ID: 1079449660

View in Genome Browser
Species Human (GRCh38)
Location 11:20588956-20588978
Sequence GGCAGACATGTGGCCAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079449653_1079449660 14 Left 1079449653 11:20588919-20588941 CCATTCACAGCATGCTGCCTGCC No data
Right 1079449660 11:20588956-20588978 GGCAGACATGTGGCCAACTTTGG No data
1079449656_1079449660 -7 Left 1079449656 11:20588940-20588962 CCCACCACGTTTGAGAGGCAGAC No data
Right 1079449660 11:20588956-20588978 GGCAGACATGTGGCCAACTTTGG No data
1079449655_1079449660 -3 Left 1079449655 11:20588936-20588958 CCTGCCCACCACGTTTGAGAGGC No data
Right 1079449660 11:20588956-20588978 GGCAGACATGTGGCCAACTTTGG No data
1079449657_1079449660 -8 Left 1079449657 11:20588941-20588963 CCACCACGTTTGAGAGGCAGACA No data
Right 1079449660 11:20588956-20588978 GGCAGACATGTGGCCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079449660 Original CRISPR GGCAGACATGTGGCCAACTT TGG Intergenic
No off target data available for this crispr