTGACACTGAAATTGG - Intronic
1144241549 17:13317571-13317593 CGAAAAACTGAAAGACAAATAGG - Intergenic
1146585694 17:34079639-34079661 CACAGGACTGACACCCAAATAGG + Intronic
1147916197 17:43888385-43888407 TAAATGACTGAAAGTCACATAGG - Intronic
1149139589 17:53414991-53415013 CAAAAGACTAAAGGTCCAATAGG + Intergenic
1149546823 17:57510151-57510173 CAAAAGGCTGAAAGTCCTATGGG - Intronic
1153119298 18:1701834-1701856 TAAAAGACAGACTGGCAAATTGG + Intergenic
1155764691 18:29613550-29613572 AGAAAGAAAGACAGTCAAATAGG - Intergenic
1155838754 18:30621677-30621699 CAAAAGACTGGAAGTCGAAGGGG - Intergenic
1157212911 18:45759231-45759253 CATAAGATTAACAGACAAATGGG - Intergenic
1157305557 18:46514617-46514639 CAGAGGACAGACACTCAAATGGG - Intronic
1158115239 18:53987828-53987850 CAAGATACTGACATTCATATAGG - Intergenic
1158758571 18:60356201-60356223 TTAAAGACTGAATGTCAAATAGG - Intergenic
1159521631 18:69532254-69532276 CAGAACACTGACAGTAAAACCGG - Intronic
1159825028 18:73197357-73197379 TAAAAGACTGACATGCAAATAGG - Intronic
925306986 2:2855061-2855083 CAAAACACTGACAGTAACATGGG - Intergenic
925576080 2:5361640-5361662 AAGAAGACTGACAGACAAACCGG + Intergenic
925734952 2:6955779-6955801 CAAAAGACAGCCATTAAAATGGG - Intronic
925947694 2:8880818-8880840 AAAAAGGCTGACAGTGAAATCGG + Intronic
926079640 2:9974174-9974196 CAAAAGACACACAGTTAAACAGG - Intronic
927735160 2:25514027-25514049 CAAAGAACTTACAGTCTAATAGG + Intronic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930758229 2:55001691-55001713 AAAAACACTGACAGTCCAACAGG + Intronic
931632664 2:64315496-64315518 CAAAAACCTGACAGCCAAGTTGG - Intergenic
933497954 2:83075007-83075029 CATAAAACTGAGAGTCCAATGGG - Intergenic
933653172 2:84865301-84865323 CAAAAGAATGACAGCCAAAAAGG + Intronic
935195998 2:100817056-100817078 CAAAGTTCTCACAGTCAAATTGG - Intergenic
936763413 2:115814455-115814477 CTAAAGAATGACTGTCAAGTTGG - Intronic
938987995 2:136598225-136598247 TAAAAGACAGACTGGCAAATTGG + Intergenic
940096300 2:149979700-149979722 TAACAGACAGACAGGCAAATTGG + Intergenic
940993519 2:160121784-160121806 AAAAAGACTCTCAGTAAAATGGG + Intronic
941292208 2:163691024-163691046 CAAAAGACTGAAAGACTATTTGG - Intronic
941390748 2:164911337-164911359 CAAAAGGCTGGCAGTCACTTTGG + Intronic
943075486 2:183189169-183189191 CAAAAGACTTTCAGACCAATTGG + Intergenic
943117722 2:183693690-183693712 CAGAAGACAGAGAGTCAAAAAGG + Intergenic
945078476 2:206064562-206064584 GAGAAAACTGACATTCAAATAGG - Intronic
947127442 2:226884992-226885014 AAAAACACTGACAGGCAGATTGG + Intronic
947406864 2:229787361-229787383 CAAGAGACTGAAAGGAAAATAGG + Intronic
948090459 2:235289601-235289623 CAAAAGCCTGATAGATAAATGGG + Intergenic
948499043 2:238377909-238377931 CAAAAAACTGACAGTCAAAATGG - Intronic
1169198539 20:3696568-3696590 CAGAAGACTGACACTCACCTCGG + Exonic
1169660264 20:7971494-7971516 CATAAGTCTGATATTCAAATTGG - Intergenic
1170120272 20:12903985-12904007 GAAGAGACTGGCATTCAAATTGG + Intergenic
1171039708 20:21749623-21749645 TAAAAGACAGACTGGCAAATTGG - Intergenic
1171365799 20:24623935-24623957 TAAAAGACAGACTGTCAAACTGG + Intronic
1172456091 20:35075211-35075233 TAAAAGACAGACTGGCAAATTGG - Intronic
1172639657 20:36433055-36433077 CAAAAAACTGTCAGTCTGATGGG - Intronic
1174694741 20:52545434-52545456 TAAAAGACAGACTGGCAAATTGG + Intergenic
1178729620 21:35088448-35088470 AAAAAGACAGACATCCAAATAGG + Intronic
1178981905 21:37271423-37271445 CAAAAGACTGCCAATCAAATGGG + Intergenic
1179390411 21:40984260-40984282 TAAAAGACAGAATGTCAAATTGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181574333 22:23784089-23784111 CAAAAAGTTCACAGTCAAATGGG + Exonic
1182085989 22:27561545-27561567 CAAGAGACTGCCATTGAAATTGG + Intergenic
1182382106 22:29899606-29899628 CACAAGAATGACATGCAAATTGG - Intronic
1184570718 22:45323133-45323155 CAAGAGAATGAAAGTCAAAGCGG - Intronic
949621323 3:5815097-5815119 CAGAAGACTTACAGTCAGTTAGG - Intergenic
951069895 3:18315216-18315238 CAAAAGACAGACAATCACAAAGG - Intronic
951497988 3:23351424-23351446 TAAAAGACAGACTGGCAAATTGG + Intronic
951609920 3:24480207-24480229 CAAAAGACTGACCATCAGTTTGG - Intronic
952547021 3:34431692-34431714 TAAAAGACAGACTGGCAAATTGG - Intergenic
952571682 3:34725328-34725350 CAGGAAGCTGACAGTCAAATGGG - Intergenic
952587136 3:34906298-34906320 TAAAAGACAGACTGGCAAATTGG + Intergenic
952837514 3:37616916-37616938 TAAAAGACAGACTGGCAAATTGG - Intronic
953828780 3:46277563-46277585 CAAACAACTGACACTCAAACAGG - Intergenic
953940052 3:47086520-47086542 CAAAATACAGCCAGTCAACTGGG + Intronic
955296811 3:57743134-57743156 CAAAATACTCACAGTCTAATAGG + Intergenic
957275434 3:78085337-78085359 CAAAAGCCTGAGAATCAAAGGGG + Intergenic
957945559 3:87058298-87058320 CAAAAGCCTGACTGTGATATGGG - Intergenic
959763791 3:110000341-110000363 TAAAAGACAGACTGGCAAATTGG - Intergenic
960067155 3:113386407-113386429 CAAAAGACCTACAGACTAATAGG - Intronic
960445653 3:117745953-117745975 CAATAAATTGCCAGTCAAATGGG + Intergenic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
961895480 3:130164395-130164417 TAAAAGACAGACTGGCAAATTGG - Intergenic
962173193 3:133124717-133124739 CAAACGTCTGCCAGGCAAATAGG + Intronic
962832949 3:139160088-139160110 CAAAAAACTGACAGTTTAGTGGG - Intronic
963558643 3:146831444-146831466 CAAGAGACTTACAGTAAAATGGG + Intergenic
964957808 3:162382647-162382669 TAAAAGACAGACTGGCAAATTGG + Intergenic
965003704 3:162988597-162988619 TAAGAAACTGAGAGTCAAATGGG - Intergenic
965090858 3:164161401-164161423 TAAAAGACAGACCGGCAAATTGG - Intergenic
965242640 3:166223071-166223093 CAAAAGAATGACAATCAGATTGG + Intergenic
965797413 3:172455229-172455251 CAAATTACTTACAGTCACATTGG - Intergenic
966429252 3:179814174-179814196 CAAAAGGCTTACAGTGAAATGGG - Intronic
966506763 3:180712001-180712023 CAAAAGATTGACACTCATACTGG + Intronic
967085484 3:186091375-186091397 CAAAGGACTGACTGTCACCTTGG + Intronic
967589309 3:191253991-191254013 CAAAAGATGGAAAGACAAATTGG + Intronic
967595887 3:191326761-191326783 CAAAGGACTGACAGTAACACGGG - Intronic
967779757 3:193423846-193423868 AAAAAAACAGACATTCAAATTGG + Intronic
968700224 4:2052739-2052761 CAAGAGACTGATAGTCTAAAGGG + Intergenic
969099698 4:4759699-4759721 CAAAAGACAGACAGAAACATTGG + Intergenic
969747291 4:9082712-9082734 TAAAAGACAGACTGGCAAATTGG + Intergenic
970283443 4:14482802-14482824 TAAAAGACAGACTGGCAAATTGG + Intergenic
970494524 4:16611403-16611425 TAAAAGACAGACTGGCAAATTGG + Intronic
970727393 4:19062339-19062361 TAAAAGACAGACTGGCAAATTGG + Intergenic
972336870 4:38114726-38114748 CAAAAAACTGTTATTCAAATAGG - Intronic
972591072 4:40487610-40487632 CAAAAACCAGACAGTCAACTAGG + Intronic
973066727 4:45804655-45804677 TAAAAGACAGACTGGCAAATTGG + Intergenic
973211550 4:47620901-47620923 CAAAATAATAACAGGCAAATAGG + Intronic
973676267 4:53266764-53266786 TAAAACACTGACAGTGATATTGG + Intronic
974819324 4:67045970-67045992 CAAAAGACTGTCAGTAAAGCAGG - Intergenic
975587967 4:75970018-75970040 CAAAAGACTGCCAGTTTATTTGG + Intronic
977534344 4:98239764-98239786 TAGAAGACTGAGAGTTAAATAGG + Intergenic
978829006 4:113060120-113060142 TAATAGAATGACAGTCAAATAGG + Intronic
979637353 4:122972523-122972545 AAAAAGACTGACAGTCAGTGAGG - Intronic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980857837 4:138461766-138461788 TAAAAGGCTCACAATCAAATGGG + Intergenic
981249870 4:142586891-142586913 CAAAAGCCTGAAAGTCAAGGAGG + Intronic
983791511 4:171803191-171803213 TAAAAGACAGACTGGCAAATTGG - Intergenic
984185192 4:176535143-176535165 CAAAAGACAGAAATTCACATCGG + Intergenic
986005787 5:3667900-3667922 TAAAAGACAGACTGGCAAATTGG - Intergenic
986811722 5:11366980-11367002 CAAAAGACTGATATCCACATAGG - Intronic
986942208 5:12967593-12967615 CAAAACACTGACAGTAGAAAGGG - Intergenic
987253197 5:16121332-16121354 CATGAGACTTACAGTCTAATGGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988867487 5:35352005-35352027 TAAAAGACAGACTGGCAAATTGG - Intergenic
989122783 5:38020887-38020909 CACAAGCCTGGGAGTCAAATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989794253 5:45447075-45447097 TAAAAGACAGACTGGCAAATTGG + Intronic
990223715 5:53625528-53625550 AAAAAGACTGGAAGTCAAACTGG - Intronic
990530530 5:56669267-56669289 GAAAAGGCTGACAGTCAGGTTGG - Intergenic
991038033 5:62147600-62147622 AAAAAGACTGAAATTCAAATTGG + Intergenic
991290500 5:65029933-65029955 CAGAAGACTGACAGTGAAGGCGG - Intergenic
991646102 5:68802027-68802049 CAAAAGACTGTCAGGGACATTGG + Intergenic
992314578 5:75539112-75539134 TAAAATACTGACAGTCCATTTGG - Intronic
992347950 5:75900018-75900040 TAAAAGACAGACTGGCAAATTGG - Intergenic
992578601 5:78147414-78147436 CAAAAGACAGACTTACAAATTGG - Intronic
992905617 5:81342701-81342723 CAAAAAACTGGCAGCCAAAAGGG - Exonic
992908942 5:81375529-81375551 TAAAAGACAGACTGGCAAATTGG + Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994142631 5:96359286-96359308 TAAAAGACAGACTGGCAAATTGG - Intergenic
994835952 5:104852549-104852571 TAAAAGACAGACTGGCAAATTGG - Intergenic
995180614 5:109227185-109227207 GAAAATACTGACAGTGAAAGGGG + Intergenic
995330052 5:110936153-110936175 TAAAAGACAGACTGGCAAATTGG + Intergenic
996167880 5:120247614-120247636 CAAAAGGATGAAAGGCAAATTGG + Intergenic
996602637 5:125283294-125283316 CACAAAACTGACAGTCCATTGGG + Intergenic
996985769 5:129562388-129562410 AAAATGACTGACAGTGAAGTTGG + Intronic
996989016 5:129605383-129605405 TAAAAGACTAACAGTCACTTTGG + Intronic
997081458 5:130744791-130744813 CAAAAGACAGACAGCTACATGGG + Intergenic
997134452 5:131310895-131310917 TAAAAGACAGACTGGCAAATTGG - Intronic
997216869 5:132118893-132118915 GAAAAGACAGACTGGCAAATTGG + Intergenic
997252528 5:132400279-132400301 CAAAACACAGACTGGCAAATTGG + Intergenic
997460724 5:134050513-134050535 CAAAATACTGAGTGTGAAATAGG + Intergenic
998673219 5:144377177-144377199 AAAAAGAGAGACAGTCCAATAGG - Intronic
1001160879 5:169311603-169311625 CAAGAGACTCACAGTCTAACTGG - Intergenic
1001415267 5:171541256-171541278 AAAAAGACTTACACTCAAAAAGG - Intergenic
1003331442 6:5132539-5132561 CAAAAGGCTGAGAGTGAAAGTGG + Intronic
1003345093 6:5259932-5259954 TAAAAGACTCATAGGCAAATAGG + Intronic
1003753439 6:9088701-9088723 AATTAGACTGACAGTCAAAGGGG + Intergenic
1004551914 6:16656145-16656167 CAAAGGGCTGGCTGTCAAATGGG + Intronic
1008283180 6:49620361-49620383 CAAGAAACTGACAGTTAAGTTGG + Intronic
1008722700 6:54376284-54376306 CGAAAAACTGTCAGTCTAATGGG - Intronic
1010422929 6:75694569-75694591 GAAAAGACTGACAGTTGCATAGG - Intronic
1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG + Intronic
1011499255 6:87969736-87969758 CAAAGAACTCAGAGTCAAATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012652290 6:101770597-101770619 CAATAGACTGACATCAAAATTGG - Intronic
1014791358 6:125676042-125676064 CAAAAAACTGGTAGTAAAATGGG - Intergenic
1014823802 6:126024546-126024568 TAAAAGAATGACAGTCCTATTGG + Intronic
1015454937 6:133415816-133415838 CAAAAAACTCATAGTCTAATGGG + Intronic
1017937900 6:159023225-159023247 CAAAAGACTAAAAGACCAATAGG + Intergenic
1020038881 7:4986195-4986217 AAAAAGACTGAAAGAAAAATAGG + Intronic
1020325709 7:6973931-6973953 TAAAAGACAGACTGGCAAATTGG - Intergenic
1021266712 7:18533537-18533559 CAAAGGAAAGAGAGTCAAATTGG - Intronic
1021916772 7:25442026-25442048 TAAAAGACAGACTGGCAAATTGG - Intergenic
1022872182 7:34491195-34491217 CAAAAGACTGAGAGGCAATGTGG + Intergenic
1023396412 7:39755839-39755861 CTAAAGAGAGACAGTGAAATTGG - Intergenic
1023523746 7:41076142-41076164 CAAGATAGTGTCAGTCAAATCGG + Intergenic
1024399247 7:48905028-48905050 ACAAAGAATGACAGCCAAATGGG + Intergenic
1025212753 7:57030062-57030084 CAAACAACTGACTTTCAAATTGG + Intergenic
1025659200 7:63546762-63546784 CAAACAACTGACTTTCAAATTGG - Intergenic
1025856658 7:65286277-65286299 CAAAAAACTGAAGGTCAAATAGG + Intergenic
1027289270 7:76685477-76685499 TAAAAGAATGCCAGTCATATTGG + Intergenic
1027447412 7:78290142-78290164 TAAAAGACAGACTGGCAAATTGG + Intronic
1028991484 7:97053074-97053096 TAAAAGACAGACTGGCAAATTGG + Intergenic
1030512642 7:110503142-110503164 CAAAAGAGTTACAGTCAAAGAGG - Intergenic
1030941602 7:115657715-115657737 GGAGAGACTGACATTCAAATAGG - Intergenic
1031132655 7:117850431-117850453 CCAAAGAATGACAGATAAATAGG + Intronic
1032348280 7:131136950-131136972 CAAGAAACTCACAGTCCAATGGG - Intronic
1033067326 7:138168488-138168510 CAAAAGTATGACAGAGAAATTGG - Intergenic
1033679332 7:143578553-143578575 TAAAAGACAGACTGGCAAATTGG - Intergenic
1033692505 7:143750891-143750913 TAAAAGACAGACTGGCAAATTGG + Intergenic
1035014584 7:155753876-155753898 CAAAAGAGTGAAAGAAAAATAGG + Intronic
1035155947 7:156913340-156913362 TAAAAGACAGACTGGCAAATTGG - Intergenic
1038073918 8:24048204-24048226 TAAAAGACAGACTGGCAAATTGG + Intergenic
1038372526 8:27008365-27008387 CAAAAAACTCACTGTTAAATAGG - Intergenic
1038645264 8:29355833-29355855 CAAAAAGCTGACAGTCTCATTGG + Intergenic
1041736216 8:61113592-61113614 CAAAAGACTGAAAAACAAGTTGG + Intronic
1041930124 8:63277354-63277376 CAAGGGACTGACAGTCCAGTGGG - Intergenic
1042117257 8:65445786-65445808 TAAAATACTGAAAGTCAGATAGG - Intergenic
1042597317 8:70464005-70464027 TAAAAGACAGACTGGCAAATTGG - Intergenic
1042620515 8:70699136-70699158 TAAAAGACAGACTGGCAAATTGG - Intronic
1042647574 8:71004497-71004519 CAAAAGGCTTACAGTTTAATTGG + Intergenic
1043047239 8:75342204-75342226 CAATATACTGACAGTACAATGGG - Intergenic
1043142202 8:76603944-76603966 GAAAAGGCTGACAGTCATCTAGG - Intergenic
1043505376 8:80897032-80897054 CCTAAGACTGACAGTGACATTGG - Intergenic
1044205947 8:89491977-89491999 CAAAGAACTTACAGTCTAATGGG + Intergenic
1044808866 8:96037059-96037081 TAAAAGACAGACTGGCAAATTGG - Intergenic
1044851041 8:96428086-96428108 CAAAAGAAAGACATCCAAATTGG - Intergenic
1046577184 8:116045140-116045162 CATGAGACTGACAGACAATTTGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047369350 8:124243513-124243535 TAAAAGACAGACTGGCAAATTGG - Intergenic
1048696936 8:137038918-137038940 TAAAAGACAGACTGGCAAATTGG - Intergenic
1050383379 9:5056581-5056603 CAAAAGGCTCACAGTCTACTAGG - Intronic
1050716442 9:8532221-8532243 CAAATACCTGACAGTCAAATTGG - Intronic
1050976362 9:11943637-11943659 TAAAAGACAGACTGGCAAATTGG + Intergenic
1052527725 9:29640776-29640798 AATGAGACTGACAGTCAAAAGGG + Intergenic
1054753975 9:68938545-68938567 TAAAAGACAGACTGGCAAATTGG - Intronic
1054864033 9:69981608-69981630 AAAAATACTGACTGACAAATAGG - Intergenic
1055327289 9:75144070-75144092 CTAAAGCCTGAGAGACAAATAGG - Intronic
1056001194 9:82218098-82218120 TAAAAGACAGACTGGCAAATTGG + Intergenic
1056061999 9:82893098-82893120 CAACAGATTGAAAGTAAAATAGG + Intergenic
1056370557 9:85949947-85949969 CAAGAGAGTAACAGTCAAAAAGG - Intronic
1056725511 9:89111245-89111267 TAAAGGAATGACAGTCAATTGGG - Intronic
1058480255 9:105385801-105385823 CCAAACACTGACAGTTAAAAAGG - Intronic
1058527280 9:105872602-105872624 CAAAGGACTTACAGTCTAATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059230650 9:112718232-112718254 CCAAAGAGTGACAGTCGAAGAGG + Exonic
1060928576 9:127473360-127473382 AAAAAGACAAACAGCCAAATAGG + Intronic
1061098758 9:128476187-128476209 GAAAAGACTGACAGTATAAATGG + Intronic
1185695568 X:2191846-2191868 CAAAAGAAAGAAAGTCGAATGGG + Intergenic
1187352742 X:18535995-18536017 CAAAAGACTGGGAGTCAGAGGGG - Intronic
1187705555 X:22006204-22006226 GAAATGGCTGACAGTCAAAATGG - Intergenic
1189029660 X:37437630-37437652 TAAAACACTGACATTCAAATTGG + Intronic
1190536241 X:51431399-51431421 TAAAAGACAGACTGGCAAATTGG - Intergenic
1191017867 X:55829263-55829285 TAAAAGACAGACTGACAAATTGG + Intergenic
1191024484 X:55898560-55898582 TAAAAGACAGACTGTCAAAATGG + Intergenic
1191133084 X:57035986-57036008 TAAAAGACAGACTGGCAAATAGG - Intergenic
1191194961 X:57710702-57710724 TAAAAGACAGACTGGCAAATTGG + Intergenic
1192116467 X:68416440-68416462 ACAAAGACAGACAGTCAAAAAGG + Intronic
1192942499 X:75927190-75927212 TAAAAGACAGACTGGCAAATTGG + Intergenic
1194589356 X:95779002-95779024 CAAAGGACAAATAGTCAAATTGG - Intergenic
1194691079 X:96985634-96985656 CAAAAGAAAGACAGTAATATTGG - Intronic
1194912050 X:99657424-99657446 CAGAAGACTCCCAGTCAAAAAGG - Intergenic
1196602724 X:117621042-117621064 TAAAAGACAGACTGGCAAATTGG - Intergenic
1196656227 X:118220258-118220280 CAAAAGACAAACAATCATATGGG - Intergenic
1197167949 X:123399420-123399442 CAATGGATAGACAGTCAAATAGG + Intronic
1198874469 X:141208292-141208314 CAAAACACTGAACGTGAAATTGG + Intergenic
1198993438 X:142544346-142544368 TAAAAGGATGACAGTCATATTGG - Intergenic
1200823315 Y:7612033-7612055 TCAAAGACTTACAGTAAAATGGG - Intergenic
1200878602 Y:8187330-8187352 CAACAGACTTACAGTAAAATGGG - Intergenic
1201055770 Y:9989178-9989200 CAAAAGACTTACCGTACAATGGG + Intergenic
1201707364 Y:16951647-16951669 TAAAAGACAGACAGGAAAATTGG + Intergenic
1201988095 Y:19991817-19991839 TAAAAGACAGACTGGCAAATTGG - Intergenic
1202190458 Y:22238085-22238107 CAAAAGACTTATAGTAAAATGGG - Intergenic
1202236740 Y:22719062-22719084 TCAAAGACTTACAGTAAAATGGG + Intergenic
1202306427 Y:23477106-23477128 TCAAAGACTTACAGTAAAATGGG - Intergenic
1202564382 Y:26193483-26193505 TCAAAGACTTACAGTAAAATGGG + Intergenic