ID: 1079437720

View in Genome Browser
Species Human (GRCh38)
Location 11:20474517-20474539
Sequence AGTCCTGGCAGAGCAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079437720_1079437723 -1 Left 1079437720 11:20474517-20474539 CCAGCGGCTGCTCTGCCAGGACT 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1079437723 11:20474539-20474561 TCTATACAGGTGCTATGTATTGG 0: 1
1: 0
2: 0
3: 2
4: 97
1079437720_1079437726 16 Left 1079437720 11:20474517-20474539 CCAGCGGCTGCTCTGCCAGGACT 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1079437726 11:20474556-20474578 TATTGGACCGAAGGCCCTGGTGG 0: 1
1: 9
2: 29
3: 68
4: 248
1079437720_1079437724 7 Left 1079437720 11:20474517-20474539 CCAGCGGCTGCTCTGCCAGGACT 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1079437724 11:20474547-20474569 GGTGCTATGTATTGGACCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1079437720_1079437727 21 Left 1079437720 11:20474517-20474539 CCAGCGGCTGCTCTGCCAGGACT 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1079437727 11:20474561-20474583 GACCGAAGGCCCTGGTGGTGTGG 0: 2
1: 41
2: 119
3: 248
4: 398
1079437720_1079437725 13 Left 1079437720 11:20474517-20474539 CCAGCGGCTGCTCTGCCAGGACT 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1079437725 11:20474553-20474575 ATGTATTGGACCGAAGGCCCTGG 0: 1
1: 2
2: 14
3: 38
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079437720 Original CRISPR AGTCCTGGCAGAGCAGCCGC TGG (reversed) Intronic
900214645 1:1475037-1475059 AGGCCTGGTTGAGCAGCCTCAGG + Intronic
900221854 1:1513386-1513408 AGGCCTGGTTGAGCAGCCTCAGG + Intronic
900403059 1:2480540-2480562 AGAGCTGGCAGAGCAGCCCCCGG - Intronic
900409833 1:2507520-2507542 TGTCCTGGCAGAGGAGCCCGGGG - Intergenic
900498928 1:2990157-2990179 AGGCCTGGCAGAGAACCCGGAGG - Intergenic
900606363 1:3525389-3525411 AGTCCAGGCAGCGCAGATGCGGG - Intronic
901564928 1:10106318-10106340 AGTCCTCACAGTGCAGCCTCTGG + Exonic
902317485 1:15633452-15633474 AGTCCTGGTGGAGCAGCAGCAGG + Exonic
902683956 1:18063660-18063682 AGGCCTGGCCCAGCAGCAGCTGG + Intergenic
905480970 1:38261743-38261765 AGTTCCAGCAGAGCAGCCCCTGG - Intergenic
905482508 1:38271301-38271323 AGTGAGGGCAGAGCAGCCTCAGG - Intergenic
905784225 1:40740167-40740189 CATCCTGGCAGAGCAGACACTGG + Intronic
906105315 1:43288277-43288299 GCTCCTGGCTGAGGAGCCGCGGG - Intergenic
906531944 1:46528823-46528845 AGTTCTGGAAGAGGAGGCGCTGG - Intergenic
907438624 1:54464953-54464975 AGCTCTGGCAGAGCAGTCACAGG + Intergenic
910746937 1:90584066-90584088 AGCCCCGTCAGAGCAGTCGCTGG - Intergenic
912212558 1:107570912-107570934 GGCCCGGGCAGAGCCGCCGCAGG - Intergenic
912770308 1:112457339-112457361 AGTATTGGAAGAGCAGCTGCTGG - Exonic
915331452 1:155115223-155115245 AGTCCCAGCACAGCAGCCCCAGG - Intergenic
915894430 1:159800487-159800509 AGTCCCTGCAGGGCAGCAGCTGG - Intergenic
916023325 1:160813625-160813647 TGTCCCTGCAGAGCAGCTGCAGG + Exonic
917970391 1:180202249-180202271 AGTCTTGCCAAAGCAGCAGCTGG - Exonic
918065212 1:181095922-181095944 AGTCGGGGCAGAGCAGCTGTTGG + Intergenic
920380150 1:205530447-205530469 AGCCCCAGCAGAGCAGCCCCGGG + Intronic
920491131 1:206416234-206416256 AGTCGTGGCAGAGGAGGCGAGGG - Intronic
922423034 1:225471970-225471992 AGACCTAGCAGGGCAGCCCCGGG + Intergenic
924741291 1:246795489-246795511 TCTCCAGGCAGAGCAGCAGCTGG - Intergenic
1063472201 10:6297194-6297216 AGTGCTGGAAGAGCAGCCCAGGG + Intergenic
1063807796 10:9667082-9667104 ACTCCTGTCAGTTCAGCCGCTGG + Intergenic
1067806573 10:49397203-49397225 AGGCCTGGCAGGCCCGCCGCTGG + Intergenic
1069053207 10:63815993-63816015 AGTTTCAGCAGAGCAGCCGCTGG - Intergenic
1070729304 10:78814224-78814246 AATACTGTCAGGGCAGCCGCTGG - Intergenic
1072226999 10:93379642-93379664 AGTGATGGCAGAGCAACCGGGGG + Intronic
1072753191 10:97999166-97999188 AGTCCTGGGTCAGCAGCCCCAGG - Intronic
1075659204 10:124181695-124181717 ACACCTGGCAGAGCAGCGGCTGG - Intergenic
1075714424 10:124547933-124547955 TGTCCAGGCAGGGCAGCCTCTGG + Intronic
1077021038 11:417256-417278 AGTCCTCCCAGAGCCGCTGCAGG - Intronic
1077035968 11:494661-494683 CGTCCAGGGAGAGCAGCAGCAGG + Exonic
1077106178 11:843512-843534 GGTCCTGCCAGTGCAGCCTCCGG - Intronic
1077535052 11:3120079-3120101 AGAGCTGGCAGGGCAGCCCCGGG + Intronic
1077536844 11:3128659-3128681 AGTCCTGGCAGGGTAACCCCAGG - Intronic
1077551332 11:3201693-3201715 AGTCCTAGCAGTGCAGGCTCAGG - Intergenic
1078168561 11:8911289-8911311 AGTCCTGGCTGGGCTCCCGCTGG + Intronic
1078720478 11:13879430-13879452 GTTCCTGGCAGAACTGCCGCCGG - Intergenic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1080975494 11:37335094-37335116 AGTCCTGGCAATGCAGCTACAGG + Intergenic
1083200914 11:61120559-61120581 GGTCCTGGAACAGCAGCAGCTGG + Intronic
1083774521 11:64887977-64887999 AGGCCTGGGGGAGCAGCCCCTGG - Intronic
1090768131 11:129895193-129895215 GGTCCTTCCAGAGCAACCGCCGG + Intronic
1090836228 11:130456003-130456025 AGTCCAGGCAGCACAGCGGCAGG - Intronic
1091335348 11:134762254-134762276 AGTCCCGGTAGAGGAGGCGCCGG + Intergenic
1091752641 12:3032398-3032420 GGTCCTGGGACAGGAGCCGCTGG + Intronic
1092487415 12:8914588-8914610 AGGCCTGGCTGAGCCGCGGCCGG + Exonic
1095906093 12:47379640-47379662 ACTCATGGAAGAGCAGCTGCAGG - Intergenic
1096946757 12:55415053-55415075 AGGCCTGGCTGAGCCGCGGCCGG - Intergenic
1097053792 12:56238537-56238559 GTGCCTGGCAGAGCAGCCCCTGG - Exonic
1097164782 12:57078248-57078270 TGGGCAGGCAGAGCAGCCGCGGG - Intronic
1098521632 12:71440139-71440161 AGACCTGGGAGAGCTGCCCCCGG - Exonic
1104159403 12:126163960-126163982 AGGCCTGGAAGAGCAGCTCCAGG - Intergenic
1106248413 13:27967076-27967098 TGTCCCGGGAGAGCGGCCGCGGG - Intronic
1110555569 13:76855776-76855798 AGTGCTGGCATTGCAGCCGTGGG - Intergenic
1118339112 14:64879873-64879895 GCTCCTGGCACAGCGGCCGCCGG + Exonic
1119731733 14:76955571-76955593 AGTCCTGGGAGGACAGCCTCAGG - Intergenic
1121873324 14:97429262-97429284 AGTCCAGGCAGAGCTGAGGCTGG - Intergenic
1122241960 14:100375090-100375112 GATCCTGGCTGAGCAGTCGCGGG - Intronic
1122277630 14:100603428-100603450 AGTCCTGGCTGAGCAGGGGAAGG - Intergenic
1122459500 14:101883634-101883656 AGTCCTGTCAGAGGAGACGATGG - Intronic
1122695748 14:103551258-103551280 AGGCATGGCACAGCGGCCGCTGG + Intergenic
1122717005 14:103701905-103701927 TGGCCTGGCAGAGCAGCTCCTGG - Intronic
1122953672 14:105060173-105060195 GATCTTGGCAGAGCAGCAGCTGG - Intronic
1122970102 14:105149032-105149054 ATGCCTGGCACAGCAGCCTCCGG - Exonic
1123091909 14:105745679-105745701 AGCCAGGGCAGAGCAGCTGCAGG - Intergenic
1123092032 14:105746201-105746223 AGCCAAGGCAGAGCAGCCGCAGG - Intergenic
1123097494 14:105773409-105773431 AGCCAGGGCAGAGCAGCTGCAGG - Intergenic
1123964014 15:25438265-25438287 AGTCCTGGCTGAGCGACGGCGGG - Intronic
1124085764 15:26549277-26549299 AGTCCTGCCTGAGAAGGCGCCGG + Intronic
1126368142 15:47917427-47917449 AGTCCTAGAAGAGCAGGAGCTGG + Intergenic
1127905823 15:63375023-63375045 AGGCCTGCCAGAGAAGCAGCTGG - Intronic
1128449764 15:67798500-67798522 TGTACTTACAGAGCAGCCGCAGG - Intronic
1129600474 15:76995469-76995491 AGTCCTGGCAGGGCTGGCCCAGG - Exonic
1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG + Intronic
1132010282 15:98268943-98268965 GGACCGGGCAGAGCAGCGGCTGG + Intergenic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132882791 16:2169872-2169894 AGGCTCGGCAGAGCAGCAGCTGG + Intronic
1132896933 16:2233620-2233642 GGTACTGGAAGTGCAGCCGCTGG + Exonic
1135550680 16:23396010-23396032 CGTCCTAACAGAGCAGCCACTGG + Intronic
1136135897 16:28256820-28256842 AGTCTTGGCAGAGCAGAGGTAGG + Intergenic
1137731451 16:50693523-50693545 GGTCCCGGCAGAGCAGGGGCGGG + Intergenic
1137786171 16:51139575-51139597 TGGCCTGGCAGAGCAGCTACAGG - Exonic
1139544900 16:67645487-67645509 AGTCCTTGCACAGAAGCCACTGG - Intronic
1141537136 16:84689916-84689938 AGTCTTGGCAGAGATGGCGCTGG - Intergenic
1142228056 16:88887001-88887023 AGTCTTCCCAGAGCTGCCGCGGG + Intronic
1142967661 17:3591337-3591359 AGTCCTGGGACAGCAGCCTGTGG + Exonic
1143382032 17:6502583-6502605 AGAGCTTGCAGAGCAGCCACAGG + Intronic
1144646879 17:16981121-16981143 ACTCCTGGCAGGGCAGCAGCAGG - Intergenic
1144759113 17:17697318-17697340 AGTCCTGGCCGAGGGGCAGCGGG + Intronic
1145790414 17:27623159-27623181 AGCCCTGGCAGAGCTGCCCCTGG - Exonic
1145936379 17:28717212-28717234 CGTCCTGGCGGAGCTGCCCCAGG - Exonic
1147747144 17:42701710-42701732 AGTTCTGGCTTAGCAGCTGCAGG - Exonic
1148323542 17:46771225-46771247 GGCCCTGGCAGCGCAGGCGCGGG - Intronic
1149498429 17:57133807-57133829 GATCCTGGCAGACCAGCCCCAGG + Intergenic
1151787734 17:76283490-76283512 AGTCCTGCCTGAGGAGCAGCTGG - Intronic
1152305590 17:79518625-79518647 AGGCCTGGCGGAACAGCCCCTGG + Intergenic
1152579062 17:81158003-81158025 AGTGCTGGCTGGGCAGCAGCAGG + Intronic
1152633440 17:81420851-81420873 AAGCCTGGCAGAGCGGCCCCAGG + Intronic
1153012447 18:551397-551419 AGTCCTGACAGAGGTGCCCCAGG + Intergenic
1160116253 18:76082102-76082124 AGTCCTGGAAAAGCAGCCAGGGG - Intergenic
1160658572 19:287748-287770 AGACCTGCAAGAGCAGCCGCAGG + Exonic
1160818977 19:1049354-1049376 AGTCCAGGCTGAGCCCCCGCAGG - Exonic
1160826189 19:1081624-1081646 AGTCCTGGCCGAACAGCTGCAGG - Exonic
1161087339 19:2341155-2341177 AGCCCTGTCAGAGCAGCCCGGGG - Exonic
1162739007 19:12763353-12763375 ATTCCTGGCACAGCAGCGGCTGG - Exonic
1163832068 19:19551826-19551848 AGTCCTGGCGAAGCACCCCCAGG - Intergenic
1164734507 19:30530960-30530982 AGTGCTGGCAGGACACCCGCAGG - Intronic
1166227211 19:41403699-41403721 ATTCCTGCCAGAGCTGCGGCAGG + Intronic
1166899050 19:46044248-46044270 AGTCTTGGCAGAGCGGCCACAGG + Intronic
925058985 2:876496-876518 CAACCTGGCAGAGCAGCCTCTGG - Intergenic
925490862 2:4391139-4391161 ATTCCTGCCTGAGCAGCCTCAGG - Intergenic
925850355 2:8075623-8075645 AGCACTGGCAGAGAAGCCCCTGG + Intergenic
928706496 2:33955243-33955265 AGTCCTGGCACCACAACCGCAGG - Intergenic
928920047 2:36517481-36517503 GGTTCTGGCAGAGCAGCGGTGGG - Exonic
934204062 2:89910666-89910688 ACTCCAGGCAGAGCAGGAGCTGG - Intergenic
934504326 2:94879384-94879406 AGTTCTGGCCCAGCAGCCCCAGG - Intergenic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
937152741 2:119697039-119697061 AGACCTGGCTGACCAGCTGCAGG + Intergenic
937955499 2:127419863-127419885 GGTGCAGGCAGAGCAGCAGCGGG + Intronic
940050238 2:149454875-149454897 AGAGCTAGCAGGGCAGCCGCAGG - Intronic
942764567 2:179439326-179439348 AGACCTGGCAGAGCATCAGATGG - Intergenic
947931201 2:233966641-233966663 AGACTTGGCAGAACAGCTGCTGG + Exonic
948730412 2:239959922-239959944 AGGCCTGGTAGAGCTTCCGCGGG + Exonic
948978340 2:241478474-241478496 GGTCCTGGCACAGCATCTGCTGG - Intronic
949036652 2:241818610-241818632 CGTCCTGGCAGGGCAGTTGCTGG - Intergenic
1171445381 20:25199078-25199100 GGTGCTGGCTGAGCAGCTGCTGG + Intronic
1172129088 20:32644021-32644043 AGTCCTGGCTGGGCAGTCGTGGG - Intergenic
1173622712 20:44448943-44448965 TGTCCTTGCAAAGCAGCCGTGGG + Intergenic
1175246703 20:57586418-57586440 AGGCCTGGCTGAGCAGCCTGGGG + Intergenic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1175738817 20:61406295-61406317 GGTCCAGGCAGAGCAGATGCTGG - Intronic
1175738947 20:61406946-61406968 GGTCCAGGCAGAGCAGACGGAGG - Intronic
1178098454 21:29240378-29240400 AGTCCTGGCACAGTAGCTGCAGG - Intronic
1179482272 21:41685812-41685834 AGTCCTGGCGGTGCTGCTGCTGG + Intergenic
1179658321 21:42859484-42859506 AGTCCTGAGTGAGCGGCCGCAGG + Intronic
1179822238 21:43943646-43943668 AGGCCTGGCAGGCCAGGCGCAGG - Intronic
1184033448 22:41907807-41907829 AGTCCTGGCAGACAAGCCTTTGG - Intergenic
1185014103 22:48333482-48333504 CGCCCTTGCAGAGCAGCCCCAGG - Intergenic
1185056139 22:48579267-48579289 AGGCCTGGCTGGGCAGCCACAGG + Intronic
1185180229 22:49355692-49355714 ATGCCTGGCAGAGCCGCGGCAGG - Intergenic
950487290 3:13281262-13281284 AGTCCTGCCACAGCAGCTGTGGG - Intergenic
951954795 3:28241948-28241970 AGACCGGGCGAAGCAGCCGCCGG - Intronic
952713239 3:36453209-36453231 AGCCCAGGCAGAGGAGGCGCCGG - Intronic
953388341 3:42519918-42519940 AGCTCTGGGAGAGCAGCCCCGGG - Intronic
954108303 3:48420746-48420768 AGGCCTGTGTGAGCAGCCGCTGG - Exonic
954216866 3:49129475-49129497 AGTCCTGGCTGAGAAGCCTCAGG - Intronic
954430823 3:50470119-50470141 AGTCCTGGCAGGGCAGCGCTGGG - Intronic
954718601 3:52539974-52539996 AGGTCTGGCAAAGCAGCAGCTGG + Intronic
968450741 4:674894-674916 CTCCCGGGCAGAGCAGCCGCAGG - Intronic
968746190 4:2361870-2361892 AGTCTTGGCCGAGCTGCGGCAGG + Intronic
968816788 4:2825741-2825763 AGGCCTGGCATGGCAGCAGCTGG + Intronic
969493786 4:7514542-7514564 AGTCATGGCAGGGCAGACACTGG + Intronic
969838251 4:9860876-9860898 AATCCAGGCAGAGGAGCAGCTGG - Intronic
969849170 4:9943117-9943139 AGTCTTGGGAGAGCAGCAGAGGG - Intronic
976125754 4:81832380-81832402 AGACATGGCAGAGCAGGGGCAGG + Intronic
979179457 4:117707375-117707397 AGTCTCAGCAGAGCAGCCACTGG + Intergenic
981614292 4:146630725-146630747 AGTCATGGCTGAGCATCTGCTGG - Intergenic
983196036 4:164807578-164807600 AGTCCTGGCAGATGAACCTCTGG - Intergenic
984116095 4:175683055-175683077 AATCCTGTGAGAGCAGCCACAGG + Intronic
984873755 4:184349684-184349706 ATGCCTGGCAGAGCAGCCATGGG - Intergenic
985766269 5:1781339-1781361 GGACCTGGCAGAGCAGCCTTGGG + Intergenic
986855874 5:11868234-11868256 TGTCCTGACAGAGCAGAGGCAGG - Intronic
994406650 5:99353104-99353126 AGTCATGACTGAGCAGCTGCAGG + Intergenic
1004839668 6:19568851-19568873 AGTCCTGGGAGAGAGGCCTCTGG + Intergenic
1005883061 6:30074855-30074877 AGTTTTGGCAGGGCAGCCGCAGG - Intronic
1006258897 6:32852677-32852699 AGTTCTGGTAGAGCAACCACAGG - Intronic
1006376740 6:33675796-33675818 AGTGCTTGAAGAGCAGCTGCAGG - Exonic
1008563186 6:52742018-52742040 AGTCCTGGCACAGCACCAGTGGG - Intergenic
1011075226 6:83431237-83431259 AGTCCTGGCAGCGCTGCTGGTGG + Intergenic
1012846583 6:104397102-104397124 AGTCCTGAGAGAGCAGCTTCTGG - Intergenic
1013751861 6:113416342-113416364 AGTCCTGGCACTGCACCAGCTGG - Intergenic
1017626211 6:156351709-156351731 AGCCCTGGCAGAGGAGCTGGGGG + Intergenic
1017989115 6:159470927-159470949 AGTCCTTGGAGAGCATCCACAGG - Intergenic
1019463794 7:1175385-1175407 AGGCCAGGCAGCCCAGCCGCAGG - Intergenic
1019710088 7:2514179-2514201 AGACCTGGCAGGGCTGCCGCTGG - Intronic
1022162897 7:27729518-27729540 AGTCCTGGAAGTGCAGTTGCTGG + Intergenic
1022413253 7:30155770-30155792 AGACCTGGGAGAGCTGCAGCTGG + Intronic
1022652973 7:32293986-32294008 AGCCCTGGCAGAGAGGCCCCCGG - Intronic
1025827824 7:65024882-65024904 AATCCTGGCAGAGCAGCAGCTGG + Intergenic
1025915353 7:65861324-65861346 AATCCTGGCAGAACAGCAGCTGG + Intergenic
1026247776 7:68636427-68636449 GCTCCTGGCAGAGCAGCTCCAGG + Intergenic
1027682139 7:81233825-81233847 AGCCCTTCCGGAGCAGCCGCTGG - Intergenic
1028712220 7:93922089-93922111 AGCTCTGGCAGCGGAGCCGCTGG - Exonic
1029464505 7:100716764-100716786 GGTCCTGGGAGAGCAGAGGCTGG + Intergenic
1033659793 7:143395454-143395476 AGTCCTGGCTGGGGAGCCTCAGG + Exonic
1034283767 7:149871198-149871220 AGCCATGGCAGAGCAGTCGGTGG + Intergenic
1034438726 7:151076045-151076067 GGGCCAGGCAGAGCAGCTGCAGG - Exonic
1036485524 8:9175486-9175508 ACTCAAGGCAGAGGAGCCGCTGG + Intergenic
1036761198 8:11509581-11509603 AGACCCGGCAGAGCACCCCCAGG - Intronic
1038394455 8:27236752-27236774 AGTGCTGGGAGCGCAGCCGGCGG + Exonic
1047199826 8:122755778-122755800 ACTCCTAGAAGAGCAGCCGTGGG + Intergenic
1047623823 8:126635321-126635343 AGACCTGGCACAGCAGGAGCCGG - Intergenic
1049003403 8:139840110-139840132 CGGCCTGGCAGAGCAGGCCCAGG + Intronic
1049748997 8:144274753-144274775 AGGCCTGGCAAAGCACCCCCAGG + Intronic
1049787842 8:144459601-144459623 AGTGCTGGCAGGGAAGCCTCGGG - Intronic
1059537444 9:115094756-115094778 AATCCTGGCAAAGCAGGCACTGG + Intronic
1059588647 9:115633121-115633143 AGTCCTAGAAGAGCAGCCCTAGG - Intergenic
1061295564 9:129675089-129675111 AGGCCGGGCAGAGCTGCCGCAGG + Intronic
1061798999 9:133104061-133104083 AGGCCTGGCAGAGCCGGCTCAGG - Intronic
1061856823 9:133446068-133446090 GGTCCTAGCAGAGCGGCCGGGGG + Intronic
1061873848 9:133534435-133534457 TGTCCAGACGGAGCAGCCGCTGG - Intronic
1062016090 9:134292077-134292099 AGCCCTGGCAGAGGAACCCCAGG - Intergenic
1062269983 9:135703940-135703962 ACTGCAGGCAGAGCAGCCGCCGG + Intronic
1062342940 9:136101856-136101878 GGTCCTGGCAGAGGAGCAGCGGG - Intergenic
1062690078 9:137837127-137837149 AGCCCTGCCAGAGGAGCAGCTGG + Intronic
1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG + Exonic
1187698077 X:21940781-21940803 ATGCCTGGGGGAGCAGCCGCGGG - Exonic
1198833802 X:140779930-140779952 AGTCCTGGCAGTACAACCCCTGG + Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic