ID: 1079449693

View in Genome Browser
Species Human (GRCh38)
Location 11:20589251-20589273
Sequence GAACAATCCTCAGCCAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079449689_1079449693 8 Left 1079449689 11:20589220-20589242 CCCACAAGTGCTGAGGATTTAAT No data
Right 1079449693 11:20589251-20589273 GAACAATCCTCAGCCAATAAGGG No data
1079449686_1079449693 23 Left 1079449686 11:20589205-20589227 CCCAACTGTAGAGTGCCCACAAG No data
Right 1079449693 11:20589251-20589273 GAACAATCCTCAGCCAATAAGGG No data
1079449690_1079449693 7 Left 1079449690 11:20589221-20589243 CCACAAGTGCTGAGGATTTAATA No data
Right 1079449693 11:20589251-20589273 GAACAATCCTCAGCCAATAAGGG No data
1079449687_1079449693 22 Left 1079449687 11:20589206-20589228 CCAACTGTAGAGTGCCCACAAGT No data
Right 1079449693 11:20589251-20589273 GAACAATCCTCAGCCAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079449693 Original CRISPR GAACAATCCTCAGCCAATAA GGG Intergenic
No off target data available for this crispr