ID: 1079451324

View in Genome Browser
Species Human (GRCh38)
Location 11:20601779-20601801
Sequence CAGGTGATGGATGCGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079451310_1079451324 28 Left 1079451310 11:20601728-20601750 CCGGGCCGTGGCGGGTGCACGTA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1079451324 11:20601779-20601801 CAGGTGATGGATGCGGGAGGCGG 0: 1
1: 0
2: 0
3: 40
4: 363
1079451311_1079451324 23 Left 1079451311 11:20601733-20601755 CCGTGGCGGGTGCACGTATGCTG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1079451324 11:20601779-20601801 CAGGTGATGGATGCGGGAGGCGG 0: 1
1: 0
2: 0
3: 40
4: 363
1079451318_1079451324 -9 Left 1079451318 11:20601765-20601787 CCGGTTGGCAGTGCCAGGTGATG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1079451324 11:20601779-20601801 CAGGTGATGGATGCGGGAGGCGG 0: 1
1: 0
2: 0
3: 40
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079451324 Original CRISPR CAGGTGATGGATGCGGGAGG CGG Intronic
900422113 1:2560157-2560179 CAGGTGATGGAGGCAGGGGAAGG + Intronic
900673866 1:3871997-3872019 GAGGTGATGGATCCTGGGGGTGG - Intronic
900809961 1:4794424-4794446 CAGGTGAGGGATGGGGAATGGGG - Intergenic
901012749 1:6210563-6210585 CAGATGATGGAGTTGGGAGGGGG - Intronic
901949293 1:12728693-12728715 CAGGTGGTGGTTGCTGAAGGTGG + Intronic
902048885 1:13546272-13546294 CAGGTGATGGGAGAAGGAGGGGG + Intergenic
902081943 1:13827236-13827258 GTGGTGATGGCTGGGGGAGGTGG + Intergenic
902398582 1:16145353-16145375 CAGGTGCTGTGTGCGGCAGGTGG - Intronic
902407368 1:16191991-16192013 CAGGTGAGGAATGAGGGAAGTGG + Intergenic
902573438 1:17361446-17361468 CAGGAGCTGGCTGTGGGAGGCGG + Intronic
903223913 1:21884492-21884514 CGGGTGAGCGCTGCGGGAGGTGG - Intronic
903384886 1:22919701-22919723 CAGGAGAGGGAGGAGGGAGGAGG + Intergenic
904239412 1:29134343-29134365 CAGGCGGCGGAGGCGGGAGGCGG + Intergenic
904520205 1:31089329-31089351 CAGTTGATGGCTGTGGGAGCCGG - Intergenic
904586880 1:31585609-31585631 CAGGTGCTGCCTGTGGGAGGGGG - Intronic
904599600 1:31666122-31666144 GAGGTGAAGGATGAGGTAGGGGG + Intronic
905038570 1:34933083-34933105 AAGGAGATGGATTCGGGTGGAGG - Intergenic
905324814 1:37144048-37144070 CGGGTGAGGGTTGGGGGAGGGGG - Intergenic
905665599 1:39761347-39761369 CAGGTGATGGCAGCTGGACGGGG - Intronic
907440656 1:54476094-54476116 CAGCTGAGGGTGGCGGGAGGTGG + Intergenic
908046230 1:60172090-60172112 CAAGAGAGGGATGCGGGAGAGGG - Intergenic
912271940 1:108220208-108220230 GAAGTGAGGGATGGGGGAGGGGG + Intergenic
916503299 1:165405571-165405593 CAGATGATGGAAGGGGGAAGAGG - Intronic
916598671 1:166271464-166271486 CAGGGGCTGGAAGCTGGAGGTGG - Intergenic
918066191 1:181103521-181103543 CAGGTGGTGGAGGTGGTAGGAGG + Intergenic
918428649 1:184436102-184436124 CTGGTGATGGATGCAGGAGAAGG + Intronic
919300642 1:195759254-195759276 GAGGTGATGGATTTGGCAGGTGG - Intergenic
919869068 1:201806851-201806873 CAGGTGATGGATGGAGCTGGTGG - Intronic
920081629 1:203378823-203378845 CAGGGGAAGGGTGTGGGAGGGGG - Intergenic
920769997 1:208875082-208875104 CAGCTAATGGGTGGGGGAGGAGG - Intergenic
921667570 1:217890960-217890982 CAGGAGATGGAGGAAGGAGGGGG + Intergenic
921900718 1:220447748-220447770 GAGGTGATGGAGGAGGGAGTGGG + Intergenic
921989693 1:221351033-221351055 TAGATGTTGAATGCGGGAGGAGG - Intergenic
922730444 1:227946546-227946568 CAGGAGAGGGCTGCGGGTGGGGG + Intronic
922765098 1:228152417-228152439 CAGGAGCTTGATGGGGGAGGGGG + Intronic
924646096 1:245878411-245878433 CAGGTGGTAGAAGCGGGTGGTGG + Intronic
1062907270 10:1187378-1187400 CTGGCGATGGGAGCGGGAGGAGG - Intronic
1063050033 10:2437068-2437090 CACTTGATGGAGACGGGAGGTGG - Intergenic
1063052690 10:2470213-2470235 CAGATGATGGATAAAGGAGGTGG + Intergenic
1063888144 10:10600587-10600609 CAGATGATGGATATGGGAAGAGG + Intergenic
1064008387 10:11715624-11715646 TTGGTGATGAATGGGGGAGGAGG + Intergenic
1064194378 10:13233497-13233519 GTGGTGATGGACGCGGGATGGGG + Intronic
1065063103 10:21929129-21929151 CAGATGATGCATCCTGGAGGTGG + Exonic
1067054142 10:43041526-43041548 CAGGTGAGGGATGCTGCTGGTGG - Intergenic
1067382439 10:45787403-45787425 CAGGTGCAGGATGAGGGGGGTGG - Intronic
1067890137 10:50127951-50127973 CAGGTGCAGGATGAGGGGGGTGG - Intronic
1069531182 10:69220723-69220745 CAGGTATTGGATGCGGAAGCGGG + Intronic
1069634839 10:69918831-69918853 CAGGTGAGGGGTGTGGCAGGTGG - Intronic
1070144294 10:73762472-73762494 CAGGTGATGTATGATGGAAGAGG + Intronic
1072430922 10:95369860-95369882 CAGGTGATGGGTGGGGCAGGTGG - Intronic
1072548412 10:96458031-96458053 GAGGTGGTGGCTGCAGGAGGTGG + Intronic
1072618135 10:97063211-97063233 GAGGTGATGGATGGGGCAGGAGG + Intronic
1072618144 10:97063252-97063274 GAGGTGATGGATGGGGCAGGAGG + Intronic
1074161867 10:110842217-110842239 CAGCTGGTGGGTGGGGGAGGCGG + Intergenic
1074180618 10:111059700-111059722 CAGGTGGTGGATGAGGGATGTGG - Intergenic
1074539836 10:114355191-114355213 CTAGGGATGGATGCGGGTGGGGG + Intronic
1075724981 10:124606473-124606495 CAGATGGTGGAGGTGGGAGGGGG + Intronic
1076843316 10:133057127-133057149 CAGGTGAGGAGGGCGGGAGGAGG + Intergenic
1077225118 11:1436222-1436244 GCGGTGCTGGATGCGGGTGGGGG + Intronic
1077499258 11:2901936-2901958 CAGGGGATGGGACCGGGAGGTGG - Intronic
1077532147 11:3102341-3102363 CAGGTGAGGGATGTGGACGGAGG + Intronic
1078510398 11:11980431-11980453 CAGGTCATGGTTGCTGGAGTAGG - Intronic
1079109752 11:17598653-17598675 CAGCTGATGAGTGAGGGAGGTGG + Intronic
1079451324 11:20601779-20601801 CAGGTGATGGATGCGGGAGGCGG + Intronic
1080746481 11:35112615-35112637 CAGGTGATGGGGGCGGGGGGCGG + Intergenic
1084274361 11:68044004-68044026 CAGGAGGTGGGTGCAGGAGGTGG + Intronic
1084274376 11:68044045-68044067 CAGGAGGTGGGTGCAGGAGGTGG + Intronic
1084288071 11:68144701-68144723 GGGGTGAAGGATGTGGGAGGGGG + Intergenic
1084455551 11:69266134-69266156 CATGTGAGGGAGGAGGGAGGGGG + Intergenic
1084698378 11:70769925-70769947 CAGGTGCTGGAGGCTGAAGGGGG + Intronic
1084736892 11:71111250-71111272 CTGGGGATGGAGGCAGGAGGTGG - Intronic
1085283582 11:75346043-75346065 CAGGTCTTGGATGCTGGAGGGGG - Intronic
1089043431 11:115476528-115476550 CAGGAGATGGCAGCAGGAGGGGG + Intronic
1090747674 11:129720335-129720357 CAGGGGATGCCTGCAGGAGGAGG - Intergenic
1090938109 11:131363199-131363221 CATGTGATGTATGGGGGTGGCGG + Intergenic
1091003758 11:131933285-131933307 CAGGTGATGCCTGCGGGTGTAGG - Intronic
1091690873 12:2596645-2596667 CAGGTGATGGATCAGGGATGGGG - Intronic
1091752764 12:3032966-3032988 CAGCTGATGGAGGGGGAAGGCGG - Intronic
1093016548 12:14161155-14161177 CAGGAGAGGGAGGGGGGAGGAGG + Intergenic
1095330487 12:40955860-40955882 CAAGTAATGGAAGTGGGAGGTGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1098000043 12:65931394-65931416 GAGATGATGGTTTCGGGAGGGGG - Intronic
1098080524 12:66780268-66780290 CATCTGATGGATGCGGGAACAGG + Intronic
1098917398 12:76271938-76271960 CAGGTGGTGGAAGTGGAAGGAGG + Intergenic
1101583200 12:106062271-106062293 CAGGTGCTGGGTGTGGTAGGAGG - Intergenic
1101743996 12:107523964-107523986 CAGGTGCTGGAGGCTGGGGGAGG - Intronic
1101922260 12:108942530-108942552 CAGGAGATGGAAGCGGAGGGAGG + Intronic
1102394155 12:112573925-112573947 CGGGTGATGGAGGAGGGAGGGGG + Intronic
1102394358 12:112574543-112574565 GGGGTGATGGAGGAGGGAGGGGG + Intronic
1103344476 12:120240265-120240287 CAGGTGACAGATGGGGGATGAGG + Intronic
1104323522 12:127774211-127774233 CAGGAGATGGAGGGTGGAGGTGG - Intergenic
1104446681 12:128839677-128839699 CATGTGATGGATTTGGGAGGAGG + Intergenic
1104781277 12:131422095-131422117 CAGGTGGAGGAGGAGGGAGGAGG - Intergenic
1104979251 12:132566309-132566331 CAGGTGATGGGATCAGGAGGTGG - Intronic
1105007340 12:132729528-132729550 GAGGTGAGGGAAGGGGGAGGGGG + Intronic
1105018065 12:132798161-132798183 CAGGTGAGGGATGAGGGGTGGGG + Intronic
1105607675 13:21940230-21940252 CAGGTGAGGGATGTAGGAGGAGG + Intergenic
1106137798 13:26987304-26987326 AAGGGGTTGGAAGCGGGAGGTGG - Intergenic
1106201802 13:27544369-27544391 CAGGGGATGTATGCGGGCTGGGG + Intergenic
1106407529 13:29486988-29487010 CAGGTGAGGGGTAGGGGAGGGGG + Intronic
1107392127 13:39976825-39976847 CAGATGATGGAGGGGAGAGGAGG - Intergenic
1108056952 13:46494659-46494681 CTGGTGATGGATGAGGGTGATGG - Intergenic
1113060191 13:106314316-106314338 AAGGTGGTGGCTGGGGGAGGAGG + Intergenic
1113252089 13:108464761-108464783 CAGCAGATGGATGCAGGTGGAGG + Intergenic
1113593752 13:111517883-111517905 CAGGTGAGGGAGCCGGGGGGTGG - Intergenic
1113593840 13:111518078-111518100 CAGGTGAGGGAGCCGGGGGGGGG - Intergenic
1113671681 13:112179717-112179739 CCAGTGATGAGTGCGGGAGGAGG - Intergenic
1113697335 13:112355505-112355527 ACGGTGATGGTGGCGGGAGGTGG - Intergenic
1115414577 14:33116728-33116750 CAGGTGATGGGTGGGTGGGGAGG - Intronic
1116769318 14:49108846-49108868 CAGGTGGCTGATGCAGGAGGTGG + Intergenic
1117289090 14:54315216-54315238 CAGGTGTTGGAAGATGGAGGAGG + Intergenic
1117810239 14:59537603-59537625 CAGGGCATGGATGCTGGGGGAGG - Intronic
1118772302 14:68950326-68950348 CAGGAGATGGATGCTGGTGATGG + Intronic
1119483611 14:74974721-74974743 AAGCTGTTGGCTGCGGGAGGTGG + Intergenic
1120178980 14:81324096-81324118 CAGGCGGTGGGTGCGGGTGGAGG + Intronic
1120857582 14:89226100-89226122 CAAGTGATGGGGGCGGGGGGAGG + Intronic
1121420680 14:93811273-93811295 CAGGTGCTGGATGGGTAAGGGGG - Intergenic
1124813938 15:32969071-32969093 GGAGGGATGGATGCGGGAGGCGG + Exonic
1125105302 15:35963936-35963958 AAGGTGATGGTAGCAGGAGGTGG - Intergenic
1125726958 15:41873061-41873083 CAGGGGATGTTTGTGGGAGGAGG + Intronic
1126814584 15:52442254-52442276 CAGGAGATGGCTGGTGGAGGTGG - Intronic
1127267985 15:57376534-57376556 CGGGAGCTGGACGCGGGAGGAGG + Exonic
1127342795 15:58065438-58065460 CGGGTGAGGGCTGCGGGACGGGG - Intronic
1128337838 15:66798809-66798831 CAGGAGATGGTGGAGGGAGGTGG + Intergenic
1128368720 15:67023769-67023791 CATGTGAGGGCTGCGGGAGGTGG - Intergenic
1129108328 15:73323507-73323529 CAGCTGTTGGATGTGGAAGGAGG + Exonic
1129601576 15:77001869-77001891 AAGGAGATGGATGAGGGATGAGG + Intronic
1129929435 15:79398144-79398166 CAGGGGTTGGATGGAGGAGGAGG - Intronic
1130748898 15:86688172-86688194 CAGGGGATTGATGCTTGAGGAGG + Intronic
1130843457 15:87723304-87723326 CAGGTGAGGGTTGGGGGAGGGGG - Intergenic
1131005351 15:88973067-88973089 CAGGTGGTGGTTGGGGGCGGGGG + Intergenic
1131068805 15:89451163-89451185 GAGGGGTGGGATGCGGGAGGGGG + Intergenic
1131131717 15:89904621-89904643 CAGGTGCTGGATTAGGGAAGGGG + Intronic
1131382385 15:91974602-91974624 CAGGGCAGGGAGGCGGGAGGTGG + Intronic
1131711285 15:95059351-95059373 CAGGTGATGGTTGGCGGGGGGGG + Intergenic
1132540191 16:504844-504866 GAGGTGAGGGGTGCAGGAGGAGG - Intronic
1132622777 16:875627-875649 CGGGCCATGGAAGCGGGAGGTGG + Intronic
1132713667 16:1280072-1280094 CAGGGCCTGGAGGCGGGAGGAGG + Intergenic
1132807497 16:1781941-1781963 CAGGAGACGGTGGCGGGAGGAGG - Intronic
1132989932 16:2787268-2787290 GGGGTGAAGGATGAGGGAGGGGG - Intronic
1132989987 16:2787439-2787461 GGGGTGAAGGATGGGGGAGGGGG - Intronic
1133105044 16:3501986-3502008 CAGGTGATACAGGCGGTAGGAGG + Intronic
1133517595 16:6524800-6524822 CAGGTGATGGAGGAAGAAGGTGG - Intronic
1133617033 16:7486814-7486836 GAGGTGACGGATGCTGGAAGAGG - Intronic
1134050263 16:11132244-11132266 CAGGGGCTGGATGGGGGCGGGGG - Intronic
1134236239 16:12468553-12468575 GAGATGAGGGCTGCGGGAGGGGG - Intronic
1135895299 16:26395735-26395757 CTGGTTATGGATGCTGGATGCGG - Intergenic
1135895326 16:26395934-26395956 CAGATGCTGGATGCTGGATGCGG - Intergenic
1136557795 16:31018433-31018455 CAGGTGATGAAGGAGGGAGGAGG + Intergenic
1138586064 16:57971174-57971196 CAGGTGCTGAATGGGGGAGGGGG + Intergenic
1141054445 16:80803522-80803544 CAGGTGGGGGGTGAGGGAGGTGG + Intronic
1141525387 16:84607700-84607722 AAGGTGTTGGAAGTGGGAGGCGG + Intronic
1141560523 16:84864771-84864793 CAGCTGGTGGATGAGGCAGGTGG + Intronic
1141775765 16:86121766-86121788 GAGGTGAAGGAGGCAGGAGGAGG - Intergenic
1141819954 16:86438487-86438509 CAGCTGATGGATGGGAGAGGTGG + Intergenic
1142274104 16:89106869-89106891 CAGGTGACGGATGGGGTTGGGGG + Intronic
1142398063 16:89844240-89844262 CAGGAGATGGAGGCTGCAGGTGG - Intronic
1142605471 17:1078785-1078807 CAGGTGCTCGCTGTGGGAGGTGG - Intronic
1144253499 17:13442865-13442887 CATATGATGGCTGGGGGAGGAGG - Intergenic
1144461584 17:15463005-15463027 CAGGAGATGGGGGTGGGAGGAGG + Intronic
1144560036 17:16313626-16313648 CGGGTGATGGATGTGGGGGAGGG + Intronic
1144585517 17:16485296-16485318 AAGGTGATGGTATCGGGAGGTGG + Intronic
1144702115 17:17346844-17346866 CAGGTGCTGGTTGTGGCAGGCGG - Exonic
1145063481 17:19746976-19746998 CAGCTGATGGAGCAGGGAGGAGG - Intronic
1146918678 17:36695184-36695206 CCAGTGATGGATGAGGGGGGTGG + Intergenic
1148674686 17:49438560-49438582 GAGGAGCTGGATGGGGGAGGGGG + Intronic
1148776622 17:50099299-50099321 GAGCTGAGGGATGCAGGAGGAGG + Intronic
1149065179 17:52470893-52470915 CAGATGAGGGATTCGGTAGGTGG - Intergenic
1149449373 17:56737961-56737983 CAGGCGCTGGCTGTGGGAGGTGG - Intergenic
1151527638 17:74681799-74681821 CAAGTGATGGATGGGGCAGGTGG - Intronic
1151852194 17:76697652-76697674 GAGGAGGTGGAGGCGGGAGGGGG + Intronic
1152290808 17:79438969-79438991 AAGCTGATGGTTTCGGGAGGAGG - Intronic
1152420758 17:80191764-80191786 GTGGTGATGGATGTGGCAGGTGG + Intronic
1152481774 17:80559007-80559029 CTGGTGGTGGATGCTGGTGGTGG - Intronic
1154294599 18:13137414-13137436 CAGGGGTTGGAGGCGGAAGGGGG + Intergenic
1154359008 18:13643427-13643449 GAGGTGATGGCTGCGGGGGGCGG + Intronic
1157437885 18:47686610-47686632 CTGGAGATGGAGGTGGGAGGGGG - Intergenic
1157768832 18:50326683-50326705 CAGGTGATAGATTCAGGAGTGGG + Intergenic
1160340827 18:78087428-78087450 TAGGTGCTGGATGCTTGAGGTGG + Intergenic
1161243272 19:3234825-3234847 CAGGTGAGGGATGAGGGGGCTGG - Intronic
1161383141 19:3977088-3977110 CAGGTGATGGATGGAGCAGGTGG - Intronic
1161573842 19:5044750-5044772 CAGGAGAGGGATGGGGGAGAGGG - Intronic
1161575558 19:5052584-5052606 CAGGAGATGGAGCTGGGAGGCGG - Intronic
1162089542 19:8269966-8269988 CAGGTGAAGGAAAAGGGAGGGGG + Intronic
1163099474 19:15085689-15085711 CAGGGGCTGGGGGCGGGAGGTGG - Intergenic
1163469844 19:17489685-17489707 CAGGTGAGGAACGCGTGAGGCGG + Intronic
1163774852 19:19212062-19212084 CAGGTGGGGGATCCGTGAGGGGG + Exonic
1163784702 19:19269026-19269048 CAAGTGATTGATGAGGCAGGTGG + Intronic
1165306729 19:35007221-35007243 GAGGTGATGGAGGCTGGAGCAGG + Intronic
1166044800 19:40223550-40223572 CAGATGGGGGATGCGGGGGGAGG + Intronic
1166760100 19:45218663-45218685 CAAGTGAGGGATGGGGGAGGGGG + Intronic
1166817170 19:45553297-45553319 GAGGTGAAGGATGATGGAGGGGG + Intronic
1167261889 19:48463366-48463388 CAGGAGATTGAAGTGGGAGGTGG - Intronic
1167499293 19:49836339-49836361 CAGGTGGTGGATGCAGGAGTGGG - Exonic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
925147905 2:1593381-1593403 CAGGTGATGGTTCCAGGAGCTGG + Intergenic
925366417 2:3315040-3315062 CAGGTGTTGGGGGCGGGTGGCGG - Intronic
925465814 2:4106618-4106640 CAGGTGATTGATGTAGGAGACGG + Intergenic
925896209 2:8474210-8474232 CAGGTGAGGGGTTAGGGAGGAGG - Intergenic
926297478 2:11579162-11579184 CAGGCGATGGATGGGCCAGGTGG - Intronic
926317355 2:11720734-11720756 CAGATGTTGGATGCTGGAGCTGG + Intronic
927140775 2:20129508-20129530 CAGGTGAGGGAGACAGGAGGCGG - Intergenic
927148066 2:20179911-20179933 CGGGTGGTGGGTGCGGGCGGCGG - Intergenic
927372675 2:22375246-22375268 CAGGTGAAGAATGGGGGAGATGG - Intergenic
927513315 2:23658078-23658100 CAGGAGAGGGAGGAGGGAGGAGG - Intronic
927846182 2:26473894-26473916 CTGGTGATGGTGGTGGGAGGGGG + Intronic
929080956 2:38121713-38121735 CAGCAGATGGCTGCTGGAGGAGG + Intergenic
929316466 2:40484865-40484887 CAGCAGAAGGATGCTGGAGGTGG + Intronic
930524912 2:52516409-52516431 CAGGTGATGGTTTTAGGAGGTGG - Intergenic
931264462 2:60648058-60648080 AAGGTGAGAGATGAGGGAGGGGG + Intergenic
931282680 2:60807921-60807943 CAGGTGAAAGCTGGGGGAGGTGG + Intergenic
931282742 2:60808288-60808310 CAGGGGAGGGCTGCGGGAGAGGG + Intergenic
931682972 2:64768190-64768212 CAGCCGGGGGATGCGGGAGGCGG - Intergenic
932336162 2:70932643-70932665 CAGGTGGTGGATGGGGGTGGGGG - Intronic
932498165 2:72157863-72157885 CAGGTGATAGGTGAGGGAGAGGG + Intergenic
932534771 2:72581672-72581694 CAGGGGCAGGGTGCGGGAGGTGG - Intronic
935034307 2:99353681-99353703 CAGGTGAGGGGTTGGGGAGGTGG - Intronic
935724586 2:106012167-106012189 CTGGTGTTAGATGCGGGTGGAGG - Intergenic
935963324 2:108448742-108448764 CAGGTCAGGGATGCGGTAGAGGG - Exonic
937914124 2:127090590-127090612 CAGGTGATGAGGGTGGGAGGCGG - Intronic
942729589 2:179049420-179049442 GATGTGATGGAGGTGGGAGGAGG - Intronic
942978141 2:182044103-182044125 CAGGTGATGGATGATGAAGGTGG - Intronic
946418332 2:219551676-219551698 CGTGTGCTGGCTGCGGGAGGGGG - Exonic
946747259 2:222858904-222858926 AAGGTGATGGTTGCTGAAGGTGG - Intergenic
948310950 2:236986347-236986369 CAGATGAAGGATGCAGGTGGGGG + Intergenic
948458799 2:238119376-238119398 AAGGAGTTGGATGCAGGAGGTGG + Intronic
948458803 2:238119389-238119411 CAGGAGGTGGATGGAGGAGGTGG + Intronic
948766500 2:240224512-240224534 GAGAGGATGGATGAGGGAGGAGG - Intergenic
948815799 2:240509939-240509961 GAGGGCATGGATGGGGGAGGAGG - Intronic
948976295 2:241465766-241465788 CAGGCGAGGGATGGAGGAGGGGG - Intronic
1168803259 20:657520-657542 CAGGTGATGGTGTTGGGAGGTGG + Intronic
1168971496 20:1934240-1934262 CAAGGGCTGGATGGGGGAGGAGG - Intronic
1169189270 20:3647089-3647111 GAGCTGATGGTTGCTGGAGGAGG + Exonic
1171562422 20:26137142-26137164 AAGGTGATGAGAGCGGGAGGGGG + Intergenic
1172292227 20:33784388-33784410 CAGGGGAGGGAGGCTGGAGGGGG - Intronic
1173895602 20:46548500-46548522 GAGGTGATGGATGCTTGAAGAGG + Intronic
1175538913 20:59736131-59736153 CAGATGATGGATGGGGCAGCTGG - Intronic
1175968245 20:62670693-62670715 CAGGGGATGGCTGCGTGTGGAGG - Intronic
1178824499 21:36004707-36004729 CCGGTGGTGGGGGCGGGAGGGGG + Intergenic
1178974406 21:37209005-37209027 CAGGGGGTGGATGGGGGTGGGGG + Intergenic
1179225411 21:39448595-39448617 CAGGAGATGAATGTGGGAGGTGG + Intronic
1179790297 21:43752433-43752455 CAGGTGATGGATCGGGGAGTGGG + Intronic
1180030463 21:45203157-45203179 CAGGAGCTTGATGAGGGAGGGGG - Intronic
1180618152 22:17141987-17142009 CAAGTGAAGGTTGTGGGAGGGGG + Intronic
1181461850 22:23090371-23090393 CAGGTGAGGGCTGGGGGAAGTGG - Intronic
1182882805 22:33747960-33747982 CCAGTGATGGATGCTTGAGGTGG - Intronic
1183285473 22:36959879-36959901 CAGGGCATGGCTGTGGGAGGAGG - Intergenic
1183603913 22:38857673-38857695 CAGGAGATGGGCGTGGGAGGTGG - Intergenic
1184258917 22:43303345-43303367 CAGGGCATGGATGGGGCAGGAGG - Intronic
1184380626 22:44143034-44143056 CAGGTGAAGGTTGCTGGAGGAGG - Intronic
1184747035 22:46462067-46462089 CAGGTGTGGGCTGTGGGAGGCGG + Intronic
949860110 3:8497687-8497709 CAGGTGAGGCATGCAGGAGCTGG - Intergenic
950873284 3:16247802-16247824 AAGGTGCTGGGTCCGGGAGGGGG - Intergenic
953030647 3:39177750-39177772 CAGGGGCGGGAGGCGGGAGGCGG - Intergenic
954044225 3:47915768-47915790 AAGGTGTTGGAGGTGGGAGGAGG + Intronic
954316871 3:49806154-49806176 CAGGTGATGGAACTGGGATGAGG + Exonic
954456397 3:50601956-50601978 CAGTGGATGGCTGTGGGAGGAGG - Intergenic
954464317 3:50645799-50645821 CAGGAGATGGAGGCAGGGGGTGG - Intronic
954660417 3:52224082-52224104 GAGGTGGTGGATGCGGTTGGAGG + Exonic
955184873 3:56705326-56705348 CAGGTTGTGGATGCGGGGAGGGG + Intergenic
956462230 3:69484283-69484305 CAGGGGCTGGATGGGGAAGGTGG + Intronic
957039884 3:75328605-75328627 CAGGTGATGGTGGCTGGGGGGGG + Intergenic
960974366 3:123160558-123160580 GATGTGAGGGATGAGGGAGGTGG - Intronic
962370743 3:134818984-134819006 CAGGAGGTGGAGGCAGGAGGTGG + Intronic
963378823 3:144503785-144503807 CACTTGATGGATGGTGGAGGTGG + Intergenic
963906164 3:150774909-150774931 AAGGTGATGGGAGGGGGAGGGGG + Intergenic
964246467 3:154659708-154659730 CAGGTGGTGGGGGTGGGAGGTGG + Intergenic
964431641 3:156612927-156612949 CAGGGGCTGGAGGTGGGAGGAGG - Intergenic
965079667 3:164020481-164020503 GAGATGATGGATGAGGGAGAGGG + Intergenic
967221579 3:187252124-187252146 CAGGTAGTGGCTGAGGGAGGAGG - Intronic
968454184 4:688879-688901 CAGGTGCTGGCTGGGGGCGGGGG - Intronic
968520446 4:1032582-1032604 CAGGTGAGGGCTGTGGGAGGAGG + Intergenic
969294785 4:6263420-6263442 AAGGTGAGGGCTGGGGGAGGTGG + Intergenic
969589341 4:8112842-8112864 CAGGTGATGGAAGGGGTGGGAGG - Intronic
972581649 4:40400306-40400328 CTGATGAGGGATGGGGGAGGAGG + Intergenic
975516851 4:75257571-75257593 AAGGTGAGGGGTGAGGGAGGTGG - Intergenic
978949175 4:114536995-114537017 GAGGTGAGGGATGAGGAAGGAGG - Intergenic
981633962 4:146854024-146854046 CAGGGGAGGGATGAGGGAGCTGG - Intronic
982453631 4:155581563-155581585 CAGCTGATGGATCAGGGTGGTGG - Intergenic
982719020 4:158840123-158840145 CAGGTTATGGAGGAGGAAGGAGG + Intronic
983525715 4:168758757-168758779 CAAGTGGGGGATGTGGGAGGGGG - Intronic
984944006 4:184957037-184957059 CAGGCCATGGAAGTGGGAGGTGG + Intergenic
985009859 4:185570956-185570978 CAGGGGATGGGTGAAGGAGGAGG + Intergenic
985520249 5:370757-370779 CAGGTGTTGGTGGGGGGAGGGGG + Intronic
985724703 5:1509914-1509936 CAGGTGAGGCCTGCAGGAGGAGG + Intronic
986813564 5:11384795-11384817 CAGCTGGTGGATGGGCGAGGAGG + Exonic
987746577 5:21981620-21981642 CAGATGATGGAAGCTGGTGGGGG - Intronic
989368622 5:40681905-40681927 CGGGGAATGGACGCGGGAGGTGG - Intronic
990732846 5:58828422-58828444 CAGGAGATGGATAAAGGAGGAGG - Intronic
991766755 5:69991378-69991400 CAGATGATGGAAGCTGGTGGCGG - Intergenic
991845987 5:70866452-70866474 CAGATGATGGAAGCTGGTGGCGG - Intergenic
993308602 5:86299797-86299819 GAAGTGAGGGATGGGGGAGGGGG - Intergenic
997406189 5:133648780-133648802 GAGGTTATGCATGTGGGAGGTGG - Intergenic
997881993 5:137599880-137599902 CAGGGGATGGATGAGGGCTGTGG + Intergenic
998135286 5:139671284-139671306 CAGGGGCTGGAGGTGGGAGGAGG - Intronic
998625641 5:143842702-143842724 CAGAAGTGGGATGCGGGAGGAGG + Intergenic
998976188 5:147651067-147651089 CAGGTGATGGATTTGGAGGGAGG + Intronic
999182669 5:149681103-149681125 CAGGGGAGGGAGGAGGGAGGAGG - Intergenic
1000246126 5:159449836-159449858 ATGGGAATGGATGCGGGAGGGGG + Intergenic
1000300803 5:159954454-159954476 CAGGTGATGGTATCAGGAGGTGG - Intronic
1000962092 5:167611865-167611887 AATGTGATGGTTTCGGGAGGTGG - Intronic
1001362003 5:171096017-171096039 CATGTCAAGGATGCTGGAGGAGG + Intronic
1001610164 5:172993955-172993977 CAAATGATGGATGATGGAGGGGG + Intronic
1002261185 5:177995121-177995143 CAGGTGAGGGGTGCGGGAGATGG - Intronic
1002342220 5:178524609-178524631 CAGGTGGTCCATGGGGGAGGAGG - Intronic
1004266649 6:14153890-14153912 CAGGTGATGGATGAGGATGGTGG - Intergenic
1004324762 6:14664798-14664820 CAGGGGACGGATGTGGTAGGAGG - Intergenic
1004374286 6:15078180-15078202 CAGGTGGTGGAGGGGGGTGGGGG + Intergenic
1005035701 6:21553216-21553238 CAGGTGATGGCAGTGGGAAGTGG + Intergenic
1005856402 6:29866408-29866430 CCTGTGAGAGATGCGGGAGGAGG - Intergenic
1005877400 6:30022264-30022286 GAGGTTATGGATTCGGGGGGAGG - Intergenic
1006625863 6:35397333-35397355 GTGGTGGTGGTTGCGGGAGGGGG - Intronic
1006920100 6:37622134-37622156 CAGGTATTGGTTGGGGGAGGAGG - Intergenic
1007287293 6:40756820-40756842 CAGGTGATCGGTGAGGAAGGTGG + Intergenic
1007380975 6:41489822-41489844 CAGGTGCTGCAGGAGGGAGGAGG + Intergenic
1009397444 6:63215811-63215833 AGGGTGATGGATGTGGGAGGGGG - Intergenic
1011044686 6:83068044-83068066 CAGGTGAGGGAGGCCGGAGGCGG + Intronic
1012290284 6:97447163-97447185 CAGGAGAAGGATGAGGGAGTAGG - Intergenic
1013467496 6:110430391-110430413 GAGGTGATGCATGCAGGGGGCGG + Intronic
1017153751 6:151304649-151304671 CTGGAGGTGGATGTGGGAGGTGG - Intronic
1017764802 6:157597794-157597816 CATGTCCTGGATGTGGGAGGAGG - Intronic
1018446316 6:163862171-163862193 GAGGGGATGGAGGAGGGAGGAGG + Intergenic
1018935923 6:168274071-168274093 CAGCTGCTGGGTGCGGGGGGGGG + Intergenic
1019087846 6:169498809-169498831 GGGGTTATGGATGCGGGTGGGGG + Intronic
1019170012 6:170128602-170128624 CAGGTGGAGGATGCTGTAGGTGG + Intergenic
1019217830 6:170455008-170455030 CAGGTGATGCAGGCGGACGGAGG + Intergenic
1019332493 7:467318-467340 GAGGTGATGGTTGTGGGAGGAGG - Intergenic
1019332508 7:467391-467413 GTGGTGATGGTTGTGGGAGGAGG - Intergenic
1019332517 7:467426-467448 GAAGTGATGGTTGTGGGAGGAGG - Intergenic
1019332528 7:467480-467502 GAGGTGATGGTTGTGGGAGGTGG - Intergenic
1019332540 7:467534-467556 GAGGTGATGGTTGTGAGAGGAGG - Intergenic
1019332543 7:467553-467575 GAGGTGATGGTTTTGGGAGGAGG - Intergenic
1019332561 7:467623-467645 GAGGTGATGGTTGTGGGAGGAGG - Intergenic
1019870029 7:3751700-3751722 CAGCTGACAGATGCGGAAGGGGG + Intronic
1020534520 7:9379068-9379090 AAGGTGATGGTTTCAGGAGGTGG + Intergenic
1021217816 7:17939712-17939734 AAGGTGATGGATGTGGGGGAGGG + Intronic
1022728588 7:33002648-33002670 CAGGTGACAGGAGCGGGAGGCGG - Intronic
1023155544 7:37248012-37248034 AAGGTCAGGGATGCTGGAGGAGG - Intronic
1024235141 7:47392182-47392204 CAGGTGGTGGCTGCGGGGGACGG - Intronic
1025045058 7:55685341-55685363 CAGGTGACAGGAGCGGGAGGCGG + Intergenic
1026493138 7:70880431-70880453 CAGTTGTTGGGTGCGGGAGGGGG - Intergenic
1026667063 7:72350851-72350873 AAGGTGATGGCTGGGTGAGGTGG + Intronic
1027502104 7:78965920-78965942 AAGGTGAGGGATGAGGGATGAGG - Intronic
1029444540 7:100604854-100604876 CGGGCGGTGGAAGCGGGAGGAGG - Intronic
1033147793 7:138885874-138885896 CTTGTGATGGGTGCGGGTGGAGG + Intronic
1033409976 7:141108581-141108603 CAGGTGATGGAGGGGCGAAGAGG + Intronic
1033654258 7:143362499-143362521 GAGGAGAGGGATGGGGGAGGGGG + Intronic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034155738 7:148954942-148954964 CAGGTGAAGAAGGCGGCAGGCGG - Intergenic
1034155970 7:148956289-148956311 CAGGTGAAGAAGGCGGCAGGCGG + Intergenic
1035622122 8:1042767-1042789 TGGGTGATGGATGTGGGTGGTGG + Intergenic
1035622163 8:1042884-1042906 TGGGTGATGGATGTGGGTGGTGG + Intergenic
1035622186 8:1042956-1042978 TAGGTGGTGGATGTGGGTGGTGG + Intergenic
1035622193 8:1042982-1043004 TGGGTGATGGATGTGGGTGGTGG + Intergenic
1035622216 8:1043054-1043076 CAGGTGGTGGATGTGGGTGGTGG + Intergenic
1035622220 8:1043067-1043089 TGGGTGGTGGATGTGGGAGGTGG + Intergenic
1035622256 8:1043191-1043213 TTGGTGGTGGATGCGGGTGGTGG + Intergenic
1035622325 8:1043406-1043428 TAGGTGGTGGATGTGGGTGGTGG + Intergenic
1037590409 8:20307101-20307123 CAGGTGATGAATACAGGAGGAGG - Intergenic
1037805353 8:22055561-22055583 CAGGAGAGTGATGTGGGAGGGGG - Intronic
1038002385 8:23403263-23403285 TAGGTGATGAAGGCGGGAGAGGG + Intronic
1039427793 8:37501023-37501045 CAGGTCATGAAGCCGGGAGGAGG - Intergenic
1039619352 8:38982305-38982327 CAGGGGCTGGAGGTGGGAGGTGG + Intronic
1039829339 8:41200576-41200598 CATGTGATGGATGGGGGTGAGGG - Intergenic
1044728558 8:95212544-95212566 CAGGTGAGGGGTGGGGGATGAGG + Intergenic
1045790622 8:105978849-105978871 CTGGTGATGCATTCGGCAGGTGG - Intergenic
1046405455 8:113766953-113766975 CAAGTGATAGATGCTGGAGTAGG - Intergenic
1048032881 8:130649647-130649669 CAGCTGCTGGATGGGGGAGGAGG + Intergenic
1048137101 8:131757133-131757155 GAGGTGATGGATGGATGAGGTGG - Intergenic
1048733161 8:137467043-137467065 CAGATGATGGAAGAGGGATGGGG - Intergenic
1049745796 8:144262804-144262826 CAGGTGAGGGGTGGGGGGGGGGG - Intronic
1050552254 9:6758393-6758415 CAGGGGAGGGATGCGGGGGCCGG + Intronic
1051291814 9:15552980-15553002 AAGCTGAGGGCTGCGGGAGGCGG + Intronic
1052277336 9:26692045-26692067 CAGGGGTTGGAAGCTGGAGGAGG + Intergenic
1052660591 9:31424275-31424297 GAGGTGATTGAGGTGGGAGGTGG + Intergenic
1052833360 9:33233216-33233238 GAGGTGATGGATATGAGAGGTGG + Intronic
1053554309 9:39119323-39119345 CAGGTGATGGATAGTGGTGGTGG - Intronic
1053564243 9:39231539-39231561 CAGGGGCTGGATGCAGGTGGTGG - Intronic
1053830029 9:42069411-42069433 CAGGGGCTGGATGCAGGTGGTGG - Intronic
1054108667 9:61083111-61083133 CAGGTGATGGATAGTGGTGGTGG - Intergenic
1054132905 9:61387495-61387517 CAGGGGCTGGATGCAGGTGGTGG + Intergenic
1054600529 9:67118042-67118064 CAGGGGCTGGATGCAGGTGGTGG + Intergenic
1054612190 9:67248014-67248036 CAGGTGATGGATAGTGGTGGTGG + Intergenic
1055611905 9:78032007-78032029 GAGGGGATGGGCGCGGGAGGAGG + Intergenic
1056840677 9:89996078-89996100 GAGGGGCTGGATGTGGGAGGTGG + Intergenic
1057314845 9:93961500-93961522 AAGGTGGTGGAGGGGGGAGGTGG - Intergenic
1057443155 9:95096424-95096446 GAGCTGGTGGGTGCGGGAGGTGG + Intergenic
1059331556 9:113538787-113538809 CAGGAGAAGGATGAAGGAGGGGG + Intronic
1060826559 9:126691151-126691173 CAGGTCCTGGAAGCAGGAGGTGG - Intronic
1060829756 9:126706106-126706128 CAGGGGATGGGGGTGGGAGGTGG - Intergenic
1061075763 9:128340615-128340637 CAGGTTTGGGGTGCGGGAGGCGG + Intergenic
1061280015 9:129592472-129592494 CAGGGTCTGGATGCGGGAAGGGG + Intergenic
1061417023 9:130452564-130452586 CAGGTGATGGAGGCGCGGGGAGG + Intronic
1062103424 9:134739922-134739944 CAGGTCAGCTATGCGGGAGGAGG + Intronic
1062517117 9:136942296-136942318 CAGGTCAAAGATGCGGCAGGGGG + Exonic
1062612631 9:137381908-137381930 AATGTGATGGAGGCGCGAGGAGG + Intronic
1189304196 X:39974392-39974414 CAGGAGGTGGATGCTGAAGGTGG - Intergenic
1189399408 X:40652620-40652642 GAAGTGATGGGTGTGGGAGGTGG + Intronic
1191867565 X:65717439-65717461 GAGTTGATGGATGCAGTAGGAGG + Intronic
1195854080 X:109311375-109311397 CATTTGATGGATGGTGGAGGTGG + Intergenic
1197146318 X:123176407-123176429 AAGGAGAGGGATGAGGGAGGAGG - Intergenic
1197313902 X:124940173-124940195 CAAGTGATTGATGCAGGAGTGGG + Intronic
1198493707 X:137169128-137169150 CTGGTGAGGCAAGCGGGAGGTGG + Intergenic
1198994836 X:142562438-142562460 CAGCTGGGGGATGAGGGAGGTGG - Intergenic