ID: 1079436344

View in Genome Browser
Species Human (GRCh38)
Location 11:20455960-20455982
Sequence AGGTTTATAAACTTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079436344 Original CRISPR AGGTTTATAAACTTGGAGGA AGG Intronic
906369165 1:45237460-45237482 AAGCTTATAAACATGGTGGAAGG - Intronic
907258463 1:53197685-53197707 AGATTTAAAAACATGGGGGAGGG - Intronic
907571379 1:55487319-55487341 ATGTTTCTATACCTGGAGGAAGG - Intergenic
907781687 1:57572801-57572823 AGGCTTATAATCTTGGCAGAAGG + Intronic
908180959 1:61605162-61605184 AGGTTGACCAACTTAGAGGAAGG - Intergenic
908745281 1:67370558-67370580 TGGTTTATAAACATGGGGGCAGG + Intronic
909725836 1:78833822-78833844 TGGATAATAAACTTTGAGGAGGG - Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
913498268 1:119448045-119448067 AGGTTGAAAAACAAGGAGGAAGG - Intergenic
915449776 1:155996557-155996579 GAGGTTATACACTTGGAGGAAGG - Intronic
915648232 1:157289053-157289075 AGGATTAAAAACTTCAAGGAAGG + Intergenic
916734248 1:167593141-167593163 TGGTTTATAAACTGGGCGGTGGG + Intergenic
918272161 1:182912432-182912454 AGGATGATATACCTGGAGGAGGG + Intronic
918651627 1:186971428-186971450 AAGTATATAAATTTGGAGAAAGG - Intronic
918834971 1:189450266-189450288 AAGTTTATAATCATGGTGGAAGG - Intergenic
919655463 1:200193114-200193136 GGCTTTATAAACATGGAGGAGGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920714508 1:208326986-208327008 ACCTTTTTAATCTTGGAGGAAGG + Intergenic
921304198 1:213779557-213779579 TGGTTTAAAAACTTGATGGATGG + Intergenic
921429103 1:215042716-215042738 AGGTTTATAAAATGAGAGGCAGG - Intronic
921988645 1:221340070-221340092 AGGTTGGTAAAGGTGGAGGAAGG + Intergenic
924800426 1:247325933-247325955 ATGATTTTAAACTTGGAGAAGGG - Intronic
1063666736 10:8065651-8065673 AGGTTGAGAAAGTTGGAGAAGGG - Intronic
1063767494 10:9159578-9159600 AAGTTTATAATCATGGTGGAAGG - Intergenic
1063938496 10:11104156-11104178 AAGTCTATATATTTGGAGGAAGG + Intronic
1064055809 10:12096211-12096233 AAGGAAATAAACTTGGAGGAGGG - Intronic
1064295129 10:14072408-14072430 ATGTTTATAAAGTAGAAGGACGG - Intronic
1064584051 10:16822046-16822068 AAGCTTATAATCATGGAGGAAGG - Intergenic
1067894343 10:50162889-50162911 AGGGTGGTGAACTTGGAGGAAGG - Intergenic
1067954497 10:50777372-50777394 AGGGTGGTGAACTTGGAGGAAGG + Intronic
1068340785 10:55699512-55699534 AGGTTTATAATCATGGCAGAAGG - Intergenic
1071342947 10:84665179-84665201 AGGATGATGACCTTGGAGGAAGG + Intergenic
1071530150 10:86383884-86383906 AGATTTATAGTCTTGAAGGAAGG + Intergenic
1074322436 10:112415732-112415754 GGGGTTATAAACATGGAAGATGG + Intronic
1074705978 10:116132325-116132347 AATTTTAAAAACTTAGAGGATGG + Intronic
1075878503 10:125828243-125828265 AGGATAACAAACATGGAGGAAGG + Intronic
1076092009 10:127694545-127694567 AAGCTTAGAAGCTTGGAGGAAGG + Intergenic
1078358023 11:10647272-10647294 AGCTGTATGACCTTGGAGGAAGG + Intronic
1078827770 11:14947110-14947132 AAGTTTAAAACCTTGGTGGATGG + Intronic
1079404714 11:20134630-20134652 AGGTTTTTAAAATTAGAGAATGG - Intergenic
1079436344 11:20455960-20455982 AGGTTTATAAACTTGGAGGAAGG + Intronic
1079530769 11:21449950-21449972 AGGTTGATAACCTTGGAATAAGG + Intronic
1079694241 11:23459206-23459228 AAGTTTTTATACTTGGAGAAAGG + Intergenic
1080975985 11:37341049-37341071 AAGTATATTAACATGGAGGAGGG - Intergenic
1081370637 11:42297350-42297372 AAATTCATAAACTTCGAGGAAGG - Intergenic
1081800876 11:45858544-45858566 AGGTTCAGAAAGTTTGAGGAGGG - Intronic
1082571833 11:54750903-54750925 AGGATTAAAAACTAGAAGGAAGG + Intergenic
1087306940 11:96499755-96499777 AGGGTGAGAAACTTAGAGGAGGG - Intronic
1088972427 11:114785682-114785704 AGGTTTCTAAACTGGGAAGGAGG - Intergenic
1090052798 11:123395079-123395101 GGGATTATAAACTTGTAGGGGGG - Intergenic
1090728382 11:129548166-129548188 AGTTTGATAAATTTGCAGGATGG + Intergenic
1090877814 11:130806693-130806715 AGGTCTGTAAACTTGGGGGGAGG - Intergenic
1092315487 12:7409048-7409070 AGGTTTATAAACTTACTGTATGG - Intronic
1093227856 12:16507190-16507212 AGGGTTCAAAACTTGGAGGTTGG + Intronic
1093270670 12:17056954-17056976 AAGTTTATAGATTTGGGGGAGGG + Intergenic
1093426171 12:19031842-19031864 AGATTTACAATCTTGGGGGAAGG + Intergenic
1093823930 12:23658532-23658554 CGGTTTATAAACTTCTGGGAAGG + Intronic
1094585517 12:31774050-31774072 AGGTCTAGAAAGGTGGAGGAAGG + Intergenic
1094633701 12:32203264-32203286 AGCTTTATGACCTTGGAGGAGGG + Intronic
1096960959 12:55577057-55577079 GGGTTTATATACTTTGAGAAAGG + Intergenic
1097376621 12:58851128-58851150 CAGTTTATAGACTTGGAAGATGG - Intergenic
1101233926 12:102769063-102769085 AGGATTAGAAACTTGGCAGAAGG - Intergenic
1102640015 12:114358892-114358914 AGGTTTATGAATCTGGGGGAAGG - Intronic
1103431598 12:120892469-120892491 ATGTTTAGAGACTTGGAAGAAGG + Intronic
1104803712 12:131571709-131571731 AGTTTAATAAACTAGAAGGAAGG - Intergenic
1106708178 13:32303483-32303505 AGTTGTGTATACTTGGAGGAAGG + Intergenic
1106819177 13:33444022-33444044 AGCTCTATAAACATGAAGGAAGG + Intergenic
1106940032 13:34768222-34768244 AGGTTCATTAAGTTGGAGGTAGG - Intergenic
1108788957 13:53943111-53943133 AGCTTCATAATCATGGAGGAAGG + Intergenic
1110196271 13:72791974-72791996 AGGAATATAAATTTGGAGGTTGG + Intronic
1111636014 13:90904837-90904859 ATGTTTACTATCTTGGAGGATGG - Intergenic
1111641253 13:90973411-90973433 AGTTTGAGAAACTTGGAGGAAGG + Intergenic
1112711160 13:102130447-102130469 AGGTCTTTAAAATTGGAGAAGGG - Intronic
1115927771 14:38456201-38456223 AGGTTTTTAAACTGAAAGGAGGG - Intergenic
1117249341 14:53920132-53920154 GGGTATAGAAACTTGCAGGAGGG - Intergenic
1117676318 14:58158328-58158350 ATGTTCATAAACTTTTAGGAAGG - Intronic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1118386191 14:65257465-65257487 AGGATGAGAAACTTGGAGGTGGG - Intergenic
1120715783 14:87839435-87839457 AAGTGTAAATACTTGGAGGATGG - Intronic
1121368825 14:93338341-93338363 AAGTTTATAATCATGGTGGAAGG - Intronic
1124985886 15:34613001-34613023 AGGTTTTTAAACTTTTACGATGG - Intergenic
1125233606 15:37485358-37485380 ATTTTTATTATCTTGGAGGAGGG - Intergenic
1125399828 15:39289707-39289729 ACTTTTATGATCTTGGAGGAAGG + Intergenic
1128439088 15:67686831-67686853 AGGTTTCTAAACCTGGGGGTAGG + Intronic
1128439315 15:67689419-67689441 AGGTTTCTAAACCTGGGGGTGGG + Intronic
1131842474 15:96452149-96452171 AGGGTTATATACTAGGAGGATGG - Intergenic
1133295103 16:4747794-4747816 AGGTGCATGAACTTAGAGGAAGG + Intronic
1134300369 16:12985373-12985395 AGTTTCAGAAACTTGGAGAAGGG - Intronic
1135152968 16:20025898-20025920 AGGTCTAGAGCCTTGGAGGAGGG - Intergenic
1135564271 16:23499807-23499829 AGGTTTCTACACTGTGAGGAAGG - Intronic
1138518565 16:57555433-57555455 GGGTATATAATCATGGAGGAAGG - Intronic
1139837360 16:69849991-69850013 CTGGTTATAAACTAGGAGGAAGG + Intronic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140431999 16:74912238-74912260 GGGTTAATAAACTGGAAGGAAGG + Exonic
1142780593 17:2178528-2178550 AGGTTTATATTCTTGCAGTAGGG - Intronic
1143403767 17:6662645-6662667 AACTTCAGAAACTTGGAGGAGGG - Intergenic
1144001902 17:11063196-11063218 AGGTTTCTAAAAGTGGAAGAGGG - Intergenic
1144458180 17:15436042-15436064 ACGTTTATAGACATGGAGGCAGG - Exonic
1146981209 17:37163310-37163332 AAGCTTATGATCTTGGAGGAAGG - Intronic
1147038076 17:37696540-37696562 AGGTTTACAAGCATGGCGGAAGG - Intronic
1149652819 17:58287544-58287566 ATGTTTATAATCTTGAAGAAAGG - Intergenic
1150067675 17:62125221-62125243 AGGTTTAGAACCTTGGAAGGTGG - Intergenic
1150979045 17:70121122-70121144 TGGTTGATAAAACTGGAGGATGG + Intronic
1151170866 17:72245112-72245134 GGCTTTATAAAATTGGATGATGG - Intergenic
1155905440 18:31445204-31445226 AGCATTCTAAACTTGGAGGCAGG - Intergenic
1156194807 18:34762381-34762403 GGGTCTATCAACTTGGAGGAAGG + Intronic
1157389064 18:47285969-47285991 AAGTTTATAAACTAGGAAGGCGG - Intergenic
1158263157 18:55631889-55631911 ACATTTAGAAACTTGGAGGAAGG - Intronic
1158803113 18:60936751-60936773 AGATTTATAACCATGGTGGAAGG + Intergenic
1158988371 18:62842696-62842718 TGGTTTTTAAAATTGGAGAAGGG - Intronic
1160199237 18:76782477-76782499 AGGTATATAAACTGGCAGGCTGG - Intergenic
1162099530 19:8331532-8331554 AGGTTTCTGAACCTGCAGGAGGG + Intronic
1163090103 19:15013379-15013401 AGGTGTCTCAACTTGGGGGAGGG - Intronic
1164451283 19:28367575-28367597 AGGTTGATAGACTTGGTAGATGG - Intergenic
1164836201 19:31356697-31356719 AGTCTTATAAAGGTGGAGGAGGG - Intergenic
1168141230 19:54388667-54388689 AGGGGGAGAAACTTGGAGGAGGG - Intergenic
925058674 2:874413-874435 GGCTTTATAAACTTGGAGGAGGG - Intergenic
926629829 2:15126236-15126258 AAGCTTATAATCATGGAGGAAGG - Intergenic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
929410989 2:41697363-41697385 TGGCTTGTAAACTTGGAGGATGG + Intergenic
930609264 2:53523142-53523164 AGGTTTTTAAGCTAGGGGGATGG + Intergenic
930612368 2:53557412-53557434 AAGTTAATAACCTTGAAGGAAGG + Intronic
931350054 2:61479552-61479574 AGGTGTATATACTTAGGGGATGG - Intronic
932181138 2:69647275-69647297 AGGTTTATAAATTTGGAGAGGGG - Intronic
932708046 2:74042088-74042110 AGGTGTATCAACTGGGAGAAGGG - Intronic
932842025 2:75092262-75092284 AGGTTTTTAAAATTGGGGGAGGG - Intronic
933848725 2:86348682-86348704 AGCTTTAGAAATTAGGAGGAAGG + Intergenic
943517035 2:188901613-188901635 TAGTGTATAAACTTGGAGTAGGG + Intergenic
946747798 2:222862455-222862477 AGGTTGATAAACATGAAAGAAGG - Intronic
947058506 2:226135269-226135291 TGGTTCTTAAACTTGGGGGAGGG + Intergenic
947607083 2:231493409-231493431 AGGTTTATAAACTTGAAAAAAGG + Intergenic
948552661 2:238784791-238784813 GAGTTTCTAAACTTTGAGGAGGG - Intergenic
1169103251 20:2970756-2970778 ATTTTTATAATCTTGGAGTAAGG - Intronic
1172855003 20:37994916-37994938 ATGGTTCTAAACTTGAAGGATGG + Intronic
1175358186 20:58385662-58385684 AGGTTAATAGACATGGAGAAGGG + Intergenic
1176994132 21:15534425-15534447 AAATTTAGAAACTTAGAGGAGGG + Intergenic
1177434883 21:21038622-21038644 AAGCTTATAACCTTGGTGGAAGG - Intronic
1179240079 21:39582122-39582144 GGGTTTTTAAAAGTGGAGGAGGG + Intronic
1181061362 22:20283588-20283610 AGGTCTATAAGCTGGGAAGATGG - Intergenic
1183349485 22:37326897-37326919 AGGTTGATAAGCTTGGAGTGAGG - Intergenic
1183991157 22:41597837-41597859 TGGTTTATAAAGATGGGGGAAGG - Intergenic
1184842372 22:47059641-47059663 AGGCTTACACACTTGGAGGTGGG - Intronic
949218387 3:1600126-1600148 TGCTATAGAAACTTGGAGGACGG + Intergenic
951179252 3:19639776-19639798 AGCTTTATAAGCTTGGAATATGG - Intergenic
951307835 3:21087283-21087305 AAGCTTATAATCGTGGAGGAAGG + Intergenic
952225161 3:31367553-31367575 AGGTTTATCACTTTGGAGCATGG - Intergenic
955877197 3:63504466-63504488 TGGTTTGTAAATTTGGAGGAGGG - Intronic
956994464 3:74808393-74808415 AGGCTTACAATCATGGAGGAAGG + Intergenic
957506968 3:81134571-81134593 AGCTTTAGCAGCTTGGAGGAAGG - Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
961154836 3:124670879-124670901 AGGTTTGGAGACTCGGAGGATGG - Intronic
961700544 3:128741168-128741190 AAGTTTATAAACTGGGAGAGAGG - Intronic
962462449 3:135627071-135627093 AGGTCAATGAACTTGGAGGAGGG - Intergenic
962941654 3:140130114-140130136 TGGTTTCTAAACTTGGAGGAGGG + Intronic
964544631 3:157820374-157820396 AGGTCTGAAAACTTGGAAGAAGG - Intergenic
964573855 3:158142576-158142598 AAGTTTATAAACGTGGTGAAAGG + Intronic
965533206 3:169797241-169797263 AGGTTTAGAGACTTGAAAGATGG - Intronic
965908085 3:173735481-173735503 AGTCTTATAAACTTGTAAGAAGG - Intronic
966527676 3:180938358-180938380 AGTTTTGTAAACTTGGTGGATGG + Intronic
967166813 3:186787477-186787499 AGGTTTATTAATTTGCAGCATGG + Exonic
967603394 3:191415498-191415520 AAGTTTATAATCATGTAGGAAGG + Intergenic
968093688 3:195913302-195913324 AGGTTTCTATTCTAGGAGGAGGG - Intergenic
969705452 4:8789032-8789054 AGGCCCATAAACTGGGAGGAGGG + Intergenic
970385433 4:15551432-15551454 AGGTTAAGAAACATGGAGGAAGG - Intronic
971387503 4:26154749-26154771 AAGCTTATAATCATGGAGGAAGG + Intergenic
971954447 4:33397559-33397581 AGCTTTCTAAACCTGGAGAAAGG + Intergenic
972052727 4:34759334-34759356 AGGTGGATAAACTTGTATGACGG + Intergenic
972208680 4:36810442-36810464 TGGTTGTTAAACTAGGAGGATGG - Intergenic
973209952 4:47604691-47604713 AGGATTATAGCCATGGAGGAGGG - Intronic
974157694 4:58095329-58095351 AGTCTTACAAACATGGAGGAAGG + Intergenic
976010580 4:80483108-80483130 AGGTTCTTAAAGGTGGAGGAGGG + Intronic
976082186 4:81368097-81368119 AGGTTTACAATCATGGCGGAAGG + Intergenic
977137751 4:93327249-93327271 TGTTTTATAAACTTCTAGGAAGG - Intronic
977931316 4:102752291-102752313 ACGTTTACAAAGTTGGAGAATGG - Intronic
979059953 4:116044673-116044695 AAGTTTATAATCATGGTGGAAGG + Intergenic
980132187 4:128827098-128827120 AGATTTATAACCAAGGAGGAGGG - Intronic
981006598 4:139881400-139881422 AGGGTTGTAAACTTGGATGCTGG - Intronic
981504954 4:145489564-145489586 AAGTTTCTAAACTTGGTGGCTGG + Intronic
982356876 4:154480366-154480388 AGCTTTGAAAAGTTGGAGGACGG + Intronic
982944983 4:161610183-161610205 AGGTTTAAAAAATTGAAGGTTGG + Intronic
984303040 4:177948752-177948774 AAAATTATAGACTTGGAGGAGGG + Intronic
988640020 5:33031653-33031675 ACCATTATAAAATTGGAGGAGGG + Intergenic
990288833 5:54328283-54328305 AGGTTTATAAATTAGAAGGGGGG - Intergenic
990506073 5:56446835-56446857 AGGTAGATAACCTTGGAGCATGG + Intergenic
991556694 5:67902673-67902695 AAGTTTAGAGACTTGGAGGAGGG - Intergenic
991727244 5:69547846-69547868 AGCTTTATTATCTTTGAGGAAGG + Intronic
991867712 5:71080030-71080052 AGCTTTATTATCTTTGAGGAAGG - Intergenic
992280317 5:75168283-75168305 GGGTTTAAAAACTTCTAGGATGG - Intronic
992854643 5:80847929-80847951 AGGTTTAAAAACTTGGTCTAGGG + Intronic
995638465 5:114223737-114223759 AAGTTTAGAAGCTTGGATGAAGG + Intergenic
996311826 5:122114961-122114983 TGCTTTATAAATTGGGAGGAAGG - Intergenic
997270768 5:132535870-132535892 AAACTTATAAATTTGGAGGACGG + Intergenic
997562379 5:134859373-134859395 AGATTTATATATTTGGAGGAGGG - Exonic
1003828895 6:9983705-9983727 TAGTTTATAAATTTGAAGGAGGG - Intronic
1005482082 6:26264663-26264685 AAGTTTATTAACATGCAGGAGGG + Intergenic
1010340355 6:74743412-74743434 AGGTTCATAAACTTAGAGTAGGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011231452 6:85166043-85166065 TTGTTTTTAAACTTTGAGGAAGG - Intergenic
1011763155 6:90590031-90590053 AGGTATTAAAACTTTGAGGAGGG - Intergenic
1015110095 6:129582965-129582987 GGGTTTATAAATTGGGAGAAAGG - Intronic
1015890085 6:137961756-137961778 AGGTTAAGAAACTTGGATAACGG - Intergenic
1016295625 6:142570670-142570692 AGTTTGAAAAACTTGGAGGATGG + Intergenic
1022921770 7:35023143-35023165 AGGTTTGGGGACTTGGAGGATGG - Intronic
1023035540 7:36128333-36128355 AGGTTTAAAAATTTGGCCGAAGG - Intergenic
1025089274 7:56049225-56049247 AGGGTTTAAAACTTAGAGGATGG - Intronic
1029521201 7:101063773-101063795 AGGCTCACAAACATGGAGGAAGG - Intergenic
1029733242 7:102451375-102451397 TGGTTTAGAAACTTGGAAGGCGG + Exonic
1030934746 7:115571538-115571560 AGGGTTATACATTAGGAGGAAGG - Intergenic
1031349079 7:120706183-120706205 AGGTATATAGACTTGGAGTCAGG + Intronic
1032566174 7:132948294-132948316 AGATTTATCACCTTGGAGGCTGG + Intronic
1032609447 7:133396134-133396156 TGATTGAGAAACTTGGAGGATGG + Intronic
1037858331 8:22387598-22387620 AGGTTTAAAAACTTCAAGGCAGG - Intronic
1038102912 8:24399473-24399495 AGGTTTGTAAATTTGTAGTAAGG + Exonic
1039355311 8:36808994-36809016 AGGTTTTGAAAGTTGGAAGAGGG - Intronic
1039770204 8:40678568-40678590 TGCTTTATAAGCTTAGAGGAGGG - Intronic
1039864120 8:41486250-41486272 AGGTTAAAAAACTTTGGGGAAGG - Intergenic
1040453435 8:47572361-47572383 AGGTGTAAAAACTTGTATGAGGG + Intronic
1044644945 8:94430359-94430381 AGGGATATAAATTTGGATGATGG - Intronic
1046429192 8:114100936-114100958 AGGTCTTAAAAATTGGAGGAAGG + Intergenic
1046686775 8:117236644-117236666 AAGGTTATAAATTTGAAGGAAGG - Intergenic
1047904791 8:129461002-129461024 ATGTTAATTATCTTGGAGGAGGG + Intergenic
1048373241 8:133798808-133798830 AGGGTAAGAAACTTAGAGGATGG + Intergenic
1049489362 8:142886072-142886094 AAGTTTACAATCATGGAGGAAGG - Intronic
1051694229 9:19751090-19751112 AGGATTATGAACCTGGGGGAGGG + Intronic
1052522736 9:29570265-29570287 AGGTTTAGAAATTTGAAGGAAGG - Intergenic
1053826048 9:42025601-42025623 AAGTATATCAACTTGGGGGAAGG + Intronic
1054604515 9:67161795-67161817 AAGTATATCAACTTGGGGGAAGG - Intergenic
1055643682 9:78342784-78342806 AGGCTTTTAAACTTGGGGAAGGG - Intergenic
1059948875 9:119441297-119441319 AAGATTATAAACTTGCAGAAAGG + Intergenic
1061539908 9:131272579-131272601 AGGCTTAAAAACTTGGAAAATGG + Intronic
1203756089 Un_GL000218v1:128331-128353 AGGGATATGAACTTGGATGAAGG + Intergenic
1186257102 X:7733549-7733571 ACTTTAATAAAGTTGGAGGATGG + Intergenic
1187593519 X:20745264-20745286 AGGTTTCTAAACTTCCAGGCAGG - Intergenic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189284179 X:39840076-39840098 AGGTTTCTGAACCTGGAGGAAGG - Intergenic
1189594550 X:42549901-42549923 AAGCTTATAATCTTGGAGGAAGG + Intergenic
1190201500 X:48365548-48365570 AGTATTATAAACTTGGAAGATGG + Intergenic
1190209179 X:48430887-48430909 AGTATTATAAACATGGAAGATGG - Intergenic
1190668334 X:52716047-52716069 AGTATTATAAACTTGGAAGACGG + Intergenic
1190671083 X:52742357-52742379 AGTATTATAAACTTGGAAGACGG - Intergenic
1190836316 X:54104241-54104263 AGGTTGATACAGTTTGAGGAGGG - Intronic
1190948809 X:55122183-55122205 AGGATTATAAATTTGGAAAAAGG + Intronic
1192385741 X:70667568-70667590 AGGATTACAAAGTTGAAGGAAGG + Intronic
1194484691 X:94472566-94472588 AAGTTTATAATCGTGGTGGAAGG - Intergenic
1195648348 X:107258426-107258448 AAGCTTATAATCATGGAGGAAGG + Intergenic
1196427764 X:115589365-115589387 AGGTATATAAACTTGTTGCATGG - Intronic
1196987842 X:121294623-121294645 AGGGCTATCAAATTGGAGGAAGG - Intergenic
1198801034 X:140447934-140447956 TGGTTTATAAACTAGGAGTGAGG - Intergenic
1199440572 X:147863522-147863544 TGGTTTATAATCTTCCAGGAAGG + Intergenic