ID: 1079437925

View in Genome Browser
Species Human (GRCh38)
Location 11:20476488-20476510
Sequence CTGGGTTTCTGGAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079437922_1079437925 -6 Left 1079437922 11:20476471-20476493 CCAAGCGTGGTGTGGTACTGGGT 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG 0: 1
1: 0
2: 2
3: 32
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079437925 Original CRISPR CTGGGTTTCTGGAGGAAAAA TGG Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901573323 1:10179719-10179741 CTGGATGTCTGCAGGGAAAAAGG - Intronic
901828787 1:11879671-11879693 CTGGGCCCCTGGAGGAAGAACGG + Intergenic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903795729 1:25927598-25927620 CTCAGTTTCTGGGGGAGAAAGGG + Intergenic
904337889 1:29809994-29810016 CATGTTTTCTGGAGGAATAATGG - Intergenic
904801951 1:33099283-33099305 CTGGGTACCTGGAGGAAGGAGGG - Intronic
905463356 1:38135396-38135418 ATGGGATGCTGGAGGAAGAAGGG - Intergenic
905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG + Intergenic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
907506657 1:54924022-54924044 ATGGGTTTCAGGAGGAGAGAGGG - Intergenic
907520887 1:55022570-55022592 CTGCGTTTATGGAGGAGAGAAGG - Intergenic
908377704 1:63561261-63561283 CTGAGTTTCAGAAAGAAAAACGG - Intronic
909430097 1:75577474-75577496 CTGGATGTCTGGAAGAAGAAAGG - Intronic
909502756 1:76353861-76353883 CTGGGGTTCTGAAGGTAAAGGGG - Intronic
909905895 1:81194205-81194227 ATGGGTTGATTGAGGAAAAAAGG - Intergenic
911835317 1:102611541-102611563 CTGGTTTTCTGAAATAAAAAAGG + Intergenic
912216860 1:107624259-107624281 CTGTGTTTCTGCAGCAAGAAAGG + Intronic
912965696 1:114235347-114235369 CAGGGCTTCTGGAGAAAAAGAGG - Intergenic
912972956 1:114301389-114301411 CTGGGTTTCACGAGGAAGGAAGG - Intergenic
912999985 1:114570743-114570765 CTAGATTTCTGAAGGAAAAGAGG + Exonic
914362157 1:146944626-146944648 ATGTGTTTCAGGAGGAAGAAGGG + Intronic
914490487 1:148147924-148147946 CTAGGTTCCTGCAGGACAAAGGG - Intronic
914838521 1:151228449-151228471 CTGTCTTTGTGGAGGAAAAGGGG - Intronic
914874622 1:151503625-151503647 TTGGGTGTGTGGAGGAAAACTGG + Intergenic
914877124 1:151520399-151520421 CTGAGCTTCTAGAGGATAAAAGG - Exonic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
916036173 1:160924362-160924384 TGGGGTTTCATGAGGAAAAAAGG + Intergenic
916291060 1:163166679-163166701 TTAGGCTTCTGGAGGAAGAAAGG + Intronic
916510745 1:165470398-165470420 CTGGGTGTCAGGAAGATAAAGGG - Intergenic
917071039 1:171151115-171151137 CTAAGTTTCTGGAGGGAGAAAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918698176 1:187571118-187571140 CAGGGTTTCTAAAAGAAAAAGGG - Intergenic
919210247 1:194473793-194473815 GTGGCTTTCCGGAGGAAAAAGGG - Intergenic
919566661 1:199197757-199197779 TTGGGATTCTGGAGCAGAAAAGG + Intergenic
919794902 1:201315686-201315708 CTGGTTTTATGGCTGAAAAAAGG + Intronic
921301551 1:213755899-213755921 CTGGCTTTCTGGAGTAACAGAGG + Intergenic
921380564 1:214520211-214520233 CAGGCTTTCTTGAGGAGAAAAGG + Intronic
921450027 1:215294717-215294739 CTGTGTTTCTGGCAGAATAAGGG + Intergenic
921815055 1:219554071-219554093 CTGGATTTTGGGAGGTAAAAGGG + Intergenic
923298068 1:232614080-232614102 TGGGGATTTTGGAGGAAAAAGGG - Intergenic
924688655 1:246323457-246323479 TGGAGTTTCTGGCGGAAAAATGG - Intronic
1063299123 10:4835922-4835944 TGGGGTTTGTGGAGCAAAAAAGG + Intronic
1063672755 10:8112542-8112564 ATGGGATTCTGGAGGTAAAATGG - Intergenic
1064925532 10:20564989-20565011 CTGGGTGGGTGGATGAAAAAAGG + Intergenic
1067774789 10:49155320-49155342 CTGGCCTTCTGGAGGGGAAATGG - Intronic
1068537778 10:58259219-58259241 AAGGGTTTCTTGAAGAAAAACGG + Intronic
1070015809 10:72529631-72529653 TTGGTTTGCTGAAGGAAAAAAGG + Intronic
1070062834 10:73001816-73001838 GTGGTTTTCTGCTGGAAAAATGG + Intergenic
1070737321 10:78872108-78872130 CTGAGTTTCTGGCTGGAAAAAGG - Intergenic
1070922082 10:80194355-80194377 CTGGGTTTATGGAGGCACCAGGG + Intronic
1070994356 10:80762960-80762982 CTAGTTTTCTGTGGGAAAAAGGG - Intergenic
1072571119 10:96658294-96658316 CTGGTTTCCTGGAAGAAAATTGG + Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073483546 10:103802318-103802340 CTGGTCTTCTGGATGAGAAACGG + Intronic
1073511875 10:104047534-104047556 CTGAGCTGCTGGAGGAAAACGGG + Intronic
1074234622 10:111572939-111572961 CTGGGTTTAAGGGGGGAAAAAGG + Intergenic
1074505822 10:114069590-114069612 CTGGCTCTGGGGAGGAAAAAAGG - Intergenic
1074674325 10:115831114-115831136 CCGTGTTTCTGGAAGAACAAGGG - Intronic
1076189386 10:128472327-128472349 CTGGCTTTCTGGAGAAACCAAGG - Intergenic
1078635212 11:13043209-13043231 CTGGAATTCAGGAGGAGAAATGG + Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1079983035 11:27171897-27171919 CTGGGTTCCTAGCGGTAAAAAGG - Intergenic
1081207777 11:40294362-40294384 CTGGATTTCTGGATGAAAACAGG - Intronic
1081613651 11:44578196-44578218 CTGGGTGTCCAGAGGAAAAGGGG - Intronic
1081814593 11:45931427-45931449 CTTGGTTTCTGAATGAGAAAAGG + Intronic
1083935465 11:65867716-65867738 CGGGGTTTCTGCAGGAAGACGGG - Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1085150249 11:74246691-74246713 CTGGGTGTGGGGAGGAGAAAAGG - Intronic
1085575851 11:77601834-77601856 CTAGGTTGCTGGAGGATGAAAGG - Intronic
1087346538 11:96978725-96978747 TTGGGTTTCTGTTGGGAAAAAGG - Intergenic
1087500593 11:98948137-98948159 CTGTTTTTTTGGAGGAGAAATGG - Intergenic
1088029656 11:105231128-105231150 CTGTCTTCCTGGAGGCAAAAAGG - Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1088727107 11:112648981-112649003 TTGCATTTCTGTAGGAAAAAGGG + Intergenic
1089433614 11:118443187-118443209 CTGGGAATAGGGAGGAAAAAGGG + Intronic
1089562381 11:119350542-119350564 AGGGGTTTCTGGAGGAAAGGAGG + Intergenic
1090430907 11:126645622-126645644 CTAGGTTTCTGAAGAAGAAAAGG + Intronic
1092895072 12:13002518-13002540 CTGGCTGTCAGGAGGAAAAAGGG - Intergenic
1092968853 12:13672314-13672336 GTGGGTTTGTGGAAGAAATATGG - Intronic
1093000548 12:13991110-13991132 ATAGGGTTCTGGAGGAAGAAAGG + Intergenic
1093006805 12:14059987-14060009 CTGAGTTTCTCAAGGAGAAATGG + Intergenic
1093272101 12:17076319-17076341 CTGGGTTTCTGTAAAAAAAAAGG + Intergenic
1094592508 12:31834915-31834937 CTGGGTATCTGGATGAAATAAGG + Intergenic
1094770605 12:33653857-33653879 ATGGTTTTCTGAAGGAAAAAAGG + Intergenic
1096454655 12:51774949-51774971 CTTGGAACCTGGAGGAAAAAAGG - Intronic
1096861693 12:54533399-54533421 GAGGTTTTCTGGAGGAAGAAAGG - Intronic
1098756545 12:74370805-74370827 CTGGGTCTTTAGAGGAAATATGG - Intergenic
1099009672 12:77276899-77276921 CTAGGAATCTGGAGGAGAAAAGG + Intergenic
1099644227 12:85330391-85330413 ATGGGTCCCTGGAGGAAAATAGG - Intergenic
1101092839 12:101305129-101305151 CTGGTTTTCTGGAGAAAACCAGG + Intronic
1101699011 12:107154143-107154165 CTGGGTATCTAGAGGGGAAAGGG - Intergenic
1102206835 12:111096619-111096641 CTTGCTTTCTGGAGGGAAAGAGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102836908 12:116072300-116072322 CTGGTTTTCTTGATGAACAATGG + Intronic
1103842421 12:123875916-123875938 CTGGGTTTTGGGAGGATGAAAGG + Intronic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1105892184 13:24689720-24689742 CTGGGGCTCAGGAGCAAAAATGG - Intronic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1106671920 13:31915202-31915224 CTGGGCTTCTGGATGAACACTGG + Intergenic
1106726460 13:32491133-32491155 CTGAGATTCTGAAGGGAAAAGGG + Intronic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1109268252 13:60225307-60225329 CTGTGTATCTGGAGGAAGAAAGG - Intergenic
1110268300 13:73564802-73564824 TTGGGTTTCTAGAGGAAAACTGG - Intergenic
1110890252 13:80689617-80689639 CTGGGTTTCAGGAACAAAACTGG + Intergenic
1110948571 13:81455834-81455856 TTATGATTCTGGAGGAAAAAAGG + Intergenic
1113326813 13:109290346-109290368 GTGGGAATCTGGAGGAAGAATGG + Intergenic
1113403521 13:110017692-110017714 CAGTTTTTCTGTAGGAAAAAAGG - Intergenic
1115057831 14:29152406-29152428 TGGAATTTCTGGAGGAAAAAAGG - Intergenic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1116029574 14:39554690-39554712 CTTGGTTTCAGGAACAAAAATGG - Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116545360 14:46158862-46158884 CTGGCTTGCTGGAGAACAAAAGG + Intergenic
1116680481 14:47962785-47962807 CTGAGCTTCTGGAAGAAAATGGG - Intergenic
1117400794 14:55356984-55357006 CTAGCTTTTTTGAGGAAAAACGG - Intronic
1118512111 14:66486825-66486847 CTGGATTCCTAGAGGTAAAAAGG + Intergenic
1118839779 14:69501603-69501625 TTGAGATTCTGGAGGAGAAAGGG + Intronic
1119663852 14:76470278-76470300 TTTGGTTTGTGGAGGGAAAAAGG - Intronic
1120110109 14:80544154-80544176 TTGGGTTTCTGAATGAAAATAGG + Intronic
1120647271 14:87088975-87088997 TTGGTTCTCTGGAGGAAGAAGGG - Intergenic
1121029717 14:90647516-90647538 TTGGGTTTTTGGTGAAAAAAGGG + Intronic
1121334947 14:93071713-93071735 CAGAGTTTGTGGAGGAAAAAAGG - Intronic
1121343148 14:93116526-93116548 CTGGGTTTGGGAAGGAGAAATGG + Intergenic
1121498324 14:94413233-94413255 CTGGATTTCAGTAAGAAAAAGGG + Intergenic
1121832866 14:97066802-97066824 CTGGGTTTCTGAATGACACAGGG - Intergenic
1122012272 14:98759985-98760007 CTGGAGCTCAGGAGGAAAAATGG - Intergenic
1122646023 14:103194730-103194752 CTGGGTCACTGGAGAAAACATGG + Intergenic
1122746670 14:103901168-103901190 CTGCGCTGCTGGAGGAAAAGTGG - Intergenic
1123119518 14:105910246-105910268 CTGCATTTCTGGAAGAACAAGGG - Intergenic
1123180545 14:106466209-106466231 ATCGGTTTCTGGAGGTAAATGGG - Intergenic
1202946354 14_KI270726v1_random:30452-30474 ATCGGTTTCTGGAGGTAAATGGG + Intergenic
1124604191 15:31158861-31158883 CTGGATATCTGGAGAACAAAGGG - Intronic
1124614495 15:31231610-31231632 GTGGGGTTCTGGACTAAAAAGGG + Intergenic
1124803408 15:32857347-32857369 CTGGATCTCTAGAAGAAAAATGG - Intronic
1126386743 15:48100999-48101021 CTTTGTTTATGGAAGAAAAAAGG - Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127486366 15:59421394-59421416 CTTAGTTTCTGGAGGAAAATGGG + Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128197208 15:65769327-65769349 TTATGTTTGTGGAGGAAAAAAGG - Intronic
1128564302 15:68690239-68690261 CTGGGTCTCCAGAGAAAAAAAGG - Intronic
1128877566 15:71214865-71214887 GTCGGTTTTTGGAGGAAAGAGGG - Intronic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1131163150 15:90122479-90122501 ATGGGTTTTTAAAGGAAAAAAGG - Intergenic
1133259344 16:4538316-4538338 CCGGGCTTCTGGAGGTAAAGCGG - Intronic
1134227797 16:12405075-12405097 TTGGGTTTGTGGGGGACAAAAGG - Intronic
1134594589 16:15485658-15485680 CTGTGTTACTGGAGGAAACTGGG + Intronic
1134683489 16:16142743-16142765 CTGTGTTCCTGGAAGAAAACAGG + Exonic
1136082570 16:27861770-27861792 GTGGGTGTCTGGGGGAAGAATGG - Intronic
1136531996 16:30876034-30876056 CTGGCTGCCTGGAGGAACAAAGG + Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1138774356 16:59703674-59703696 GTGGGTTTATGGAGGGAGAAAGG - Intergenic
1139198120 16:64944697-64944719 CTGGGTTTCTGGGGGTGACAGGG - Exonic
1141015891 16:80449078-80449100 CTTGGTGACTGCAGGAAAAAAGG + Intergenic
1143042898 17:4052511-4052533 CTGTGATTCTGGAGTGAAAAAGG - Intronic
1143055421 17:4158563-4158585 AGGGGTTTGTGGAGGCAAAACGG - Intronic
1143098792 17:4493354-4493376 CTGGGTTCCTGAAGGACAAGTGG + Intergenic
1143769247 17:9157547-9157569 CTGGGTTTCTGGTTGGAAAGTGG + Intronic
1143864664 17:9915354-9915376 CTTGGTTTCTTTATGAAAAATGG - Exonic
1143930818 17:10421932-10421954 CTGGGTTCTTGGTGGAAATAAGG + Exonic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1144028600 17:11300406-11300428 CTCGGATTCTGAAGGAAAGAGGG - Intronic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1144459989 17:15450894-15450916 CTGGGTTTGGGGAGGATAATGGG - Intronic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1146603594 17:34239003-34239025 CTGGTTTTCTAGAGAACAAAGGG - Intergenic
1146910523 17:36645601-36645623 CTGGGTTAAGGGAGGATAAAGGG + Intergenic
1148533345 17:48416368-48416390 TTGGGTTTGTGGAGGAGAAGAGG + Intronic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1150127694 17:62648999-62649021 CTGGGTTTCTGGGAGGACAAAGG - Intronic
1150660918 17:67077830-67077852 CTGGGTTTCTGTACCAGAAATGG - Exonic
1151326053 17:73380354-73380376 CTGGGTTTCAGGAAGAACCACGG + Intronic
1151781946 17:76252559-76252581 CTGTGTTTCTGAAGGAGAAGGGG + Intergenic
1153170019 18:2305175-2305197 CTGTCTTTCTGGAATAAAAAGGG + Intergenic
1154446838 18:14441791-14441813 TTGGATTTCTGCTGGAAAAAAGG + Intergenic
1155082790 18:22427410-22427432 GTGGGATTCTGGAAGAGAAAAGG - Intergenic
1157243374 18:46032445-46032467 ATGGGTTGCTGAAGGGAAAATGG - Intronic
1157731720 18:50009917-50009939 CTGGGTTCCTGGGGTGAAAATGG + Intronic
1158287535 18:55900996-55901018 CTCTGTTTCTGATGGAAAAAGGG - Intergenic
1158524869 18:58204020-58204042 CTAGGTTTTTGGAGTCAAAATGG - Intronic
1159893634 18:73975936-73975958 CTGGGATTATGGTGGAGAAAAGG - Intergenic
1160572479 18:79827534-79827556 CTGTGTTCCTGGAGGAAGGAGGG + Intergenic
1161425764 19:4202196-4202218 CTAGGGTTCTGGAGTAAAAGGGG - Intronic
1162580727 19:11528773-11528795 CTGGGTCTCTTGGGGGAAAAAGG + Intronic
1164531799 19:29054138-29054160 CTAGGTTTCTGGAGCTAAATGGG + Intergenic
1165156473 19:33791907-33791929 CTGGGTTTCTGATGGAACAAAGG + Intergenic
1167313736 19:48752339-48752361 CTTGGTTCCTGGAGGAGTAATGG + Intronic
1167471024 19:49676659-49676681 GGGGGAGTCTGGAGGAAAAAGGG - Intronic
1167701864 19:51053310-51053332 CTGGGTTACTGGTGGAGACAAGG - Intergenic
1168363060 19:55759290-55759312 CTGTATTTCTGGAGGATAAGGGG + Intronic
926409671 2:12589987-12590009 CAGGGTTTCTGTGGGAAGAAGGG + Intergenic
926415631 2:12646834-12646856 CAGGGTTTCTGAAGCAAAAAGGG - Intergenic
927874014 2:26642398-26642420 CAGGGTCTCTGCAGGAACAAAGG + Intergenic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
929630080 2:43450931-43450953 CTGGGGCACTGGAGGAAAAGGGG + Intronic
933073403 2:77891306-77891328 CGAGGTTTCTGGAGGAAGAAAGG + Intergenic
933448313 2:82411702-82411724 ATGGTTTCCTGGAGGAATAACGG + Intergenic
934098649 2:88630185-88630207 CAGAGTATCTGGAGGAAAAGGGG + Intergenic
934232327 2:90195691-90195713 ATGGGCTTTTGGAGAAAAAAAGG - Intergenic
936288108 2:111197429-111197451 CTGGATTTCTCAAGGCAAAAGGG + Intergenic
936343939 2:111661037-111661059 CTGGGTTTCAAAAGGAAAAATGG - Intergenic
936744808 2:115562124-115562146 CTGGGTTTTTGAAGCAGAAAAGG - Intronic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937670386 2:124531941-124531963 CTGGGTTTCTAAAGGCAAATGGG + Intronic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938883331 2:135615381-135615403 TTGGGTTTGGGGAGGAAAATTGG + Intronic
938885960 2:135648828-135648850 CTGAGTTTCAGGAAAAAAAAGGG - Intronic
940124310 2:150307682-150307704 GTGGTTTTCAGGAGGAAAGAAGG - Intergenic
940420049 2:153470380-153470402 CTGGGTGGCTGCAGGAAGAAGGG - Intergenic
942031464 2:171965937-171965959 CTGGCTTTGTGGAGGTAATAAGG - Intronic
943708760 2:191065384-191065406 CTGGGTTTTGGGAGGCATAATGG + Intronic
943795558 2:191988590-191988612 CTGACTTTCTAGAGGACAAATGG + Intronic
944541264 2:200755880-200755902 CCAGGTTTCTGCAGGTAAAATGG - Intergenic
945145519 2:206734081-206734103 CTGAGTTTCTGGAAGCAAACTGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946723127 2:222632514-222632536 TTGCGTTTCTGGAGGTAAGAAGG - Intronic
947946014 2:234102858-234102880 CTGGAGCTCTGGTGGAAAAAAGG + Intergenic
948019554 2:234719399-234719421 CTGGCTTTTTGCAGGAAAACGGG - Intergenic
948985614 2:241520859-241520881 AAAGGTTTCTGGAGGAAACAAGG - Intergenic
949010603 2:241676248-241676270 CGGGGTTTCAGGAGAAAAAGAGG + Intronic
1168736962 20:148975-148997 CTGAGTTTCCGGGAGAAAAAGGG + Intergenic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1170297226 20:14840834-14840856 ATAGGTTTCAGGATGAAAAATGG + Intronic
1173012950 20:39199157-39199179 ATGGGTGTCCGAAGGAAAAATGG + Intergenic
1173179738 20:40796781-40796803 CTGGGATCCTGTAGGAAAGAAGG - Intergenic
1175847630 20:62066603-62066625 CTGGGTTTATTGATTAAAAATGG - Intergenic
1175951074 20:62583660-62583682 CGAGGTTTCTGGAAGAAAACGGG - Intergenic
1176449134 21:6848050-6848072 TTGGATTTCTGCTGGAAAAAAGG - Intergenic
1176827302 21:13713074-13713096 TTGGATTTCTGCTGGAAAAAAGG - Intergenic
1177225037 21:18243350-18243372 CTGGGATTCTGAATGAAAAATGG - Intronic
1177357113 21:20022565-20022587 ATGGGATTCTGGAACAAAAAAGG - Intergenic
1179230719 21:39501594-39501616 CTGTCTTTCTGTAGGATAAATGG - Intronic
1179998812 21:44985987-44986009 CTGTGTTTCTGCAGCAAACAGGG - Intergenic
1181866139 22:25857004-25857026 CTGGGTGTCTAGAGGAGACAGGG - Intronic
1183342453 22:37289112-37289134 CTGGTCTTCTGGAGAAAAGATGG + Intronic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1184381060 22:44145219-44145241 CTGCCTTTATGGAGGAAGAAAGG + Intronic
1184805292 22:46791470-46791492 CTGTGTTCCAGGTGGAAAAAAGG + Intronic
1185082630 22:48718294-48718316 CGGGGCTGCTGGAGGAAGAAGGG + Intronic
949572714 3:5308989-5309011 CTTGGTTTCTGGGAGATAAATGG - Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950980038 3:17293241-17293263 TTGAATTTCTGGAGAAAAAAAGG - Intronic
951586682 3:24222028-24222050 CTTTGTTTCATGAGGAAAAAAGG + Intronic
951738140 3:25890605-25890627 CTGAGATTCAGGAAGAAAAAAGG - Intergenic
954664451 3:52244439-52244461 CTGGCTTCCTGGAGGAGGAAAGG + Intergenic
954972787 3:54665031-54665053 CTGTGTTTCTGTAGGACAATGGG + Intronic
956776658 3:72570890-72570912 CTGGGTGTCTGGGGTAAAAGGGG + Intergenic
957684224 3:83479765-83479787 ATGGGATTCTGGAAGAGAAAAGG - Intergenic
957693404 3:83600668-83600690 CTGGCTTTCTGGAAGAACAAAGG + Intergenic
958464790 3:94443985-94444007 CTGGCTTTCTGAAATAAAAAAGG + Intergenic
959663263 3:108892876-108892898 CTGTGTTTCAGAAGGAAGAAGGG - Intergenic
960053100 3:113256043-113256065 ATGGGTTTTTTGAGGATAAATGG + Intronic
961014043 3:123453941-123453963 TTTGATTTGTGGAGGAAAAAGGG - Intergenic
961051457 3:123750590-123750612 CTGTCTTTCTGCAGGATAAAGGG - Intronic
961607490 3:128107555-128107577 CTGGGTTTCTGGGGTAGAGAAGG - Intronic
961677100 3:128574296-128574318 CAGATTTTCTGCAGGAAAAATGG + Exonic
963247310 3:143075065-143075087 CTGGGTCTCTGGAGGAAAACCGG + Intergenic
963364159 3:144313344-144313366 CTGGGTGTCTACAGGAAAGAAGG - Intergenic
964028529 3:152107817-152107839 CTTGGTTTCTGGAGGCAACTTGG - Intergenic
964099938 3:152977118-152977140 CTGGCTTTCTGTAGCAGAAAAGG + Intergenic
964453540 3:156836281-156836303 GTGGGTTTCATGAGGAAAACAGG + Intronic
966632386 3:182092628-182092650 CACTGTTTCTGCAGGAAAAAGGG + Intergenic
966913339 3:184571303-184571325 GAGGGTCTCTGGAGGAACAACGG - Exonic
969690790 4:8703067-8703089 CTGTGTCTCGGGAGGAAGAAAGG - Intergenic
969845450 4:9916872-9916894 CTGAGTGTCTGGGGGAGAAAAGG - Intronic
969904158 4:10377724-10377746 CTGTGTTCCTGAAGGAAACAGGG - Intergenic
971013888 4:22467758-22467780 GTGGGTTGGTGGGGGAAAAAGGG - Intronic
971769612 4:30879272-30879294 CTTGTTTATTGGAGGAAAAAAGG - Intronic
971965169 4:33544807-33544829 CTGGGTTTTTGTAGAGAAAAGGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
973960994 4:56109481-56109503 CTTGGATTCTGGAGCAGAAAAGG + Intergenic
974175202 4:58313767-58313789 CTGGATCTCTGGAGGCAACATGG - Intergenic
974434150 4:61835196-61835218 CAGGGTTTCATGAGGAAAACAGG + Intronic
974581801 4:63813530-63813552 CTGGGTTTCTGAAATAAAATAGG - Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
975683028 4:76895881-76895903 CTTGGTGTCTGGAGCAAAGAAGG - Exonic
975720778 4:77246768-77246790 CTGAGTTTCTCGAGCATAAATGG - Intronic
976151030 4:82092002-82092024 CTGGGGTTGGGAAGGAAAAATGG + Intergenic
980161753 4:129172575-129172597 GTAGGTTTCTAGATGAAAAATGG + Intergenic
981569443 4:146135781-146135803 CTTTGTTTCAGGAGGAAAAATGG - Intergenic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
983504132 4:168534122-168534144 CTAGATTTCTGGAGAAAACATGG + Intronic
984074969 4:175165278-175165300 TTGGGTTTCTGCAGCTAAAATGG - Intergenic
984878286 4:184388850-184388872 CTGGGGTCATGGAGGAAGAAAGG + Exonic
985421046 4:189785503-189785525 CTGAGTTTCTGGATGCAAATTGG - Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
987054050 5:14174253-14174275 TTTGGTTGCTGGAGCAAAAAAGG + Intronic
988791876 5:34616065-34616087 CTGGGTACCAGGAGGATAAATGG - Intergenic
990679988 5:58231837-58231859 GTGGGTTTGTGGGGGAATAAAGG - Intergenic
991534065 5:67647296-67647318 CTTGGATTCAGGATGAAAAAAGG - Intergenic
991632366 5:68669211-68669233 TAGGGATTCTTGAGGAAAAATGG - Intergenic
992987307 5:82245250-82245272 CTGGCTGTCTGAAGGAAAAACGG + Intronic
993915944 5:93742429-93742451 TTGGGTTTCTGGTGGGATAAGGG - Intronic
994981863 5:106885534-106885556 CTGGGATTCTGGAACAGAAATGG + Intergenic
995172796 5:109137248-109137270 CTTGGTTTCCAGAAGAAAAAAGG + Intronic
995366338 5:111365605-111365627 CTGGGATTTTGGAGGAAGAAGGG + Intronic
995968725 5:117941120-117941142 TTGGGTTGCTGGAAGAATAAAGG - Intergenic
996242472 5:121220964-121220986 CTGGGTTTCAAGAAGAAAGATGG + Intergenic
996695133 5:126385963-126385985 CTGGGTCTCTGGAGCAGAGAGGG + Intronic
998667927 5:144319769-144319791 CTGTGTTGCTTGAGTAAAAATGG + Intronic
999269517 5:150288708-150288730 CTGGGTTTCTGGAGGATCCTGGG - Intronic
999443397 5:151620217-151620239 CTGGGTCTATGAAGGACAAATGG - Intergenic
999772890 5:154788636-154788658 GTGGGTTTCTGGGGGAGGAAGGG + Intronic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000850999 5:166340188-166340210 CTTGGTTGTTGGAGGAAAAGGGG - Intergenic
1001188458 5:169601634-169601656 CTGGCTGCCTGGAGGAAAAGAGG - Intronic
1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG + Intronic
1003924132 6:10860985-10861007 ATGGGATTCTGGAGAAGAAAAGG - Intronic
1004780981 6:18908336-18908358 GAGGCTTTCTGGAGGAGAAAGGG - Intergenic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1005003289 6:21263933-21263955 CCATGTTTCTGGAGCAAAAAAGG - Intergenic
1005732303 6:28709878-28709900 CTGTGTTCCTGGAGCACAAAAGG - Intergenic
1005909106 6:30292530-30292552 TTTTGTTTCTGGAGGGAAAAGGG + Intergenic
1007363607 6:41374988-41375010 CTGGGTTTCAGCTGGCAAAAAGG - Intergenic
1007423340 6:41732953-41732975 CTCGGTTTCTGCAGGCAACAGGG - Intronic
1008161785 6:48086555-48086577 CAGGGATTGTGGAGGCAAAAAGG + Intergenic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1009815265 6:68725180-68725202 CTGGTTTGTTGGAGGAACAATGG + Intronic
1010717441 6:79245852-79245874 CTGGCTTTGAGGAGGAAGAAAGG + Intergenic
1010807647 6:80257862-80257884 CTGGGAGTCCGAAGGAAAAAAGG - Intronic
1011256977 6:85432417-85432439 CTAGTTTTCTGGTGGAAAAAGGG + Intergenic
1011679708 6:89771153-89771175 TTGTGTTTGTGCAGGAAAAAGGG - Intronic
1011846424 6:91569129-91569151 CTGGATTTCTGGAAGAAAGGTGG - Intergenic
1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG + Intergenic
1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG + Intergenic
1013117325 6:107113555-107113577 CTTGGATTCTAGAGGAAAGATGG - Intronic
1015291835 6:131546316-131546338 CTTGGTTTCTGGTGGAGAAGTGG + Intergenic
1015869883 6:137765486-137765508 CATGTTTTCTGGGGGAAAAATGG - Intergenic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1016686716 6:146890268-146890290 CTGGGTTTGTGGATAAGAAAGGG - Intergenic
1018309513 6:162493328-162493350 CTGGGTTTGTAGAGGCAAAGAGG + Intronic
1018489257 6:164275084-164275106 TTTGGTTTCTGGAGGAAAATAGG - Intergenic
1018727334 6:166623782-166623804 GGGGGTTTCTAGAGGAAAACTGG - Intronic
1018957323 6:168418886-168418908 ATGGCTTTCTGGGGAAAAAAAGG + Intergenic
1021900252 7:25278157-25278179 CTGGGCTTTTGGTAGAAAAAAGG + Intergenic
1023093790 7:36640292-36640314 CTGGGTTTCTGCTGGAAATTGGG + Intronic
1023245720 7:38201423-38201445 GTGGGTTTGTGGAAGGAAAAAGG + Intronic
1023637628 7:42228263-42228285 CTGGGTGTCTGGGGGCAGAAGGG + Intronic
1024186480 7:46953103-46953125 CTAGGTCCCTGGAGGAAACAAGG + Intergenic
1024962449 7:54991694-54991716 CTGGCTTTCTGTTGGGAAAATGG - Intergenic
1027164606 7:75825491-75825513 CTGAGTTTCTGGAAGGCAAAAGG + Intergenic
1028069922 7:86438948-86438970 CTAGAGTACTGGAGGAAAAATGG - Intergenic
1028946535 7:96586257-96586279 CTGGAATTCTGTAGGAAAGAAGG - Intronic
1030113123 7:106043046-106043068 CTGGGTTCCTGGAGGAGATTTGG + Intergenic
1031973919 7:128082116-128082138 TGGGGTTTCTGGAGGCCAAAGGG + Intronic
1031979410 7:128115150-128115172 CTGGAGTTCAGGAGGAAACATGG - Intergenic
1032553083 7:132804013-132804035 GAGGTTTTCTGCAGGAAAAATGG - Intronic
1032741546 7:134744594-134744616 CTTGGTTTCTGGAGGAATTCAGG - Intronic
1033652720 7:143354731-143354753 GTTGGTTTTTGGAGGAAACATGG - Exonic
1034103345 7:148470221-148470243 CTTGGTTTCTGGAGGGGAAATGG - Intergenic
1034860593 7:154591768-154591790 CTGGGTTTCTTTAGGGGAAAAGG + Intronic
1035278974 7:157765546-157765568 ATGGGTGGATGGAGGAAAAATGG - Intronic
1036803868 8:11813912-11813934 CTGGGTTTCTGGGGAAAACGTGG + Intronic
1037374338 8:18211691-18211713 CTGGGCCTCTGGATGAAAAGGGG - Intronic
1039455261 8:37701732-37701754 GTGGGTCTCTGAAGGAAAGAGGG - Intergenic
1039603656 8:38863546-38863568 CCTGCTTTCAGGAGGAAAAAGGG - Intergenic
1040331341 8:46387310-46387332 CAGGGTTTCTGGAGTAGGAAAGG - Intergenic
1040714986 8:50240211-50240233 CTGCATTTCAGGAGCAAAAATGG - Intronic
1040843010 8:51804510-51804532 CTGTATTTATGGAGTAAAAAGGG - Intronic
1042152897 8:65808202-65808224 CTGGATCTCTGAAAGAAAAATGG - Intronic
1042278485 8:67029572-67029594 CTGTGATTCTGGTGGAGAAAAGG + Intronic
1042478776 8:69280246-69280268 CTGGGTTTCAGGTAGAAAATGGG + Intergenic
1042711317 8:71720508-71720530 GTGGGTTGCTGGAGAACAAAGGG - Intergenic
1042868982 8:73380455-73380477 CTGGCTTGCTGGAGGGAAGAAGG - Intergenic
1043022629 8:75023389-75023411 TGGGGTTTCTGCAGGAAGAAGGG - Intronic
1043276613 8:78404231-78404253 CTAGGTATCTGGAAGAAAGAAGG - Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1043961933 8:86426708-86426730 CTGTGTTTCAGGAAGAAAATTGG + Intronic
1045502731 8:102755807-102755829 CTGAGTTTCTGCAAGACAAAGGG + Intergenic
1046034992 8:108829925-108829947 GTGAGTTTTTGAAGGAAAAATGG - Intergenic
1046414803 8:113898829-113898851 CTGGGTGGCTGGGGGAACAAGGG - Intergenic
1047616294 8:126565191-126565213 GTGGCTTTCTGCAGGACAAATGG + Intergenic
1048998628 8:139810072-139810094 GTGGGTTTCAGGAGGGAACAGGG - Intronic
1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG + Intergenic
1051076708 9:13247370-13247392 ATGAGTTTCTACAGGAAAAACGG - Intronic
1051915224 9:22199765-22199787 GTGTGTTTTTGGAGGTAAAAAGG + Intergenic
1052221457 9:26028792-26028814 CTGGGTATGTGGAGGATATATGG - Intergenic
1053024720 9:34720107-34720129 CTGGGTTTCCGTAGGAACCAGGG + Intergenic
1055310895 9:74978480-74978502 CTGTGTTCCTACAGGAAAAAAGG + Intergenic
1055444872 9:76372539-76372561 ATTGCTTTTTGGAGGAAAAAAGG - Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057055600 9:91958231-91958253 CTGGGTTTCTTTAGGAAATGGGG + Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057897330 9:98919788-98919810 CTTGGTTTCCGAAGGAGAAAAGG - Intergenic
1059611283 9:115899371-115899393 CTGGATGTTTGGAGGAACAAAGG + Intergenic
1059806123 9:117802516-117802538 ATGGGATTCTGGAGGAAAAATGG + Intergenic
1060206755 9:121686819-121686841 CTGGGGCTCTGGAGGAAATGTGG - Intronic
1060526567 9:124324287-124324309 CTGGGTTTCCAGAGGAACAGGGG + Intronic
1060670063 9:125460922-125460944 CTGGATTTCTGGAGGAAGCAGGG + Intronic
1203520054 Un_GL000213v1:36466-36488 TTGGATTTCTGCTGGAAAAAAGG + Intergenic
1186067797 X:5785112-5785134 CTACGTCTCTGGAGCAAAAATGG - Intergenic
1186389102 X:9140745-9140767 CAGGGTTTCAGGGGGAAAAAGGG - Intronic
1186593049 X:10951818-10951840 CTGTGTTGCTGGAGGAAATTAGG - Intergenic
1187715048 X:22094402-22094424 ATGAGTTTCTCCAGGAAAAACGG - Intronic
1187734623 X:22291138-22291160 TAGGTTTTCTGGAGGAGAAATGG - Intergenic
1188422151 X:30003282-30003304 AGGGGTTTGTGGAGGAGAAAGGG - Intergenic
1188520955 X:31037164-31037186 TTAGCTTTCTGGAGGATAAAAGG - Intergenic
1189039801 X:37530553-37530575 CTGGGTTTCTGGCACAAAATTGG - Intronic
1189709317 X:43793418-43793440 GAGCCTTTCTGGAGGAAAAAGGG - Exonic
1190973177 X:55372461-55372483 CTGGGTTTCTGCAGCAATATGGG - Intergenic
1192958211 X:76095940-76095962 CTGGGTTTCAGGAACAAAACTGG - Intergenic
1195664270 X:107414356-107414378 CTGGGATTCTGCAGGTAAATTGG + Intergenic
1195777144 X:108419960-108419982 CTTGGTTTCTGCAGGAGCAATGG + Intronic
1196321426 X:114344886-114344908 ATGGGTTTCTTGAGAAAAACAGG + Intergenic
1196524242 X:116713111-116713133 GTGGTTGTTTGGAGGAAAAAGGG + Intergenic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1200052110 X:153439191-153439213 TTGGGTTTTTGGAGTAAAATTGG - Intergenic
1201054585 Y:9976005-9976027 CTGTGATTCAGAAGGAAAAAAGG + Intergenic