ID: 1079437272

View in Genome Browser
Species Human (GRCh38)
Location 11:20470148-20470170
Sequence GTTACTGTATTTACAACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079437270_1079437272 2 Left 1079437270 11:20470123-20470145 CCTAGGTTACAAACCTGTACAGC 0: 28
1: 495
2: 1255
3: 1622
4: 3715
Right 1079437272 11:20470148-20470170 GTTACTGTATTTACAACTATAGG 0: 1
1: 0
2: 0
3: 38
4: 392
1079437267_1079437272 30 Left 1079437267 11:20470095-20470117 CCTAGGCTATATACTATAGCCTG 0: 1
1: 5
2: 82
3: 529
4: 1147
Right 1079437272 11:20470148-20470170 GTTACTGTATTTACAACTATAGG 0: 1
1: 0
2: 0
3: 38
4: 392
1079437269_1079437272 11 Left 1079437269 11:20470114-20470136 CCTGTTGCTCCTAGGTTACAAAC 0: 7
1: 146
2: 829
3: 1515
4: 1461
Right 1079437272 11:20470148-20470170 GTTACTGTATTTACAACTATAGG 0: 1
1: 0
2: 0
3: 38
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079437272 Original CRISPR GTTACTGTATTTACAACTAT AGG Intronic
902369357 1:15995959-15995981 GTTACTGTACTAAGTACTATAGG + Intergenic
902453846 1:16517270-16517292 GTTATTGTATTTACTACAGTAGG + Intergenic
904286189 1:29454549-29454571 GTTTCTGTTTCTACAATTATAGG + Intergenic
904721939 1:32516793-32516815 GTTACTGTATTGAAAACTGTAGG + Intronic
904815640 1:33195573-33195595 GTTACTGTATTGAATACTGTTGG + Intergenic
905704765 1:40046713-40046735 GTTACTGTATCTAATACTGTAGG + Intronic
906010379 1:42518538-42518560 GTTACTGTATTAAATACTATAGG - Intronic
906184688 1:43852443-43852465 GTTATTGTGTATATAACTATTGG + Intronic
907768377 1:57434747-57434769 GTTACTGTATTGAATACTGTAGG + Intronic
907911420 1:58830326-58830348 GTTACTGTACTAACTACTGTAGG - Intergenic
908447464 1:64213892-64213914 GTTACTGTACTAAACACTATAGG + Intronic
909180894 1:72422375-72422397 GTTACTGTATGTTTAACTTTTGG - Intergenic
909244431 1:73260460-73260482 GTTACTGTAGTGACTACTGTAGG - Intergenic
909754132 1:79202000-79202022 GTTACTGAATTTACAAAATTTGG + Intergenic
910595678 1:88977881-88977903 GTTACTGTACTTAATACTACAGG - Intronic
910696582 1:90024826-90024848 CTTACTGAATTTACATCTAATGG - Intronic
911135369 1:94433585-94433607 GTTACTGTACTGAATACTATAGG + Intronic
911885993 1:103300502-103300524 GTTACTGTACTGAAAACTGTAGG + Intergenic
911967910 1:104390533-104390555 GTTACTCTATTTCCAGCTTTAGG + Intergenic
914738228 1:150438788-150438810 GTCACTGTATTGAATACTATAGG + Intronic
915691041 1:157691099-157691121 GTTGCTGTATTTATAGCTGTTGG + Intronic
917131700 1:171749983-171750005 GTTACTGTATTGAATACTGTAGG - Intergenic
917286608 1:173427809-173427831 GTTACTGTACTGAAAACTGTAGG + Intergenic
917907388 1:179600376-179600398 GTTACTGTACTGAATACTATAGG - Intronic
919138228 1:193537471-193537493 GTTACTGTATTGAATACTGTAGG - Intergenic
919184441 1:194126727-194126749 GTTATTGTAATTATAACCATGGG - Intergenic
920037243 1:203074326-203074348 GTTACTGTATTGAATACTGTTGG + Intronic
921014691 1:211177982-211178004 GTTACTGTACTGAATACTATAGG + Intergenic
921172789 1:212564105-212564127 GTTACTGTATTCAATACTGTAGG - Intergenic
921240903 1:213180942-213180964 GTTACTGTATACTAAACTATGGG - Intronic
921274062 1:213499792-213499814 GTTACTGTATTGAAAAGTGTAGG + Intergenic
921447476 1:215263608-215263630 GTTGCTATATTTAATACTATAGG - Intergenic
922247593 1:223815835-223815857 GTTACTGTATTGAATACTGTAGG - Intronic
923332862 1:232941718-232941740 GTTACTGTACTGAATACTATGGG - Intergenic
924430982 1:243996321-243996343 GTTCCTGAATTTCCAACTCTTGG - Intergenic
1065174464 10:23063216-23063238 GTCACTGTAGTTACAACTCAAGG - Intergenic
1065640839 10:27780728-27780750 GTTACTCTTTTTACAACCATAGG + Intergenic
1067377109 10:45737695-45737717 CTTACTGTTTTTGCAACTCTTGG + Intronic
1067743773 10:48917052-48917074 GTTACTGTACTAAACACTATAGG - Intronic
1067884815 10:50078389-50078411 CTTACTGTTTTTGCAACTCTTGG + Intronic
1068351944 10:55859026-55859048 GTTACTGTACTCAACACTATAGG + Intergenic
1068912256 10:62390791-62390813 GTTACTGTACTGACTACTGTAGG + Intronic
1069214975 10:65808445-65808467 TGTACTGTGTTTACAACTATGGG + Intergenic
1069238688 10:66110924-66110946 GTTACTGTACTGAATACTATAGG + Intronic
1071135988 10:82455351-82455373 GTTACTGTACTGAATACTATAGG + Intronic
1071382461 10:85081666-85081688 GTTACTGTACTGAGTACTATAGG - Intergenic
1071425364 10:85544072-85544094 GTTAATATTTTTACAAGTATAGG - Intergenic
1071440398 10:85687080-85687102 GTTGCAGTACTTTCAACTATCGG - Intronic
1071857206 10:89637469-89637491 GTTACTGTGCTTAGTACTATAGG + Intronic
1071892104 10:90020748-90020770 GTTACTGTACTGAGTACTATAGG + Intergenic
1071950259 10:90696135-90696157 GTTACTGTACTGAATACTATGGG + Intergenic
1072111111 10:92321046-92321068 GTTACTGTATTGAATACTGTAGG - Intronic
1072282124 10:93875862-93875884 CTTACGGTAATTACTACTATGGG + Intergenic
1072863722 10:99034806-99034828 GTTATTGTACTGAAAACTATAGG + Intronic
1073705920 10:105984311-105984333 GATACTGTATTTAACACTTTTGG - Intergenic
1074342724 10:112649786-112649808 GTTACTGTACTGAATACTATAGG + Intronic
1074615563 10:115064527-115064549 GTTACTGTACTAACTACTGTAGG + Intergenic
1074652387 10:115538943-115538965 GTTACTGTATTGAATACTGTAGG - Intronic
1076182040 10:128417326-128417348 GTTACTGTATTGAACACTGTAGG - Intergenic
1079437272 11:20470148-20470170 GTTACTGTATTTACAACTATAGG + Intronic
1079536040 11:21516585-21516607 GTTACTGTACTGAATACTATAGG + Intronic
1080257703 11:30310077-30310099 GTTACTGTACTGAATACTATAGG + Intergenic
1080536086 11:33223158-33223180 GTTACTGTATTTATTAATGTTGG - Intergenic
1080630729 11:34072916-34072938 GTTACTGTACTGACTACTGTAGG - Intronic
1080788800 11:35500798-35500820 GTTACTGTACTGAATACTATAGG + Intronic
1081918005 11:46746538-46746560 GTTACTGTACTGAATACTATAGG + Intronic
1082194741 11:49288778-49288800 GTTAGTGTTTTTAAAACTACAGG + Intergenic
1082214440 11:49550829-49550851 GCCACTGTATTTACAAATATAGG + Intergenic
1082220881 11:49634761-49634783 ATTACTGTAGTGAAAACTATAGG + Intergenic
1085185009 11:74568460-74568482 TTTAGTGTATTTACAAATATGGG + Intronic
1085598440 11:77832183-77832205 TTAACTGTACTTACAATTATAGG + Intronic
1086105548 11:83143141-83143163 GTTACTGTCCTTAGTACTATGGG + Intergenic
1086316782 11:85603329-85603351 GTTACTTTACTTACCACTGTAGG + Intronic
1086628159 11:88984352-88984374 ATTACTGTAGTGAAAACTATAGG - Intronic
1086635149 11:89073670-89073692 GCCACTGTATTTACAAATATAGG - Intergenic
1086671392 11:89552151-89552173 GTTAGTGTTTTTAAAACTACAGG - Intergenic
1086755318 11:90554417-90554439 GTTACTGTACTGAATACTATAGG + Intergenic
1086849167 11:91788395-91788417 GTTACTGTACTCACTACTATAGG + Intergenic
1086915992 11:92530871-92530893 CTTACTTTATTTACAAATATAGG + Intronic
1087042071 11:93811015-93811037 GTTACTGTACTGAATACTATAGG + Intronic
1091107157 11:132933499-132933521 GTCACTGAAATTACAACCATAGG - Intronic
1091135856 11:133188706-133188728 GTTATTCTATTTTTAACTATAGG + Intronic
1091502360 12:1030825-1030847 GTTACTGTATTGAATACTGTAGG - Intronic
1093008319 12:14076856-14076878 GTTACTGTACTGAATACTATAGG - Intergenic
1093310652 12:17578293-17578315 GCTTATGTATTTAAAACTATGGG + Intergenic
1093445160 12:19248559-19248581 GTTACTGTATTGAATACTATAGG - Intronic
1093547329 12:20364512-20364534 GTTACTGTATTAAATACTCTAGG - Intergenic
1094232275 12:28120201-28120223 GTTACTGTACTGAATACTATAGG - Intergenic
1095051324 12:37557184-37557206 TTTAATGTATATACAAATATAGG + Intergenic
1095054644 12:37584789-37584811 TTTAATGTATATACAAATATAGG + Intergenic
1095265806 12:40155974-40155996 GTTACTGTTTTTATGACTTTAGG + Intergenic
1095822808 12:46497725-46497747 GTTACTGTATTGAATACTGTAGG - Intergenic
1096937120 12:55293241-55293263 GTTACTGTATTAAATACTATAGG - Intergenic
1096972288 12:55677028-55677050 GTTACTGTACTCAATACTATAGG + Intergenic
1097456880 12:59810361-59810383 GTTACTGTATTGAACACTGTAGG - Intergenic
1098785879 12:74754642-74754664 GTTACTGTATTGAATACTGTAGG - Intergenic
1099563314 12:84206640-84206662 GTTACTGTATTGAATACTGTAGG + Intergenic
1099690058 12:85940444-85940466 GTTACTGTATGAAATACTATAGG + Intergenic
1100314318 12:93430202-93430224 GTTACTGTACTTAATACTGTAGG - Intronic
1100885773 12:99068379-99068401 GTTACTGTACTGAAAACTGTAGG + Intronic
1101942081 12:109107002-109107024 GTTACTGTACTAAATACTATAGG - Intronic
1101989420 12:109472550-109472572 GTTAATGTATTTACTATTAATGG - Intronic
1102323072 12:111955820-111955842 GTTACTGTATTGAATACTATAGG - Intronic
1102801142 12:115735253-115735275 GTTACTGTACTGAATACTATAGG + Intergenic
1106059294 13:26271409-26271431 GTTATTGTATTGACTATTATAGG + Intronic
1106623589 13:31395526-31395548 GTTACTGTACTGAATACTATAGG - Intergenic
1107444919 13:40461746-40461768 GTTACTGTACTGAATACTATAGG + Intergenic
1108015757 13:46073993-46074015 GTTACTGTTTTTGCTACTTTTGG - Intronic
1108778259 13:53794492-53794514 GTTACTGTACTGAATACTATAGG - Intergenic
1108836735 13:54559399-54559421 GTTACTGTATTGAATACTGTAGG + Intergenic
1109800205 13:67366718-67366740 GTTACTGCTTTTACAAGTAGAGG - Intergenic
1110365268 13:74676752-74676774 GTAACTATAATTGCAACTATAGG - Intergenic
1111053535 13:82918064-82918086 GTTACTGTACTAAATACTATAGG - Intergenic
1112289115 13:98129405-98129427 GTTACTGTACTGAAAACTGTAGG - Intergenic
1112723898 13:102279926-102279948 TTTCCTGCATTTACATCTATTGG + Intronic
1114859246 14:26494683-26494705 TTTATGGTATTTACAACCATGGG - Intronic
1114931749 14:27477979-27478001 ATTAATATATTTACAACTATTGG - Intergenic
1115210486 14:30962901-30962923 GTTACTGTACTGAATACTATAGG - Intronic
1115805073 14:37041647-37041669 ATTACTATATTTGCAACTAGAGG - Intronic
1116349779 14:43846423-43846445 GTTACTGTACTGAAAACTGTAGG - Intergenic
1116615183 14:47127167-47127189 ATTACTGTATTTTAAACTGTTGG - Intronic
1116824594 14:49660170-49660192 GTTGCTGTATTGAATACTATAGG - Intronic
1117095930 14:52297828-52297850 GTTACTATATTGAAAACTGTAGG + Intergenic
1117718847 14:58608293-58608315 GTTACTGTATTGAATACTGTAGG + Intergenic
1117742447 14:58832950-58832972 GTTACTGTACTGAATACTATAGG + Intergenic
1117835102 14:59796186-59796208 GTTACTGTATTGAATACTGTAGG - Intronic
1118252541 14:64176215-64176237 GTGCCTGCATTTTCAACTATAGG - Intronic
1120725517 14:87935435-87935457 GTTACTGTTTTTCCAACTTAAGG - Intronic
1120731217 14:88003314-88003336 AATACTGTATTTTCAACTATAGG - Intergenic
1121968409 14:98332345-98332367 TTTTCTGTATATACAATTATTGG - Intergenic
1123102572 14:105815359-105815381 GATACTGTATTCAGAAGTATTGG + Intergenic
1124113517 15:26816714-26816736 GTTACTGGATATACCACAATTGG - Intronic
1124256378 15:28146047-28146069 ATTACTGTATTTAAAAGTATGGG + Intronic
1124567863 15:30833109-30833131 ACTACTGTATTTAAAAGTATGGG - Intergenic
1125227857 15:37415259-37415281 GTTACTGTATGTACAATGAAAGG - Intergenic
1125899729 15:43334178-43334200 GTTTCTTTATTTACAAAAATGGG - Intronic
1125990705 15:44104630-44104652 GTTACTGTACTGAATACTATAGG - Intronic
1126378586 15:48022020-48022042 GTTACTGTATTGAATACTGTAGG + Intergenic
1126653562 15:50952054-50952076 TTTACTGTATCTGCATCTATAGG + Intronic
1126694169 15:51312335-51312357 GTTAATGTGTTTACATATATGGG - Intronic
1127705486 15:61543133-61543155 GTTACTGTACTGAATACTATAGG + Intergenic
1127898030 15:63320110-63320132 GTTACTGTACTGAATACTATAGG - Intergenic
1130347427 15:83061192-83061214 GTTACTGTACTGAATACTATAGG + Intronic
1131364912 15:91830721-91830743 GTTACTGTATTGAATACTGTGGG - Intergenic
1131670354 15:94613220-94613242 GTTACTGTACTGAATACTATAGG - Intergenic
1133782547 16:8951144-8951166 ATTTCTGTATTTAAAACTGTAGG + Intronic
1138036345 16:53610673-53610695 GTTACAGTCTTTACAACTACAGG + Intronic
1140160833 16:72491735-72491757 GCTACTGTATTTAAAACCACAGG - Intergenic
1143206225 17:5141123-5141145 GTTACTGTATTGAACACTGTAGG - Intronic
1144931488 17:18862724-18862746 AATCCTGTATTTACAACTACAGG + Intronic
1145371958 17:22314069-22314091 TTTAATGTATATACAAATATAGG + Intergenic
1145375327 17:22342267-22342289 TTTAATGTATATACAAATATAGG + Intergenic
1147699861 17:42387119-42387141 CTTACTGTATGTGCAACTAAAGG - Intronic
1148518735 17:48248258-48248280 GGTACTGTATGAAAAACTATAGG + Intronic
1150087795 17:62289640-62289662 GTTACTGTATTGAATACTGTAGG + Intergenic
1150966493 17:69975336-69975358 GTTACTGTTCTTAAAACTGTAGG - Intergenic
1151053180 17:71003047-71003069 GTTTCTGTATATACAACCAAAGG + Intergenic
1151072405 17:71230836-71230858 GTTACTGTATTGAATACTGTAGG - Intergenic
1153160465 18:2199114-2199136 GTTACTGTATTGAACACTGTAGG - Intergenic
1154286304 18:13060243-13060265 GTTACTGTACTTAATACTGTAGG + Intronic
1155269933 18:24130796-24130818 GTTACTGTATTGAATACTGTAGG + Intronic
1155439768 18:25850094-25850116 GTTACTGCATTGACTACTGTAGG - Intergenic
1155781875 18:29847936-29847958 GTTACTGTAGTTATTACTTTTGG + Intergenic
1156528892 18:37796056-37796078 GTTACTGTATTGACTACTGTAGG - Intergenic
1156571317 18:38256757-38256779 GTTATTGTCTTTGCCACTATTGG + Intergenic
1157055127 18:44218795-44218817 GTTACTGTATGGAATACTATAGG + Intergenic
1157538496 18:48480465-48480487 ATTAATGTATTTACAGCTAATGG + Intergenic
1157782572 18:50453079-50453101 GTTACTGTATTGAAAACTGTAGG - Intergenic
1158223666 18:55177817-55177839 GTTACTGTGTTCAAAAGTATAGG - Intergenic
1159187308 18:64991834-64991856 GTTACTGTACTTAATACTGTAGG - Intergenic
1159271412 18:66156635-66156657 GTTGCTTTATTTCCAAATATAGG - Intergenic
1162836437 19:13321613-13321635 GTTACTGTACTTAATACTGTAGG + Intronic
1164845230 19:31426647-31426669 GTTACTGTACTAAATACTATAGG - Intergenic
1165572853 19:36790252-36790274 TTTAATGTATATACAAATATAGG - Intergenic
1165648335 19:37464571-37464593 GTTACTGTACTGACTACCATAGG - Intronic
928204268 2:29272946-29272968 GTTGCTGTTTTTACCATTATAGG - Intronic
928469403 2:31558741-31558763 GTTACTGTACTGACTACTGTAGG - Intronic
930181502 2:48363741-48363763 GTTACTGTACTGAATACTATAGG - Intronic
930325515 2:49912118-49912140 GTTACTGTACTTAATACTATAGG - Intergenic
930499489 2:52194352-52194374 GTTACTGTACTTAATACTGTGGG + Intergenic
930690340 2:54356314-54356336 ATTACTGTATTGACAACAACTGG + Intronic
930996437 2:57724532-57724554 GTTAATTTTTTTAAAACTATAGG - Intergenic
931490591 2:62742051-62742073 GTTACTGTATTGAATACTGTAGG - Intronic
932896288 2:75643833-75643855 CTTACTGAATTTAAAACTCTGGG - Intergenic
933021077 2:77193150-77193172 GTTACTGTATTAAATACTGTAGG - Intronic
933040768 2:77463192-77463214 GTTACTGTACTAAACACTATAGG + Intronic
933353092 2:81180693-81180715 GTTACTGTACTGAATACTATAGG - Intergenic
936225957 2:110651826-110651848 GTTATTGTATTGAATACTATAGG - Intronic
936233961 2:110727114-110727136 GTTACTGTATTCAATACTGTAGG + Intergenic
936661828 2:114551403-114551425 TTTACCATATTTACAACTCTAGG + Intronic
937524889 2:122756212-122756234 GTTACTGTCTTCACACCTTTGGG + Intergenic
937593187 2:123639999-123640021 GTGACTGTATTTGGAACTTTAGG + Intergenic
938195836 2:129327143-129327165 ATTTCTGCATTTCCAACTATGGG - Intergenic
939820186 2:146947816-146947838 GTTACTGTATTGAACACTGTAGG + Intergenic
940096722 2:149984658-149984680 GTTACTCTACTAAAAACTATAGG - Intergenic
940191063 2:151040490-151040512 GTTAGTGTGTTTACAAATAGTGG - Intronic
940723920 2:157313256-157313278 GTTACTGTATTGAACACTGTAGG - Exonic
940957083 2:159739349-159739371 ATTACTATTTTTCCAACTATAGG - Intronic
940968212 2:159863924-159863946 GTTACTGTACTGACTACTATAGG - Intronic
941485149 2:166071078-166071100 GCTACTGTATTTATAGCCATTGG - Intronic
941598177 2:167504772-167504794 GTTACTGTACTAAATACTATAGG - Intergenic
942049425 2:172125111-172125133 GTTACTGTACTGAATACTATAGG - Intergenic
942536621 2:176971273-176971295 GTTATTGAACTAACAACTATTGG + Intergenic
942716536 2:178899161-178899183 GTTACTGTATTGAATATTATAGG - Intronic
942824448 2:180157395-180157417 GTTACTATACTTACAAATCTAGG + Intergenic
943604611 2:189962206-189962228 GTTACTGTACTTAATACTGTAGG - Intronic
943655287 2:190502425-190502447 TTTACTGTTTCTACAACCATAGG - Intronic
943867716 2:192949463-192949485 GTTACTGTATTGAATACTGTAGG + Intergenic
944904181 2:204245940-204245962 GTTACAGAATTTTCATCTATTGG + Intergenic
945113200 2:206384085-206384107 GTTACTGTACTGAATACTATAGG + Intergenic
945584930 2:211649064-211649086 GTTACATTATCTACAATTATAGG + Intronic
946601038 2:221360484-221360506 GTTAATGTAATTACAAGAATGGG + Intergenic
946812687 2:223542942-223542964 GTAACTGGAATTACAATTATAGG + Intergenic
946987937 2:225294339-225294361 GTTACTGTATTGAATACTGTAGG + Intergenic
1168993994 20:2118822-2118844 GTTACTGTACTGAATACTATAGG - Intronic
1169618941 20:7482634-7482656 GTTTCTGCCTTTACTACTATGGG - Intergenic
1169619810 20:7492750-7492772 GTTTCTGCCTTTACTACTATGGG - Intergenic
1169871252 20:10250862-10250884 GTTACTGTACTGAATACTATGGG - Intronic
1171527608 20:25827517-25827539 TTTAATGTATATACAAATATAGG - Intronic
1171549218 20:26028367-26028389 TTTAATGTATATACAAATATAGG + Intergenic
1172568630 20:35951974-35951996 GTTACTGTACTGAATACTATAGG - Intergenic
1173479066 20:43384880-43384902 GTTACTGTCCTGACGACTATAGG + Intergenic
1174982688 20:55414576-55414598 GTTACTGTATTGAATACTGTAGG + Intergenic
1177333125 21:19686485-19686507 GTTTCTGTATTTAAAAATAATGG - Intergenic
1177337510 21:19750338-19750360 GTTACTGTACTGAAAACTTTAGG - Intergenic
1177596148 21:23246019-23246041 GTTACTGTATTGAATACTGTGGG - Intergenic
1178559672 21:33626772-33626794 GATACTGTATTTAATAATATAGG - Intronic
1179621517 21:42619504-42619526 GTTGCTGTCTTTAAAACAATGGG - Intergenic
1179621953 21:42622284-42622306 GTTGCTGTCTTTAAAACAATGGG + Intergenic
1184595809 22:45513541-45513563 GTGACTGTATTTAATACCATTGG - Intronic
951422944 3:22509593-22509615 GTTTCTGTATTCCCAACCATGGG + Intergenic
952975456 3:38690855-38690877 GTTACTGTACTGAATACTATAGG - Intergenic
953495960 3:43387177-43387199 GTTACTGTACTGAACACTATAGG + Intronic
954013997 3:47669783-47669805 TCTACAGTAATTACAACTATTGG + Intronic
954345089 3:49990304-49990326 GTTACTGTATTGAACACCATAGG + Intronic
957241943 3:77671122-77671144 ATTAGTGTATTCACTACTATAGG + Intergenic
957452085 3:80392379-80392401 GTTATTTTATTTTAAACTATTGG + Intergenic
958677007 3:97277620-97277642 GTTACTGTACTTAGTACTTTAGG + Intronic
959569850 3:107871544-107871566 GTTACTGTACTGAATACTATAGG + Intergenic
962187799 3:133278584-133278606 GTTACTGTACTGAATACTATAGG + Intronic
962646129 3:137442228-137442250 GTTACTGTATTGAATACTGTAGG + Intergenic
962896482 3:139719441-139719463 GTTACTGTATTGAATACTGTAGG + Intergenic
963428823 3:145169057-145169079 GGTACTATATTTACGACTGTAGG + Intergenic
964423187 3:156526133-156526155 GTTACTGTACTGAATACTATAGG - Intronic
964430524 3:156601130-156601152 GTTACTGTACTGAGTACTATAGG + Intergenic
964994701 3:162863682-162863704 GTTACTGTATTTACTATTGTGGG - Intergenic
965088518 3:164132383-164132405 TTTACTGCAATTATAACTATTGG + Intergenic
965136635 3:164780676-164780698 TTTACTGTATTTACAATCCTGGG - Intergenic
966499109 3:180618069-180618091 GTTACTGTACTGAGTACTATAGG - Intronic
966721652 3:183068822-183068844 GTTACTGTATTGAATACTGTAGG - Intronic
967227766 3:187309003-187309025 GTTACTGTACTGAATACTATAGG - Intergenic
970045074 4:11842908-11842930 GTTACTGTATTGAATACTGTAGG + Intergenic
970049901 4:11901920-11901942 GTTAGTGTATTTAAAAACATGGG - Intergenic
970889027 4:21021120-21021142 GTTACTGTATTGAATACTATAGG + Intronic
972710187 4:41587860-41587882 GTTACTGTTTTTTCAATAATGGG - Intronic
973071818 4:45869503-45869525 GTTACTGTATTGAATACTATAGG + Intergenic
974210678 4:58770553-58770575 GTTACTGTATATATACCTAAAGG - Intergenic
975366675 4:73537633-73537655 GTTACTGAGTTTGCAAATATTGG - Intergenic
976598684 4:86917840-86917862 GTTACTGTACTGAATACTATTGG + Intronic
976651728 4:87442240-87442262 GTTACTGTACTGAATACTATAGG + Intronic
976822243 4:89219726-89219748 GTTACTGTACTGAAAACTGTAGG - Intergenic
977324657 4:95559919-95559941 GTTACTGTACTGAATACTATAGG - Intergenic
977519915 4:98068843-98068865 GTTACTGTACTTAATACTGTGGG + Intronic
977634114 4:99276063-99276085 TTTCCTGGATTTACAACTCTTGG + Intergenic
977636763 4:99307289-99307311 TTTCCTGTATTTAGAACTCTTGG + Exonic
978330398 4:107606784-107606806 GTTACTGTACTGAATACTATAGG - Intronic
978698167 4:111608605-111608627 GTTACTGTACTGAACACTATAGG - Intergenic
979504000 4:121473662-121473684 GTTACTGTACTCAATACTATAGG + Intergenic
979650279 4:123121595-123121617 GTTACTGTATTCAACACTGTAGG - Intronic
979871713 4:125831603-125831625 GTTAATGAATTTACAAATATAGG - Intergenic
980049750 4:128027138-128027160 GTTACTGTACTTAATACTGTAGG - Intronic
981008962 4:139904834-139904856 GTTACTGTACTGAATACTATAGG + Intronic
981224981 4:142283600-142283622 GTTACTGTACTGAATACTATGGG + Intronic
982345783 4:154356662-154356684 GTTACCGCATTGACTACTATAGG - Intronic
982776960 4:159451939-159451961 GTTACTGTATTAAATACTGTAGG - Intergenic
983483525 4:168305106-168305128 GTTACTGTATTGAGTACTCTAGG - Intronic
983500752 4:168496648-168496670 GTTACTGAATTTACTATTTTAGG + Intronic
984285452 4:177722906-177722928 GTTACTGTACTGAATACTATAGG + Intergenic
984746358 4:183223141-183223163 GTTACTGTACTGAAAACTGTAGG - Intronic
986825595 5:11518719-11518741 GTTACTGTATTGAATACTGTAGG - Intronic
987365959 5:17148973-17148995 GTTACTGTACTGAAGACTATAGG - Intronic
987603532 5:20103934-20103956 GTTACTGTATTGAATACTGTAGG - Intronic
987641986 5:20624399-20624421 ATTAATGTTTTTACAACCATAGG - Intergenic
988048730 5:25995160-25995182 CTTGCTGTATTTCCAACTCTTGG + Intergenic
989132097 5:38117219-38117241 GTTACTGTATTGAATACTGTAGG + Intergenic
989827665 5:45877970-45877992 GTTACTGTATTGAATACTCTGGG - Intergenic
989946541 5:50239292-50239314 GATATTTTCTTTACAACTATAGG + Intergenic
991382537 5:66045340-66045362 GTTACTGTACTGAACACTATAGG - Intronic
991708043 5:69378863-69378885 GTTACTGTATTGAATACTGTAGG + Intronic
992068470 5:73128510-73128532 ATTACAGTATTTTCAACTATGGG + Exonic
992909770 5:81384538-81384560 GTTACTGTACTGAAAACTGTAGG - Intronic
993066572 5:83106368-83106390 AATACTGTATTTATAACTTTAGG + Intronic
993716986 5:91284788-91284810 GTTACTGTACTGAATACTATAGG - Intergenic
993853424 5:93040051-93040073 GTTACTGTATTGAATACTGTAGG - Intergenic
994471081 5:100208728-100208750 GTTATTTTATTTACCTCTATAGG + Intergenic
995176659 5:109185914-109185936 GTTACTGTATTGAATACTACAGG + Intronic
995513998 5:112936523-112936545 GCTACAGTAATTAAAACTATGGG + Intergenic
995612763 5:113927743-113927765 GTGACAGCATTTACAACTAATGG + Intergenic
995951992 5:117726616-117726638 GTTACTGTACTAAATACTATAGG - Intergenic
996138351 5:119873447-119873469 GTTACTATATTGAATACTATAGG + Intergenic
996180473 5:120412673-120412695 GTTACTGTGTTGATAACTGTAGG + Intergenic
996870452 5:128186134-128186156 GTTACTGTAGTGAATACTATAGG - Intronic
997344239 5:133174711-133174733 GTTACTGTACTCAATACTATAGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998615810 5:143739050-143739072 GTTACTGTATTGAATACTGTAGG + Intergenic
1000078262 5:157815800-157815822 GTTACTGTAATGACTACTATAGG + Intronic
1000117086 5:158163589-158163611 AATACTGTATTTACAAAAATAGG - Intergenic
1000410586 5:160932590-160932612 GTTACGCTATTTATAACTATTGG + Intergenic
1000452667 5:161409272-161409294 ATTTCCGTCTTTACAACTATAGG - Intronic
1000762046 5:165238278-165238300 GTCATTGTATTTACAATTCTAGG + Intergenic
1003381341 6:5626945-5626967 GTTACTGTATTGAATACTGTAGG + Intronic
1004587741 6:17018792-17018814 GTTACTGTACTTAATACTGTAGG - Intergenic
1005748200 6:28859298-28859320 GTTACTGTATTGAATACTGTAGG + Intergenic
1006214163 6:32424939-32424961 GTGACTGTATTGAATACTATTGG - Intergenic
1006555388 6:34861633-34861655 AATACTGTTTTTACAACAATAGG + Intronic
1008593936 6:53022429-53022451 GTTACTGTACTGAATACTATAGG - Intronic
1008842449 6:55920214-55920236 GTTACTGTATTGAATAATATAGG + Intergenic
1008849637 6:56009563-56009585 GTTACTGTACTGAATACTATGGG + Intergenic
1008856287 6:56091866-56091888 GTTACGGTTTTTTCAACTACTGG + Intronic
1008900030 6:56602347-56602369 GTTACTGTACTGACTACTGTAGG - Intronic
1008955961 6:57216118-57216140 GTTACTGTATTGAATACTGTAGG - Intronic
1009158988 6:60258453-60258475 GTTACTAAACTGACAACTATTGG + Intergenic
1009677992 6:66851781-66851803 ATTACTGTATTGAATACTATAGG + Intergenic
1009837805 6:69026745-69026767 GTTACTGTATTGAATACTGTAGG + Intronic
1010091555 6:71988764-71988786 GTAACTGTTATTACAACTATTGG + Intronic
1011028276 6:82893590-82893612 GTTTCTGTTTTCAAAACTATTGG - Intronic
1011399661 6:86946358-86946380 GTTACTGTATTGAATACTGTAGG - Intronic
1012236565 6:96823829-96823851 GTTACTGTATTGAATACTGTAGG - Intronic
1012738718 6:102985009-102985031 GTTACTGTACTAAATACTATAGG + Intergenic
1013238419 6:108220454-108220476 GTTACTGTACTTAATACTACAGG - Intronic
1013252795 6:108350981-108351003 GTTACTGTATTGAATACTGTAGG + Intronic
1014227786 6:118867607-118867629 GTTACTGTATGGAATACTATAGG - Intronic
1014900281 6:126955018-126955040 GTTACAGTATCTAGATCTATTGG - Intergenic
1014928172 6:127299926-127299948 GTTACTGTATTGAATACTATAGG - Intronic
1015139592 6:129914540-129914562 GTTACTGTACTAAATACTATAGG - Intergenic
1015238730 6:131000111-131000133 TATACGGTATTTACATCTATAGG - Intronic
1015689172 6:135901736-135901758 TTTACTGTACTTACAGCAATTGG + Intronic
1017262217 6:152400534-152400556 GTGCCTGTAGTTCCAACTATTGG + Intronic
1018562885 6:165120597-165120619 GTTACTGTACTGAGTACTATAGG - Intergenic
1018577243 6:165272577-165272599 ATAACTATATTTACAAATATAGG + Intergenic
1018786635 6:167113492-167113514 GATACTGTAGTTCCAAGTATTGG + Intergenic
1020595079 7:10196580-10196602 GTTACTGTGTTTATGACTAGTGG + Intergenic
1020895356 7:13932424-13932446 GATACTGTATTTGAATCTATTGG - Intronic
1021354570 7:19637960-19637982 GTTACTGTACTGAATACTATAGG + Intergenic
1022267378 7:28770601-28770623 GTAACTGTCTTTACCACAATTGG - Intronic
1023236151 7:38090421-38090443 GTTACTGTACTGAATACTATAGG + Intergenic
1025297265 7:57785717-57785739 TTTAATGTATATACAAATATAGG + Intergenic
1025298033 7:57792351-57792373 TTTAATGTATATACAAATATAGG + Intergenic
1026227081 7:68451628-68451650 GTTACTGTATTTAATACTGTAGG + Intergenic
1027798677 7:82724567-82724589 GTTACTGTACTAAATACTATAGG + Intergenic
1028693882 7:93685668-93685690 GGTACTGTATTTATAATTGTTGG - Intronic
1028878806 7:95855692-95855714 GTTACTATATTGAATACTATAGG + Intronic
1031247556 7:119335709-119335731 GTTACTGTACTGAAAACTGTAGG + Intergenic
1031663668 7:124458449-124458471 GCTACTGTATTTAAAAATAAGGG - Intergenic
1034279257 7:149840719-149840741 GTTACTGTACTGAAAACTGTAGG - Intronic
1034554969 7:151844664-151844686 GTTAGTGTATTTCAAACTTTTGG - Intronic
1034871096 7:154684539-154684561 GTTTCTGTGTTTTCACCTATTGG + Intronic
1036447468 8:8834545-8834567 GTTACTGTAATCAATACTATAGG - Intronic
1037867119 8:22453754-22453776 GTTACTCTATTTAATACTGTAGG + Intronic
1038123792 8:24648237-24648259 GTTACTGTATTGAATACTATAGG + Intergenic
1038471125 8:27821952-27821974 GTTACTGTACTGAATACTATAGG - Intronic
1038922857 8:32104215-32104237 GTTACTGTACTTAATACTGTAGG + Intronic
1039108066 8:34010990-34011012 GTTACTGTATTGAATACTGTAGG + Intergenic
1041148774 8:54909877-54909899 GTTGCAGTACTTTCAACTATCGG - Intergenic
1041393664 8:57370048-57370070 GTAACTGTATTTAAGACTACTGG + Intergenic
1041685271 8:60638866-60638888 GTTATTGTTTTTACAAAAATGGG - Intergenic
1041874604 8:62673728-62673750 GTTACTGTACTGAATACTATAGG + Intronic
1041894833 8:62912114-62912136 GTTACTGTACTGAATACTATAGG + Intronic
1042310709 8:67376511-67376533 GTTACTGTACTGAAAACTGTAGG + Intergenic
1043174248 8:77003928-77003950 GTTACTGTACTGAGTACTATAGG + Intergenic
1043657141 8:82682817-82682839 TTTACTGAATATACAACTCTAGG + Intergenic
1043755370 8:83997293-83997315 GTTACTGTATTGAATACTGTAGG + Intergenic
1044553007 8:93533006-93533028 GTTACTGTATTGAGTACTGTAGG - Intergenic
1044958571 8:97506790-97506812 TTTCCTGTATGTACAAATATAGG + Intergenic
1045852717 8:106722631-106722653 GTTACTGTACTGAATACTATAGG - Intronic
1046281676 8:112041891-112041913 GTTACTGTATGGAATACTATAGG - Intergenic
1046572704 8:115986570-115986592 GTTTCCGTATTTCCTACTATAGG - Intergenic
1046581420 8:116097489-116097511 TCTACTGTATTTACAACAGTGGG + Intergenic
1046838908 8:118835970-118835992 GTTACTGTACTGACTGCTATAGG - Intergenic
1047118109 8:121868366-121868388 GTTCCTGTACTGACTACTATAGG - Intergenic
1047146913 8:122211875-122211897 TTTACTGTAATTACTACTTTAGG - Intergenic
1049123206 8:140758961-140758983 GTTACTGTATTGAATACTGTGGG - Intronic
1050298903 9:4236501-4236523 GTTACAGTATTTGCAAATATTGG + Intronic
1050406965 9:5319661-5319683 GTTAGTTTATTTACAATAATTGG + Intergenic
1050436714 9:5618883-5618905 GTTACTGTACTGAATACTATAGG + Intergenic
1050517695 9:6462141-6462163 GATACTTTATTTACAAAAATAGG - Intronic
1050533957 9:6614884-6614906 GTTACTGTACTGAATACTATAGG + Intronic
1050664797 9:7923560-7923582 GTTACTGTATTGAATACCATAGG - Intergenic
1051023729 9:12579285-12579307 AATACTGTATTTTTAACTATAGG + Intergenic
1051136491 9:13927693-13927715 GTTACTGTACTGAGTACTATAGG + Intergenic
1051352427 9:16210350-16210372 GTTAACATTTTTACAACTATGGG + Intronic
1051448679 9:17170919-17170941 GTTACTGTACTGAATACTATAGG - Intronic
1052156413 9:25197308-25197330 GTTACTGTACTGAATACTATAGG + Intergenic
1052419621 9:28225517-28225539 TTCACTGCATTTAAAACTATTGG - Intronic
1052530553 9:29678641-29678663 TTCACTGTAGTTGCAACTATGGG - Intergenic
1053795569 9:41723688-41723710 TTTAATGTATATACAAATATAGG - Intergenic
1053798957 9:41751466-41751488 TTTAATGTATATACAAATATAGG - Intergenic
1054146253 9:61563487-61563509 TTTAATGTATATACAAATATAGG + Intergenic
1054149615 9:61591188-61591210 TTTAATGTATATACAAATATAGG + Intergenic
1054183979 9:61935743-61935765 TTTAATGTATATACAAATATAGG - Intergenic
1054187372 9:61963525-61963547 TTTAATGTATATACAAATATAGG - Intergenic
1054465985 9:65494578-65494600 TTTAATGTATATACAAATATAGG + Intergenic
1054469379 9:65522298-65522320 TTTAATGTATATACAAATATAGG + Intergenic
1054651142 9:67625005-67625027 TTTAATGTATATACAAATATGGG + Intergenic
1054654526 9:67652743-67652765 TTTAATGTATATACAAATATAGG + Intergenic
1055204921 9:73717243-73717265 GTGACTGTATTTACAAATTTTGG + Intergenic
1055608851 9:78000201-78000223 TTTCCTGAATTTAAAACTATAGG + Intronic
1056037037 9:82617721-82617743 GTTACTGTATTAAATACTGTAGG + Intergenic
1057990072 9:99759264-99759286 GTTACTGGATATACAACCAAAGG - Intergenic
1058210933 9:102169259-102169281 GTTACTGTAGTGAATACTATAGG + Intergenic
1058351127 9:104025423-104025445 GTTACTGTATTGAATACTGTAGG + Intergenic
1058511696 9:105725636-105725658 GTTACTGTAGTGACTACTATAGG + Intronic
1059200304 9:112408643-112408665 GTTACTGTACTGACTACTGTAGG + Intronic
1186012999 X:5158025-5158047 GTTACTGTATTGAATACTATAGG - Intergenic
1186911044 X:14166034-14166056 CTTACTGTATTTATTACTATGGG + Intergenic
1187819166 X:23267567-23267589 GTTACTGTACTAAATACTATAGG + Intergenic
1187934644 X:24323776-24323798 GTTACTGAATTGAATACTATAGG + Intergenic
1188184925 X:27101989-27102011 TTTTCTGTTTTTCCAACTATAGG - Intergenic
1188619454 X:32202254-32202276 ATTACTGTAATTAAAAATATAGG - Intronic
1190035481 X:47019349-47019371 GTTACTGTAATAACAACTCTAGG - Intronic
1190046803 X:47118165-47118187 GTTACTATATTTATACATATAGG - Intergenic
1192111697 X:68371566-68371588 GTTACTGTACTGAATACTATAGG - Intronic
1193553465 X:82927685-82927707 GGAACTGTATTTAAAAATATTGG - Intergenic
1194928060 X:99851353-99851375 GTTAATGTATTTTAAAATATCGG - Intergenic
1196566557 X:117212108-117212130 GTTACTGTATTGAATACTGTAGG - Intergenic
1196627088 X:117888873-117888895 GTTACTGTACTGAATACTATAGG - Intergenic
1197193700 X:123677116-123677138 GTTACTATATTGAATACTATAGG + Intronic
1197850857 X:130858616-130858638 GTTACTGCATTTACCTCTCTAGG - Intronic
1198662386 X:138983934-138983956 TCTACTGTATTGATAACTATAGG - Intronic
1201637402 Y:16139482-16139504 GTTGCTGTATTTACAACTTGAGG - Intergenic
1201977232 Y:19865100-19865122 TTTACTGTATTTAAAAGTTTAGG - Intergenic