ID: 1079445738 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:20554871-20554893 |
Sequence | CCTCTTCACCAGACGGCAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1079445732_1079445738 | 26 | Left | 1079445732 | 11:20554822-20554844 | CCACATGGCTGAGGAGGCCTCAG | 0: 186 1: 2373 2: 6150 3: 6818 4: 5319 |
||
Right | 1079445738 | 11:20554871-20554893 | CCTCTTCACCAGACGGCAGAAGG | No data | ||||
1079445734_1079445738 | 9 | Left | 1079445734 | 11:20554839-20554861 | CCTCAGGAAACTTACAATCATGG | 0: 5548 1: 8228 2: 6830 3: 4292 4: 3006 |
||
Right | 1079445738 | 11:20554871-20554893 | CCTCTTCACCAGACGGCAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1079445738 | Original CRISPR | CCTCTTCACCAGACGGCAGA AGG | Intergenic | ||
No off target data available for this crispr |