ID: 1079453896

View in Genome Browser
Species Human (GRCh38)
Location 11:20620748-20620770
Sequence CTTCAAAGCCAGATAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 337}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079453896 Original CRISPR CTTCAAAGCCAGATAGACCT GGG (reversed) Intronic
900163330 1:1234874-1234896 CTTCAGAGCCACAAAGAACTGGG - Exonic
901491027 1:9596297-9596319 ATGCAGAGCCAGAAAGACCTGGG - Intronic
902053540 1:13582592-13582614 CTTCTCAGCCAGATCTACCTGGG - Intergenic
902650559 1:17834616-17834638 CTTGAAAGTCAGATTCACCTTGG + Intergenic
902669710 1:17964594-17964616 CCTTAAAGACAGATGGACCTAGG - Intergenic
902671348 1:17976370-17976392 CTTCTGAGCCAGATCAACCTGGG - Intergenic
902761933 1:18586869-18586891 CTTCAGAGTCAGATAGATCTGGG + Intergenic
903275238 1:22217441-22217463 CTTCAGAATCAGACAGACCTGGG - Intergenic
903368655 1:22820190-22820212 CTTCAATGCCAGAAAGACCTGGG - Intronic
904642693 1:31942330-31942352 CTTCAGAGGCAGACAAACCTGGG - Intronic
904747111 1:32718124-32718146 CTCCAGAGCCAGAAAGGCCTGGG - Intergenic
904786466 1:32986903-32986925 CTTCAGAGTCAGAAAGATCTTGG + Intergenic
905258677 1:36702138-36702160 CTTCAAAGTCAGAAAAACCTGGG + Intergenic
905295338 1:36951087-36951109 CTACAAAGCCAGAAAGACAAAGG - Intronic
906232039 1:44172249-44172271 CTTCAGAACCCGACAGACCTGGG - Intergenic
906681355 1:47727822-47727844 CTTTGAAGTCAAATAGACCTAGG - Intergenic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
906788895 1:48641511-48641533 CTTCAAAGGCAGAAGGACTTGGG + Intronic
907304771 1:53507387-53507409 CTCTGAAGCCAGATGGACCTGGG - Intronic
907475996 1:54706035-54706057 CTTAAAAGCCAGACAGAAATAGG - Intronic
907545266 1:55254273-55254295 CTTTGAAGTCATATAGACCTTGG + Intergenic
907668793 1:56456581-56456603 CTTTGAAGTCAGATAGATCTAGG - Intergenic
907677442 1:56531700-56531722 CTTGAAAGCCAAACAGATCTAGG + Intronic
907827002 1:58027607-58027629 CTCTAGAGCCAGAAAGACCTGGG + Intronic
907903093 1:58759702-58759724 CTTCCAAGTCAGACAGATCTGGG + Intergenic
908411310 1:63868443-63868465 CTCCAGAGTCTGATAGACCTGGG + Intronic
908668457 1:66518990-66519012 CTTGATTGCCAGATAGACCGAGG + Intergenic
908890187 1:68837693-68837715 CTACAAAGGCAGATTGAGCTTGG - Intergenic
909042136 1:70667270-70667292 CTTTGAAGACAGATAGATCTGGG + Intergenic
909701610 1:78530813-78530835 TTTGAAATCCAGATAGACTTGGG + Intronic
910163287 1:84297463-84297485 TTTAGAAGCCAGATAAACCTTGG - Intergenic
910680672 1:89861010-89861032 CTTCAAAGCCATGCAGAGCTGGG + Intronic
910761276 1:90734178-90734200 CTTCAAATCCACAAAGACATTGG - Intergenic
911742244 1:101399691-101399713 ATTCTGAGCCAGACAGACCTGGG + Intergenic
912472031 1:109912607-109912629 CATCAAAGCCAGACAGCCCTTGG + Intronic
912806270 1:112759168-112759190 CTTCAGAGTGAGATGGACCTGGG + Intergenic
915176881 1:154023124-154023146 GTTCAGAGCCAGATAAAGCTGGG + Exonic
915224831 1:154404798-154404820 CTTTGCAGTCAGATAGACCTGGG - Intergenic
915915615 1:159938662-159938684 CTTGGGAGCCAGATAGACCTAGG + Intronic
916198171 1:162244403-162244425 ATTCAAAACCACATAGAACTTGG - Intronic
916637682 1:166691307-166691329 CTCCAAAGCCAGACTGACATGGG + Intergenic
918342692 1:183580619-183580641 ATGCAATGCCAGATAGACCCAGG - Intronic
919861714 1:201743164-201743186 CTTTAGAGTCAGACAGACCTAGG - Intronic
920157155 1:203962704-203962726 CCTGAAAGCCAGAAAGTCCTGGG + Intergenic
920460985 1:206140184-206140206 CTTCACAGCCAAATGGACCGAGG + Intergenic
920649356 1:207825169-207825191 CTACATACCCAGATAGACCAAGG + Intergenic
920822843 1:209397572-209397594 CATAAAAGCCAGATAGAGCCTGG + Intergenic
924644859 1:245868268-245868290 CTTTGGAGCCAGACAGACCTGGG - Intronic
924835374 1:247641756-247641778 CTTTGAAATCAGATAGACCTGGG - Intergenic
1064812059 10:19211180-19211202 CTTCATAGCCAGATCGACGTGGG + Intronic
1065097952 10:22301117-22301139 CCTCGGAGCCAGACAGACCTGGG + Intergenic
1065317960 10:24483106-24483128 CCTCAAAGCTAAAGAGACCTTGG + Intronic
1067557307 10:47282060-47282082 CTCCAAAGCCAGCTAGACTCGGG - Intergenic
1067909755 10:50334043-50334065 ATTCAAAGTCTGAAAGACCTGGG - Intronic
1068636629 10:59355307-59355329 CTTTAAAGTCAGAGAGGCCTGGG + Intronic
1069087340 10:64156569-64156591 CTTGAAAGACAGATAGAAATGGG - Intergenic
1069532606 10:69230306-69230328 CTCCAAGGCCAAATAGGCCTTGG + Intronic
1071852012 10:89582667-89582689 TTTTAAAGCCAGATAGAAGTTGG + Exonic
1072138710 10:92571786-92571808 CTCCGATGCCAGATAGACATGGG + Intronic
1072552122 10:96487061-96487083 CTTTTAAGCCAGAAAGACCTGGG + Intronic
1072707002 10:97687754-97687776 CTTCAAAGCCAGAATGTCGTGGG + Intergenic
1073049474 10:100658247-100658269 CATGAAAGACAGACAGACCTTGG + Intergenic
1073976834 10:109111728-109111750 TTCCAGAGCCAGATACACCTAGG + Intergenic
1074141340 10:110675709-110675731 CTTTCAAGTCAGACAGACCTGGG + Intronic
1074238780 10:111614575-111614597 CTTCAAAGGCAGACAGAGCTGGG - Intergenic
1075083928 10:119401488-119401510 CTTTAGAGTCAGGTAGACCTGGG + Intronic
1075384326 10:122044124-122044146 CTTCGAAGCCCGAGAGAGCTGGG - Intronic
1075566441 10:123508162-123508184 TTTGTAAGCCAGACAGACCTGGG - Intergenic
1075816663 10:125269934-125269956 TTTCAGAGCCAGCCAGACCTGGG + Intergenic
1078492195 11:11779878-11779900 CTTCGGAGTCAGAGAGACCTGGG - Intergenic
1078882289 11:15464132-15464154 ATTCAAAGCCAGGGAGAACTGGG - Intergenic
1079088533 11:17464403-17464425 CTCCGCAGCCAGATACACCTGGG + Intronic
1079107822 11:17584616-17584638 CATAAAAGTCAGTTAGACCTGGG - Intronic
1079160153 11:17984751-17984773 CTTTGAAGTCAGATAGACCAAGG - Intronic
1079261660 11:18888110-18888132 CTTTAAAGCCAGCAAGAACTGGG - Intergenic
1079453896 11:20620748-20620770 CTTCAAAGCCAGATAGACCTGGG - Intronic
1079886202 11:25992524-25992546 TTTCAAAGCCAGATAGGCTTTGG - Intergenic
1080295449 11:30721939-30721961 CTTCAAAGCCACACAGTCTTAGG - Intergenic
1080458323 11:32434479-32434501 CTCCAAAGCCAGGCAGAGCTAGG - Intronic
1080565213 11:33502729-33502751 CTTCTAAGTCAGTGAGACCTGGG + Intergenic
1080689871 11:34547596-34547618 TTCCAAGGCCAGATAGATCTTGG - Intergenic
1082085320 11:48045165-48045187 CTTCTGATGCAGATAGACCTTGG + Intronic
1082989651 11:59196497-59196519 CTTCAAAGTCCAATGGACCTGGG + Intronic
1083443774 11:62693683-62693705 CTTTAGAGCCAGACAGACATGGG - Intronic
1085024434 11:73228335-73228357 CTTTGAAGCCAGATAGCTCTGGG + Intronic
1085426981 11:76413440-76413462 CTTCGAAGCTAGATGGCCCTGGG + Intronic
1086127465 11:83363877-83363899 CTTAAGAGTCAGAGAGACCTGGG - Intergenic
1086189694 11:84064426-84064448 GGTCACAGCCAGATAGATCTGGG + Intronic
1086282444 11:85206366-85206388 ATTTGAAGCCAGATAGACCTGGG + Intronic
1086405002 11:86492075-86492097 CTTTCAAATCAGATAGACCTGGG + Intronic
1086425635 11:86679845-86679867 CTTTAAAGTCAGATACATCTGGG + Intergenic
1086954132 11:92918014-92918036 CTTTCAAGTCAGATAGACCTAGG + Intergenic
1087116411 11:94529639-94529661 CTTGGAAGCCAGATGGACATGGG - Intergenic
1087123301 11:94597562-94597584 CTTTCGAGCCAGACAGACCTGGG - Intronic
1087136789 11:94729194-94729216 CTTTGAAGTCAGACAGACCTGGG + Intronic
1087332682 11:96800904-96800926 CTTTAAAGCTAGATAGATCTGGG + Intergenic
1089614601 11:119688064-119688086 CTTTGAATTCAGATAGACCTGGG + Intronic
1089667234 11:120028205-120028227 CTGCAGAGCCAGACAGACTTGGG - Intergenic
1089785045 11:120901672-120901694 CTTAAAAGCCAGCAAGACTTTGG + Intronic
1090733789 11:129593744-129593766 CTTTAAAGTTAGACAGACCTGGG + Intergenic
1091032565 11:132204099-132204121 CTCCAATTCCAGGTAGACCTGGG + Intronic
1093285260 12:17252342-17252364 CTACACAGGCAGATAGACTTAGG + Intergenic
1094329555 12:29276035-29276057 CTTCAGAGGCAGACAGACCTGGG + Intronic
1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG + Intronic
1094525986 12:31231649-31231671 GTTCCAAGCCAGACAGCCCTGGG + Intergenic
1095357612 12:41294209-41294231 TTTCAAAGTCAGGCAGACCTGGG + Intronic
1096120586 12:49087041-49087063 CTTAGAAGCCAGCTAGATCTGGG - Intergenic
1096622872 12:52875266-52875288 CTTTAGAGCCAGAGAGTCCTGGG - Intergenic
1097370349 12:58771199-58771221 CTTGAAAACCAGATAGTCGTAGG - Intronic
1097449578 12:59719986-59720008 ATTCAAAGTCAGGTAGACCCAGG - Intronic
1098557945 12:71840011-71840033 CTCCAAGGCCAGCTAGGCCTCGG + Intronic
1100645310 12:96523060-96523082 CTTCAAAACGATATAGAACTGGG - Intronic
1100767677 12:97885787-97885809 CTTCAAAGCGGGACAAACCTTGG + Intergenic
1101202627 12:102452758-102452780 CTTCTGAGCCAGAAAGAGCTGGG + Intronic
1101654114 12:106705029-106705051 GTTGTAAGTCAGATAGACCTGGG + Intronic
1101849413 12:108390382-108390404 CTTTAAAGCCATACAGACCTGGG - Intergenic
1101892006 12:108725553-108725575 CTTTAGGGCCAGATAGAGCTGGG - Intronic
1102301790 12:111776646-111776668 CCTCAAAGCCAAACAGATCTGGG - Intronic
1102513971 12:113434332-113434354 CTTCAAAGCCAGGCAGACATGGG + Intronic
1102693217 12:114778021-114778043 CTTTAAAGCCAGAGAGAGCTAGG - Intergenic
1102799661 12:115720846-115720868 CTGCAAACCCAGGCAGACCTGGG - Intergenic
1103631485 12:122265266-122265288 TTCCAAGGCCATATAGACCTTGG + Intronic
1104369794 12:128214656-128214678 CTTCAAGACCAGATACACCTTGG - Intergenic
1105430458 13:20332732-20332754 CTCCAAAGTGAGACAGACCTGGG - Intergenic
1106052540 13:26205079-26205101 CTACCAAGCCAGATAGACCATGG + Intronic
1106118097 13:26834156-26834178 CTTTAAAGTCAGATGGACCCTGG + Intergenic
1106486036 13:30173502-30173524 CTTCAAAGCCTGAAAGCTCTTGG + Intergenic
1106545930 13:30731303-30731325 CTTTAAAGCCAGACCGGCCTGGG + Intronic
1107404112 13:40097101-40097123 CTTTAGAGCCAGACAAACCTGGG + Intergenic
1108234437 13:48388627-48388649 CTTTGGAGCCAGAAAGACCTGGG - Intronic
1109590310 13:64471061-64471083 TTTTGAAGCCAGATACACCTGGG + Intergenic
1110070709 13:71173900-71173922 CTTTGAAGCAAGATACACCTGGG + Intergenic
1110354499 13:74551708-74551730 CATCAAATCCAGATAGACTCAGG + Intergenic
1111008451 13:82281114-82281136 CTGCTAAGCCAGATGGACCTTGG + Intergenic
1111665619 13:91264935-91264957 CTTAAAAGCCAGAAAGGACTGGG - Intergenic
1113211292 13:107984728-107984750 CTTTGAAGCTAGATAGACTTTGG + Intergenic
1116485011 14:45437144-45437166 CTTAAAAGACAGATACTCCTGGG + Intergenic
1118206208 14:63726348-63726370 GTTCAAAGACAGATAAACATTGG + Intronic
1119193734 14:72702101-72702123 CTTCAAGGGCAGACAGACCAGGG - Intronic
1119348500 14:73945152-73945174 CTTTAGAGTCAGACAGACCTGGG + Intronic
1119584985 14:75824974-75824996 CTTTAGAGTCAGACAGACCTAGG + Intronic
1119629893 14:76220251-76220273 CTTGAAAGCCAGATATAGTTAGG - Intronic
1119677707 14:76568289-76568311 CTTTTAAACCAGACAGACCTAGG + Intergenic
1120751206 14:88199866-88199888 CTTCAAGGTCAGATAGATTTAGG + Intronic
1121307561 14:92916659-92916681 CTTTGGAGCCAGAGAGACCTGGG - Intergenic
1122879345 14:104683136-104683158 CCTCAAAGACACAGAGACCTGGG + Intergenic
1124644013 15:31422317-31422339 CTTCATAGCTGGAGAGACCTCGG + Intronic
1125904536 15:43378878-43378900 CTTTGGAGCCAGATAGAGCTGGG - Intronic
1126274325 15:46858547-46858569 CTTCAGAGTCAGACAAACCTAGG + Intergenic
1126349723 15:47731928-47731950 CTTCAACGTCAGACAGACGTAGG + Intronic
1127639280 15:60900473-60900495 CCTCAGAGTCAGATAGAGCTGGG + Intronic
1127864179 15:63018396-63018418 CTTCAGAGTCAGACAGACCTAGG + Intergenic
1128044072 15:64601899-64601921 CTTCAAAGTCAGACATACATTGG + Intronic
1128801291 15:70498704-70498726 CCTCAAAACCAAATAGATCTCGG + Intergenic
1128920130 15:71602982-71603004 CTTTAGAGCCAGAAAGCCCTGGG - Intronic
1129602991 15:77011106-77011128 CTTTCAAGCCAGACAGACCTTGG + Intronic
1129618963 15:77125674-77125696 CTTTTAAGTCAGACAGACCTGGG - Intronic
1130449918 15:84040994-84041016 CTTCAAAACCAGAAAGCACTAGG - Intergenic
1130610741 15:85358733-85358755 CTGCAAACCCAGACAGACCTAGG + Intergenic
1133844696 16:9443149-9443171 CTTTAGAGTCAGATAGACCTCGG - Intergenic
1134254459 16:12600292-12600314 ATTCAGAGCCAGCAAGACCTGGG + Intergenic
1134769229 16:16791723-16791745 CTTCAAATTCAGATGGACCTGGG - Intergenic
1134857527 16:17532810-17532832 CTTCAGAGCCAGAGAGATATGGG + Intergenic
1135009100 16:18857105-18857127 CTTCACTGCCAAATATACCTGGG - Intronic
1137571158 16:49567248-49567270 CATCAAAGCCAGCTAAAGCTGGG - Intronic
1138705640 16:58912409-58912431 CTCTAGAGCCAGAGAGACCTGGG + Intergenic
1139110717 16:63887272-63887294 CTTCAAAAACAGAAAGACCCAGG + Intergenic
1139385983 16:66571472-66571494 CTTTAGAGTCAGATAGACCTGGG - Intronic
1139517595 16:67460890-67460912 CTTCAGAGCCACAAGGACCTGGG + Intronic
1142793101 17:2284110-2284132 ATTACAAGCCAGACAGACCTTGG + Intronic
1143186734 17:5014527-5014549 CTTCAGAGTCAGGCAGACCTGGG + Intronic
1143599976 17:7938710-7938732 TTCCAGAGCCAGGTAGACCTGGG - Intronic
1144552767 17:16255955-16255977 CTTCAAAGCCAGATTATTCTGGG + Intronic
1145017734 17:19410184-19410206 CTTCAGAGCCAGGCAGATCTGGG - Intergenic
1146005917 17:29160640-29160662 CTTTGGAGCCAGAAAGACCTGGG - Intronic
1146012293 17:29205641-29205663 CTTTGGAGCCAGACAGACCTGGG + Intergenic
1146153380 17:30497393-30497415 CTTTGAAGCCAGAGAGTCCTGGG + Intronic
1148359941 17:47003450-47003472 CTTCAGAGCCAAACAAACCTGGG - Intronic
1149666442 17:58368081-58368103 CTCTCAAGCCAGATAGCCCTGGG - Intronic
1150055115 17:62007546-62007568 CTTCAAACTGAGTTAGACCTTGG + Intronic
1150786915 17:68170437-68170459 CTTCAGAGCCAAACAAACCTGGG + Intergenic
1150897724 17:69233856-69233878 TTTCTAGCCCAGATAGACCTGGG + Intronic
1151895504 17:76977801-76977823 CTTCAAAGCCCTCTAGAACTAGG + Intergenic
1152263688 17:79281075-79281097 CTTCTGAGCCAGACATACCTGGG + Intronic
1156284816 18:35681816-35681838 CTTTAAAGTCAGGCAGACCTGGG + Intronic
1160900813 19:1427385-1427407 CTTCCAAGCCAGACAGTCGTTGG + Intronic
1162105191 19:8366053-8366075 CTGCAAAGCCAGGTAACCCTAGG + Exonic
1163827771 19:19533176-19533198 CTCCAGAGCCAGACACACCTGGG - Intronic
1166412201 19:42563047-42563069 CTTTATATCCAGATAGACCTGGG + Intergenic
925872224 2:8281376-8281398 ATTCAAAGCCACGTGGACCTGGG + Intergenic
926853341 2:17225397-17225419 CTTCAAAGCCAGAGAAATCTGGG + Intergenic
926861899 2:17318599-17318621 CTTGAAAGCCAGACACACCTGGG + Intergenic
927215955 2:20667863-20667885 CTGCAAGGCCAGGGAGACCTGGG - Intronic
927918305 2:26950770-26950792 CTTCAAAGGCATATTGGCCTTGG - Intergenic
928653613 2:33426810-33426832 AGTCAAAGCCAGTTAGACTTTGG + Intergenic
929407558 2:41660183-41660205 CTTCATAGCTGGATATACCTGGG + Intergenic
929864545 2:45707171-45707193 CTTCACAGGCAGATATTCCTCGG + Intronic
929982668 2:46696571-46696593 CTTCAAACCCAGAGAACCCTGGG - Intergenic
930454651 2:51591374-51591396 CATCATAGCCAGATAGAAATGGG - Intergenic
930849164 2:55939443-55939465 CTTCAAACCCATAAAAACCTAGG + Intergenic
932098686 2:68876299-68876321 AATCAAATCCAGATAGACTTGGG + Intergenic
932279372 2:70476451-70476473 CTGCAAAGGCAGGTAGCCCTGGG - Intronic
932781179 2:74559610-74559632 CTTCAACCCCAGATAGTCATGGG + Intronic
933070649 2:77854202-77854224 CTTTAAAGCCAGAAATGCCTGGG - Intergenic
934580232 2:95431942-95431964 ACTCAAAGTCAGAGAGACCTGGG - Intergenic
934599214 2:95644772-95644794 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
934737994 2:96699667-96699689 CTCCAAAGCCAGATAGGAGTCGG - Intergenic
935254762 2:101299934-101299956 CTTCACAGCCAGACAGACCTGGG + Intronic
936151664 2:110025278-110025300 CTTCAAAGGAAGAGAGACCTGGG + Intergenic
936193010 2:110346091-110346113 CTTCAAAGGAAGAGAGACCTGGG - Intergenic
936532566 2:113286770-113286792 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
936663960 2:114573612-114573634 CTTCAAAGGGAAATAGATCTTGG + Intronic
936885523 2:117306671-117306693 CTTCAAAGCCAGAAAGGAATGGG - Intergenic
937082364 2:119149432-119149454 CTTTGACGTCAGATAGACCTGGG + Intergenic
937128120 2:119487515-119487537 CTTGACAGTCAGACAGACCTGGG - Intronic
937227487 2:120378082-120378104 CATCAGAGCCAGACAGATCTTGG + Intergenic
937632471 2:124118894-124118916 ATTTGGAGCCAGATAGACCTGGG - Intronic
938369373 2:130759739-130759761 GTTCAGAATCAGATAGACCTGGG + Intronic
938813253 2:134872989-134873011 TTTCAAAGTCAAATTGACCTGGG + Intronic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
940158792 2:150689211-150689233 CTTTAAAATCAGATAGACCTGGG - Intergenic
940885046 2:158982374-158982396 CTTTGAAACCAGATAGACTTTGG + Intronic
940944684 2:159602139-159602161 GTTTAAAGCAAGATAAACCTAGG + Intronic
942872194 2:180748622-180748644 CTTCTAATCCAGAGATACCTGGG + Intergenic
942928813 2:181464599-181464621 CTTCAAAACCAGTCAGAACTGGG - Intronic
943096865 2:183439709-183439731 TTTTGAAGCCAGAGAGACCTGGG + Intergenic
943382347 2:187167103-187167125 CTTTGAAGTCAGACAGACCTTGG - Intergenic
945816648 2:214613170-214613192 CTTCAAAGACAGATAGGATTTGG + Intergenic
948124983 2:235558003-235558025 CTTTAGAGGCAGATACACCTGGG + Intronic
948171648 2:235908204-235908226 CTAGAAAGCCAGATACCCCTTGG + Intronic
948204160 2:236153308-236153330 CTTCCAAGCCAGATAATCTTTGG - Intergenic
1169248995 20:4046074-4046096 CTTTGAAGGCAGCTAGACCTGGG - Intergenic
1172210880 20:33197703-33197725 CTTCAGAGACAGACAGACCTGGG - Intergenic
1172356309 20:34282686-34282708 CTTTGAAGCCAGATAGACCTGGG - Intronic
1172860961 20:38051584-38051606 CTTTAAAGTCGTATAGACCTGGG - Intronic
1173333157 20:42092407-42092429 CTTCAAAGACAGAATGAACTTGG + Intronic
1173931833 20:46827302-46827324 CTTTAAAGTCAGAGAGGCCTGGG - Intergenic
1174969922 20:55263549-55263571 ATTCAGAGCCAGATAGAAGTGGG - Intergenic
1175598953 20:60257216-60257238 CTCCAGAGTCAGACAGACCTGGG - Intergenic
1178110715 21:29367394-29367416 CTGCAAGGTCACATAGACCTAGG + Intronic
1178304873 21:31483045-31483067 CTTTACAGCCAGATACACTTGGG - Intronic
1178576885 21:33801226-33801248 CTTCAAAGACATACAGTCCTTGG - Intronic
1178708653 21:34895176-34895198 CTTCTCAGCCAAATGGACCTTGG - Intronic
1180520521 22:16197780-16197802 TTTCAAATTCAAATAGACCTAGG - Intergenic
1183427462 22:37747175-37747197 CTTCACAGCCAGATAAACTGAGG + Intronic
949358858 3:3210432-3210454 CTCCAAAGCCAGATAGATAAAGG - Intergenic
949734789 3:7159644-7159666 ATTGGAAGCCAGATATACCTAGG + Intronic
949814810 3:8047445-8047467 CTTCAAAGTCAGACATGCCTGGG - Intergenic
950021628 3:9792028-9792050 CTGGTAAGCCAGACAGACCTGGG + Intronic
950615867 3:14157774-14157796 CTCCAAAGCCACACAGACCTGGG + Intronic
951143519 3:19197414-19197436 CTCCAATGCCAGATAGATTTGGG - Intronic
951519812 3:23600897-23600919 CTTCACAGCCACAGAGACCTGGG - Intergenic
951698109 3:25467045-25467067 CTTCTAAGCCACAGAGCCCTGGG - Intronic
951779951 3:26351152-26351174 CTTCAAAGGCATTTAGGCCTTGG - Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952499334 3:33945314-33945336 CTTTGAAGTCAGACAGACCTGGG - Intergenic
953209808 3:40865854-40865876 CTTCAAACTCAGAAAGATCTGGG + Intergenic
954541876 3:51398664-51398686 CTTAAAAGACAGACAGCCCTGGG + Intronic
954795436 3:53159258-53159280 CTTTGGAGCCAGACAGACCTCGG + Intronic
954945018 3:54415806-54415828 CTTTGAAGCCAGAAAGACTTAGG - Intronic
955385152 3:58473480-58473502 CTGACAAGACAGATAGACCTGGG + Intergenic
955996069 3:64682119-64682141 CTTTGAAGCCAGATTGCCCTAGG + Intronic
956870597 3:73413586-73413608 TTTCGAAGCCAGGCAGACCTGGG - Intronic
957670957 3:83302227-83302249 CTTCAAAGCAACATTTACCTAGG - Intergenic
958894019 3:99810487-99810509 CTTCGAAGCCAGGTGGACCATGG - Intergenic
960738364 3:120804784-120804806 CTTTAATGTCAGATAGACCAGGG + Intergenic
960925661 3:122793501-122793523 ATGCAAGGCCAGAGAGACCTGGG + Intronic
961122822 3:124387531-124387553 CTTTAGAGTCAGAAAGACCTGGG - Intronic
961741852 3:129038201-129038223 CTTCAGAGCCCCACAGACCTGGG - Intronic
962158639 3:132976053-132976075 CTTCAGAACCATTTAGACCTGGG - Intergenic
962974406 3:140433580-140433602 CTCCGAAGCCAGAAAGACCCAGG + Intronic
965692325 3:171370981-171371003 CTTCAGATTCAGAGAGACCTGGG + Intronic
966887645 3:184385709-184385731 CTTGGGAGTCAGATAGACCTGGG + Intronic
967237225 3:187397250-187397272 CTTCAGAGCCTGATAAACTTTGG - Intergenic
967291798 3:187928180-187928202 CCACTAGGCCAGATAGACCTGGG + Intergenic
967299432 3:187998159-187998181 CTTTAGAACCAAATAGACCTGGG + Intergenic
967529507 3:190532646-190532668 CTTTACAGCCATATAGACCTGGG - Intronic
967814272 3:193786073-193786095 CTTCTAAGCCTGGTGGACCTGGG + Intergenic
969619759 4:8273143-8273165 CTGCAAAGCCAGCCAGACCCAGG - Intronic
970155560 4:13138157-13138179 CTTCAAGGACAGAGAGATCTGGG + Intergenic
970174485 4:13325207-13325229 CATGAAAGCCATATAGCCCTCGG + Intergenic
970560506 4:17277288-17277310 CTTCAAAGGAAGAAGGACCTAGG + Intergenic
972703366 4:41515725-41515747 CTCCAGAGACAGAAAGACCTGGG - Intronic
973792639 4:54392516-54392538 CTTTAACACCAGATAGTCCTGGG - Intergenic
974115537 4:57575000-57575022 ATACAGAGCCAGAAAGACCTGGG - Intergenic
974667949 4:64989805-64989827 CTTCAGAGTCAGATAGACCTGGG - Intergenic
974939715 4:68451851-68451873 CTTTGAAGTCAGATAGACCCTGG - Intronic
975198541 4:71556120-71556142 TTTTAAAGTCAGATAGAACTGGG + Intronic
975791345 4:77955143-77955165 CTTTAAAATTAGATAGACCTGGG - Intergenic
975822645 4:78287468-78287490 CTGAAAAGGCAGATAGACCAGGG + Intronic
976580925 4:86735977-86735999 ATTAACAGCCAGATAGACATGGG - Intronic
980951478 4:139383329-139383351 CTTTGAAGCCAGTTAGACTTGGG - Intronic
981887888 4:149699796-149699818 TTTCAAAGAATGATAGACCTAGG + Intergenic
988903878 5:35764381-35764403 CTTTGAAGTCATATAGACCTAGG - Intronic
989819309 5:45775974-45775996 ATTCAAAGTCAGATAGAATTAGG - Intergenic
991043852 5:62202549-62202571 CTTCAAATCCAGAAAGGACTTGG + Intergenic
991210639 5:64100488-64100510 ATTCATGGCCAGGTAGACCTGGG + Intergenic
991281203 5:64916329-64916351 CTTTAAAGTCAGAAAAACCTAGG + Intronic
992407450 5:76473093-76473115 CTTTGAAGTCAGAAAGACCTAGG - Intronic
994690630 5:103015133-103015155 TTTCAAAGTCAGAAAGACCTAGG - Intronic
994876290 5:105426503-105426525 CTAGATAGCCAGATATACCTAGG - Intergenic
995414568 5:111894640-111894662 ATTCAAAGCAACAAAGACCTTGG + Intronic
995979962 5:118089454-118089476 TTTCAAAGCCAGCAAGAGCTGGG - Intergenic
996416805 5:123219582-123219604 CTTCAGAGCCAGATAGACTTGGG + Intergenic
996528984 5:124507752-124507774 CTTCTAACTCAGATAGACTTGGG - Intergenic
997349357 5:133219444-133219466 CTTCAGAGTCAGGTAGACTTGGG - Intronic
998450903 5:142233933-142233955 CTCCAAAGCCAGAAATACCTTGG - Intergenic
1000191636 5:158916640-158916662 CTTCAGAGATAGAGAGACCTGGG - Intronic
1000244458 5:159437907-159437929 CTACAAAGTCAGACAGACCTGGG - Intergenic
1000379625 5:160617038-160617060 CTTTAAAGCCAGAACCACCTGGG - Intronic
1000435262 5:161200037-161200059 CTTCAAAGCCATAGTGACCAAGG - Intergenic
1001104619 5:168842684-168842706 CTTTACAGCCAGACACACCTGGG - Intronic
1001323011 5:170698326-170698348 CTTTATAGCCACATAGAACTGGG - Intronic
1001656629 5:173355757-173355779 CTTGAAAGCCAGAAAGCCCTGGG - Intergenic
1001892747 5:175352850-175352872 GTTTGAAGTCAGATAGACCTGGG - Intergenic
1003443243 6:6162560-6162582 CTTCCAAGTCAGGAAGACCTGGG + Intronic
1006772607 6:36566134-36566156 CTTCAAAGTCAGATAATACTGGG - Intergenic
1007236639 6:40395134-40395156 CTTCAGAGCCAGTTTCACCTGGG + Intronic
1007935599 6:45729480-45729502 TTTCAAAGCCAAATAGGCATGGG - Intergenic
1008665374 6:53710827-53710849 GTTCAAGGCCACATACACCTAGG - Intergenic
1009507480 6:64503257-64503279 GTTCAAAGACAGAGAGTCCTTGG + Intronic
1010034614 6:71310432-71310454 CTTTGAAGCCAGATGGACTTTGG + Intergenic
1011723294 6:90181887-90181909 CTGCAGAGTCAGAGAGACCTAGG - Intronic
1011917073 6:92520216-92520238 CTTTAGAGCCAGCTAGACTTGGG + Intergenic
1013562786 6:111322639-111322661 TCACAAAGCCAGAGAGACCTTGG - Exonic
1015710354 6:136132427-136132449 CTTCAAGGTCAGAAAGACCCAGG + Intronic
1016882419 6:148923837-148923859 CTTGGAAGCCAGATAGGCCGGGG + Intronic
1020331358 7:7020228-7020250 CTTCAAAGTCAAATAGACAATGG + Intergenic
1020357204 7:7290637-7290659 CTTTGGAGTCAGATAGACCTGGG - Intergenic
1021324899 7:19254898-19254920 TTTCAAAGCCAAACAAACCTTGG + Intergenic
1021836726 7:24684055-24684077 CTCTAAAGACAGAAAGACCTAGG - Intronic
1023303120 7:38794688-38794710 CTTTGAGGCCAGACAGACCTGGG - Intronic
1024355501 7:48410204-48410226 CTTCAAAGACAGAGAGAACAGGG + Intronic
1026970635 7:74465405-74465427 CTTTGAAGCCAGACACACCTAGG + Intronic
1027901242 7:84117765-84117787 CTTTAAAGTCAGTTAGACATGGG + Intronic
1028974927 7:96902173-96902195 CTTAGAAGCCAAATAGATCTGGG + Intergenic
1032453289 7:132052947-132052969 CTGCAGAGCCATATGGACCTTGG - Intergenic
1032656471 7:133936017-133936039 CTTCAAAGTGAGATAAACCCAGG - Intronic
1036077518 8:5517920-5517942 CTTTAAAGCCTGAGAGTCCTTGG + Intergenic
1036915982 8:12804103-12804125 CTTCAAAGTCAGACAGGTCTAGG - Intergenic
1037204801 8:16303771-16303793 TTTCAACTCCAGATAGATCTGGG + Intronic
1037571693 8:20163440-20163462 ATTCAAACCCAGGTGGACCTGGG + Intronic
1038162192 8:25050378-25050400 TCTCAAAGCCAGAGAGACCAAGG + Intergenic
1038607701 8:29025386-29025408 CTTCAGAGCCACACAGACTTAGG + Intronic
1038945105 8:32350473-32350495 TTTGAAAGTCAGATGGACCTTGG + Intronic
1040034506 8:42856776-42856798 CTTTAAAGTCAGACAGATCTGGG + Intronic
1040655584 8:49503758-49503780 CTTTAAAGTCAAACAGACCTGGG + Intergenic
1041499086 8:58519932-58519954 CATTAAAGCCAGATCTACCTTGG + Intergenic
1041649642 8:60289146-60289168 CTTTAAAGCTGGTTAGACCTAGG - Intergenic
1041983555 8:63892846-63892868 CTTCAAAGTCAGATTAATCTAGG - Intergenic
1043065411 8:75564289-75564311 CTTCAAACTCAGATATACATTGG - Exonic
1043396340 8:79841749-79841771 CTTGAGAGTCAGACAGACCTAGG + Intergenic
1044295727 8:90525080-90525102 CTTTAGAGCCAGACAGCCCTGGG + Intergenic
1047333221 8:123911560-123911582 ATGCAGAGCCAGAAAGACCTAGG - Intronic
1047570345 8:126091276-126091298 CTTCAGAGCCAGATAGACTTAGG - Intergenic
1048240718 8:132739265-132739287 CTTTTAAATCAGATAGACCTCGG + Intronic
1048417103 8:134239623-134239645 TTTGGAAGCCAGAGAGACCTGGG - Intergenic
1049285620 8:141773619-141773641 CTTCAGAGCCAGAAGGCCCTGGG + Intergenic
1049369851 8:142259084-142259106 CTTCAGAGTCAGACAGACCTGGG - Intronic
1049469130 8:142767572-142767594 GTTCAAAGCCAGGGAGGCCTTGG - Intronic
1051038547 9:12778158-12778180 CTTTGAAGCCAGATAAACCAGGG + Intronic
1055419864 9:76127942-76127964 CTTCAGAGTCAGGAAGACCTAGG - Intronic
1055742933 9:79409464-79409486 TTTCAGATCCAGAAAGACCTGGG - Intergenic
1056114055 9:83424894-83424916 TTGCAAAGCCAGATAGAACTGGG - Intronic
1056942652 9:90968658-90968680 CTTTAGAGCCAGATACAACTGGG + Intergenic
1057250855 9:93500451-93500473 ATTTAAAGCCAGGCAGACCTTGG - Intronic
1058583331 9:106482004-106482026 ATTTACAGCCAGAGAGACCTTGG - Intergenic
1058812258 9:108652431-108652453 TTTTAAAGCCAGAAAGACTTGGG - Intergenic
1059382374 9:113936192-113936214 CTCCAGAGGCAGACAGACCTGGG + Intronic
1059403295 9:114084200-114084222 CTTTATATCCAGACAGACCTGGG + Intergenic
1059620082 9:115994617-115994639 CTTCACAGCCTGGGAGACCTGGG + Intergenic
1059910186 9:119034667-119034689 CTTCTAAGCCAGAAAGACTGGGG - Intergenic
1060368648 9:123046464-123046486 CTTGAGAGGCAGACAGACCTGGG + Intronic
1061146083 9:128799481-128799503 CTTCAAAAGCAGAAAGCCCTGGG + Intronic
1186763985 X:12752141-12752163 CTTGGGAGCCAGAGAGACCTGGG + Intergenic
1190776201 X:53554105-53554127 CTTTAAAGTCAGACAGATCTGGG + Intronic
1191673837 X:63774260-63774282 ATTAAAAGTCAGATGGACCTGGG - Intronic
1191952950 X:66614475-66614497 CTTTAGAGCCAGATACACATGGG - Intronic
1192356650 X:70410418-70410440 CCTAGAAGCCAGATAGACATGGG + Intronic
1193464388 X:81829855-81829877 CTTCAAAACAAGGTACACCTGGG + Intergenic
1195603948 X:106780778-106780800 CTTTAAAGCCAGATAGAACCTGG + Intronic
1196199568 X:112870325-112870347 CTTTGGAGTCAGATAGACCTAGG + Intergenic
1198411441 X:136373444-136373466 CTTTAAAGCCAGACAGACATAGG - Intronic
1198481547 X:137045938-137045960 CTCCACAGCCAGATAGTCCCAGG - Intergenic
1201274287 Y:12284118-12284140 TTTAAAAGCCTGATAGCCCTAGG + Intergenic
1202059232 Y:20868409-20868431 CTTCTAAGACAGAGAGCCCTAGG - Intergenic