ID: 1079445738

View in Genome Browser
Species Human (GRCh38)
Location 11:20554871-20554893
Sequence CCTCTTCACCAGACGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079445732_1079445738 26 Left 1079445732 11:20554822-20554844 CCACATGGCTGAGGAGGCCTCAG 0: 186
1: 2373
2: 6150
3: 6818
4: 5319
Right 1079445738 11:20554871-20554893 CCTCTTCACCAGACGGCAGAAGG No data
1079445734_1079445738 9 Left 1079445734 11:20554839-20554861 CCTCAGGAAACTTACAATCATGG 0: 5548
1: 8228
2: 6830
3: 4292
4: 3006
Right 1079445738 11:20554871-20554893 CCTCTTCACCAGACGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079445738 Original CRISPR CCTCTTCACCAGACGGCAGA AGG Intergenic
No off target data available for this crispr