ID: 1079455702

View in Genome Browser
Species Human (GRCh38)
Location 11:20634322-20634344
Sequence TACCCAAGGCAGATGGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079455702_1079455709 24 Left 1079455702 11:20634322-20634344 CCGCTCCCCATCTGCCTTGGGTA 0: 1
1: 0
2: 4
3: 27
4: 342
Right 1079455709 11:20634369-20634391 TGCAAAGAATGCCTTCACCTGGG 0: 1
1: 0
2: 0
3: 9
4: 166
1079455702_1079455708 23 Left 1079455702 11:20634322-20634344 CCGCTCCCCATCTGCCTTGGGTA 0: 1
1: 0
2: 4
3: 27
4: 342
Right 1079455708 11:20634368-20634390 TTGCAAAGAATGCCTTCACCTGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079455702 Original CRISPR TACCCAAGGCAGATGGGGAG CGG (reversed) Intronic
900126408 1:1070752-1070774 CTCCCCAGGGAGATGGGGAGAGG - Intergenic
900566325 1:3333885-3333907 TACTCATGGCAGAAGGGGAGGGG - Intronic
902742509 1:18448729-18448751 TGTCCAAGGCAGATGGAGATAGG - Intergenic
903845545 1:26277941-26277963 GACACAAGGCAGCTGGAGAGTGG - Exonic
903871238 1:26436362-26436384 TACCCAAGGTGGATGGAGTGTGG - Intronic
904989119 1:34577203-34577225 TACCAAAGGCTGAGGGCGAGGGG - Intergenic
905124101 1:35705173-35705195 TACCTAAGGCATGCGGGGAGTGG + Intergenic
905309291 1:37038177-37038199 CACCCAAAGTAGCTGGGGAGGGG - Intergenic
905380947 1:37561247-37561269 TACCTAAGGCAGGAAGGGAGGGG + Intronic
905746516 1:40422936-40422958 TACCCAGAGCAGATGGGGAGAGG - Exonic
906313026 1:44767319-44767341 GGCCCAGGGCAGCTGGGGAGGGG + Exonic
906678422 1:47709318-47709340 AAGCCGACGCAGATGGGGAGAGG - Intergenic
906713698 1:47951626-47951648 TACCCAAGGTAGAGAGGGTGGGG + Intronic
907253442 1:53159534-53159556 TACTCCAGGCAGAAGGTGAGGGG - Intergenic
907313483 1:53553138-53553160 TCGCCAAGGCTGATGGGGATGGG - Intronic
907883476 1:58572576-58572598 TACCCAAGTCAGACAGAGAGGGG - Intergenic
908011040 1:59777630-59777652 TGCCCAAGACAGAGAGGGAGGGG + Intergenic
910012728 1:82485702-82485724 TAGCCAAGGCAGAGAGAGAGAGG + Intergenic
911364282 1:96917977-96917999 TACCAAAGGCAGTGGGGGAAGGG + Intergenic
913026083 1:114842078-114842100 TACCTAAGTCAGATTGGGAAAGG + Intergenic
915102129 1:153508164-153508186 GCCCCAAAGCAGATGAGGAGGGG + Intergenic
915123400 1:153647086-153647108 GTCCCAAGGGAGATGGGCAGTGG + Intergenic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
916684901 1:167135498-167135520 TAACAATGGCAGATGGGGTGTGG + Intergenic
918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG + Exonic
918229625 1:182515806-182515828 TGCCCTAGCCAGAAGGGGAGGGG + Intronic
918340399 1:183563679-183563701 TACCCAATACAGCAGGGGAGAGG + Intronic
921166700 1:212513179-212513201 GACCCAAGGCAGCTGGGGCCAGG + Intergenic
922520477 1:226246422-226246444 TACCCAGGGCAGGATGGGAGTGG - Intronic
922747335 1:228051810-228051832 TACACATGGCAGAAGTGGAGTGG + Intronic
923863985 1:237919278-237919300 CAGCCAAGGCAGAGAGGGAGAGG + Intergenic
924183542 1:241463750-241463772 TCCCCAAGTCACATGGGGAAGGG - Intergenic
924662913 1:246038501-246038523 TACCCGAGGCACATGTGGATAGG - Intronic
1064503867 10:16008585-16008607 TAGCCAATGCGGTTGGGGAGAGG + Intergenic
1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG + Intergenic
1066066440 10:31764680-31764702 TACTCATGGCAGAAGGGGAAGGG - Intergenic
1067092716 10:43277488-43277510 TACCCAGGGCAGAGGGAGAGAGG - Intergenic
1067094191 10:43287455-43287477 TGCCCAAGGCACATGGGGGCAGG - Intergenic
1067106716 10:43371520-43371542 CACCCAGGGCTGTTGGGGAGGGG - Intergenic
1068574535 10:58670449-58670471 TTGCCATGGCAGATGGGGACAGG - Intronic
1069719097 10:70538802-70538824 GGCCCAAGGCAGACGGGGGGTGG - Intronic
1069776023 10:70927647-70927669 TAGCCTAGGCAGGTGGGGAGTGG + Intergenic
1069799469 10:71073113-71073135 TGCCCAAGGCAGAGAGGGAGGGG - Intergenic
1071186980 10:83057757-83057779 TAGCAAAGGGAGATGGGGTGGGG - Intergenic
1071774151 10:88765958-88765980 CACACAAGCCAGATGGGGAAAGG + Intronic
1072048483 10:91680745-91680767 TCACCAAGTCAGATGAGGAGAGG + Intergenic
1072063650 10:91842934-91842956 TTCCCAAAGCACATGGGGACTGG - Intronic
1073423093 10:103440166-103440188 CTCCCAAGGCAGATGGGGGCAGG + Intronic
1075100408 10:119502582-119502604 CACCCAGGGCAGAGGAGGAGGGG + Intronic
1075559070 10:123455538-123455560 CACCCCAGGCTGATGGGGAGAGG + Intergenic
1076222539 10:128746046-128746068 TTCCCAGGGCACATGTGGAGGGG + Intergenic
1076442155 10:130487401-130487423 CAGCGAAGGGAGATGGGGAGGGG - Intergenic
1076511889 10:131019989-131020011 AACCCAGGACAGATGGGAAGAGG + Intergenic
1077160495 11:1110329-1110351 TCCCCTAGGCATCTGGGGAGCGG + Intergenic
1077932230 11:6745552-6745574 TATCTAAGTCATATGGGGAGGGG - Intergenic
1078627925 11:12975250-12975272 TACTCAAGTAAGATGAGGAGTGG - Intergenic
1078902154 11:15651297-15651319 TCCCGGAGGCAGACGGGGAGCGG + Intergenic
1079127998 11:17732385-17732407 TGACCCAGGCAGTTGGGGAGGGG - Intergenic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1080721152 11:34849893-34849915 TAACCAAGCCAGATGAGAAGTGG + Intergenic
1080770092 11:35332709-35332731 TGTTCAGGGCAGATGGGGAGAGG - Intronic
1080878765 11:36300274-36300296 TACTCATGGCAGAAGGTGAGGGG + Intronic
1082765374 11:57163502-57163524 TACCCTAGGGAAATGGGGACTGG - Intergenic
1083130261 11:60618490-60618512 TAGCCAAGGCAGAGAGAGAGAGG + Intergenic
1083426986 11:62593310-62593332 TACAAAAGGCAGAGGGGGAGGGG + Exonic
1083831520 11:65236677-65236699 TCCCACAGGCAGATGGGGATGGG + Intergenic
1084559349 11:69894007-69894029 AACCCAAGTGAGATGGCGAGTGG - Intergenic
1085273469 11:75283731-75283753 TCCCCAGGGCATATGTGGAGGGG + Intronic
1085794505 11:79525669-79525691 TGCCAAAGGCTGAGGGGGAGGGG - Intergenic
1086087785 11:82972371-82972393 CGCCCAAGGCAGAGGGTGAGAGG + Intergenic
1089322217 11:117634116-117634138 GACCCAGGGCAGAGGGGGACCGG + Intronic
1090234875 11:125139848-125139870 TGCCCAAAGCAGGGGGGGAGGGG - Intergenic
1090682572 11:129077327-129077349 AAGACAAGGTAGATGGGGAGGGG + Intronic
1091885629 12:4015274-4015296 TAACCAAGGCAGAATGGAAGAGG + Intergenic
1092759760 12:11799118-11799140 AACTAAAGGCAGAGGGGGAGGGG + Intronic
1093992210 12:25602771-25602793 AACTAAAGGCAGATGGGAAGAGG + Intronic
1096227270 12:49874293-49874315 CTCCCAGGGCAAATGGGGAGAGG - Intronic
1096980369 12:55725152-55725174 TGTCCAAGGCAGATGGGGGCTGG + Intergenic
1097052219 12:56230402-56230424 TTCCCAAGGAATATGGGGATGGG + Intronic
1097152159 12:56987111-56987133 TACCCAGGGCTGCTGGGAAGGGG + Intergenic
1100382347 12:94073572-94073594 TCCACAAGCCAGATGGGCAGTGG + Intergenic
1100933866 12:99640537-99640559 ATCCCAAGGCAGAAGGTGAGAGG - Intronic
1101505218 12:105340133-105340155 TACTCAATGCAGGTGGGGCGTGG + Intronic
1102201915 12:111063198-111063220 TTCCCTGGGCAGATGAGGAGGGG + Intronic
1103402017 12:120649583-120649605 ACCCCAAGGAAGCTGGGGAGAGG + Intronic
1103547680 12:121713341-121713363 TACCAAAAGCAGATGGGAGGGGG - Intronic
1104694317 12:130852040-130852062 GACCCAAGACAGATGGGAATGGG + Intergenic
1105019918 12:132809133-132809155 CAACCAAGGCAGAGAGGGAGAGG + Intronic
1105349842 13:19605228-19605250 TACACAAGGTAGAGGGGGAATGG - Intergenic
1105418753 13:20234633-20234655 TTCCCATGGCAGAGGTGGAGGGG + Intergenic
1105587524 13:21758809-21758831 TACCAAAGGAAGATGGGGGGAGG - Intergenic
1109726466 13:66347788-66347810 TAAAGAAAGCAGATGGGGAGAGG - Intronic
1110503221 13:76253465-76253487 TACCAAAGGCCGATGGAGAAAGG - Intergenic
1111213369 13:85109364-85109386 AACCCTAGGCAGATAGGGATGGG - Intergenic
1111290676 13:86166146-86166168 CACTCAAGGCAGATGGTGAAGGG + Intergenic
1111763856 13:92500784-92500806 TATCTAAGGCAGGTGGTGAGTGG - Intronic
1112023312 13:95390788-95390810 TACAGAAGGCGGAAGGGGAGAGG - Intergenic
1112660137 13:101498469-101498491 TATCCAAGACAGATGGTAAGGGG + Intronic
1112802090 13:103124013-103124035 GGCCCAAGGAAGATGGAGAGGGG - Intergenic
1112957099 13:105073380-105073402 TGCAGGAGGCAGATGGGGAGTGG - Intergenic
1113408147 13:110060940-110060962 AACCCAAGGGCGATGGGGTGGGG + Intergenic
1113535526 13:111063298-111063320 CAGCAAAGGGAGATGGGGAGGGG - Intergenic
1114229445 14:20767379-20767401 AACTCAAAGCTGATGGGGAGTGG - Intergenic
1114730499 14:24987780-24987802 TACCCAAGGGAGATGCAGAGTGG + Intronic
1114823780 14:26052921-26052943 TACTCATGGCAGAAGGTGAGGGG - Intergenic
1115504638 14:34081420-34081442 GACCCAAGGCAGATGTGATGTGG - Intronic
1119172303 14:72544687-72544709 CAGGCAAGTCAGATGGGGAGCGG + Intronic
1120592806 14:86395371-86395393 TACTCATGGCAGAAGGTGAGGGG + Intergenic
1121400322 14:93670516-93670538 AACGCAAGGCACATGGGAAGGGG + Intronic
1122548651 14:102538615-102538637 TGGCCCAGGCAGCTGGGGAGGGG - Intergenic
1124956337 15:34362914-34362936 TCCCCAACCCAGGTGGGGAGTGG + Intronic
1125398655 15:39276623-39276645 GACCCCAGGCAGACGGGGATGGG + Intergenic
1128771244 15:70284060-70284082 TACTCAAGCCAGTTGGGTAGGGG - Intergenic
1129737567 15:77974690-77974712 TACTGAAGGCAGGTGTGGAGAGG - Intergenic
1129877110 15:78982896-78982918 TCCCCAAAGAGGATGGGGAGAGG + Intronic
1130963803 15:88682332-88682354 CACCAAAGGCAGATGGGGAAGGG - Intergenic
1132597435 16:759735-759757 TACCCAAGGGCTCTGGGGAGGGG - Intronic
1132750502 16:1455368-1455390 CGCCCAAGGCAGAAGGGAAGGGG + Intronic
1132812975 16:1810556-1810578 TGACCAGGGCAGATGGGGTGGGG + Intronic
1132865125 16:2089513-2089535 TTCCCAAGGGAGCTGGGGAGGGG + Exonic
1133024530 16:2982216-2982238 AGCCCTAGGCAGCTGGGGAGGGG - Intergenic
1133172263 16:3988535-3988557 TTTCCAGGGCAGGTGGGGAGGGG + Intronic
1134320135 16:13155407-13155429 GTCCCAGGGCAGGTGGGGAGGGG - Intronic
1136653807 16:31696593-31696615 TGCCCCAGGCAGAAGAGGAGGGG + Intergenic
1137403482 16:48172045-48172067 TACCAAGGGCTGGTGGGGAGGGG - Intronic
1137742876 16:50798051-50798073 TACCCAAGGGAGATGGAGGCAGG - Exonic
1138638749 16:58365400-58365422 TCCCCAAGGCAGAAGGGTGGAGG + Intronic
1139250894 16:65494932-65494954 TAAACAGGGCAGATGGGGAATGG - Intergenic
1141012807 16:80418690-80418712 CACCCCGGGCAGATGGGGAGAGG + Intergenic
1141558850 16:84853666-84853688 TTTCCAGGGAAGATGGGGAGGGG - Intronic
1141679960 16:85538112-85538134 GACCCAGGCCAGAAGGGGAGGGG + Intergenic
1143017965 17:3901520-3901542 TACCCAAGTCAGCTGTGGAAGGG - Intronic
1143473737 17:7191705-7191727 TAGCCAAGGCAGGAGAGGAGGGG + Intronic
1143564809 17:7715087-7715109 TCCCCAGGGGAGATGGGGATGGG + Intergenic
1144032716 17:11336590-11336612 TTGCGAAGGCAGATGAGGAGGGG + Intronic
1144588286 17:16502297-16502319 CACTCATGGCAGATGGTGAGAGG + Intergenic
1144787929 17:17842157-17842179 CACCCAGGGGAGAAGGGGAGTGG - Intergenic
1144800762 17:17925077-17925099 TACTCATGGCAGAAGGGGAAGGG - Intronic
1145004178 17:19328238-19328260 CACTCAAAGCACATGGGGAGAGG + Intronic
1145392026 17:22462435-22462457 TTCAGAAGGCACATGGGGAGAGG - Intergenic
1146761660 17:35484101-35484123 TCCCCAAATCACATGGGGAGTGG - Intronic
1146958726 17:36954033-36954055 AAGCCAAGGGGGATGGGGAGGGG - Intronic
1147386881 17:40088231-40088253 TTCGCAAGGCAGCTGTGGAGCGG - Exonic
1147430299 17:40366769-40366791 CACCCATGGCTGATAGGGAGAGG - Intergenic
1147885808 17:43683627-43683649 TGCCCAAGGCAGTTGGGAGGGGG - Intergenic
1148491852 17:48028444-48028466 TAGCCAAGGCAGATGCAGGGGGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1150450591 17:65263840-65263862 TAGCCAAGGCATCTGGGGATGGG + Intergenic
1150476911 17:65482568-65482590 CACCCAAGAGAGATGTGGAGAGG + Intergenic
1150482867 17:65524088-65524110 TGCCCAAGGCAGTGGGAGAGTGG - Intergenic
1151498194 17:74472376-74472398 TGCCCCAGGCAGATGGGCACAGG - Intronic
1152612703 17:81323435-81323457 TTCCCAGGGCAGGTGGGGAGGGG - Intronic
1153223344 18:2880503-2880525 TACCCAAGGCACCTGTGGACGGG + Intronic
1153328447 18:3847285-3847307 TACACAAGGCAGATAGGGAGAGG + Intronic
1157234152 18:45947526-45947548 TATCCAAGGCAGTAAGGGAGAGG + Intronic
1160819696 19:1052305-1052327 GACCCAAGGCGGGTGGGCAGTGG + Intronic
1160899009 19:1417533-1417555 GACCCAAGGTAGGTGGGGAAGGG + Exonic
1161314727 19:3612533-3612555 GAGCTAAGGCACATGGGGAGGGG + Intronic
1161810749 19:6469846-6469868 TCCCCAAAGAAAATGGGGAGTGG + Intronic
1162565166 19:11441934-11441956 CCCCCAAGGCAGAGAGGGAGAGG - Intronic
1162613156 19:11772093-11772115 CAGCCAAGGCAGAGAGGGAGAGG - Intronic
1163500136 19:17671349-17671371 CTCCCAAGGCAGATGGACAGGGG + Intronic
1165621846 19:37254686-37254708 TTCCCAGGGCAGATGCTGAGTGG + Intergenic
1166122043 19:40691952-40691974 GACCCAGGGCAGACGGGGAAGGG + Exonic
1166204798 19:41262735-41262757 TACCCAAAGCAGATCGGAATTGG + Intronic
1166985748 19:46659376-46659398 GACCGAGGGCAGAGGGGGAGAGG + Intronic
1167733958 19:51279911-51279933 TTCACAAGGCTGTTGGGGAGGGG + Intergenic
925598946 2:5588483-5588505 TAACCAAAGCAGATGGAAAGGGG + Intergenic
927430355 2:23022058-23022080 GACCCCAGGGAGTTGGGGAGGGG + Intergenic
928197269 2:29224890-29224912 TGCCCAGGACAGATGGGCAGAGG - Intronic
929248657 2:39729611-39729633 TACCCTTGTCAGAAGGGGAGAGG - Intergenic
929804323 2:45131490-45131512 TAGCCGGGGCAGATAGGGAGAGG + Intergenic
929999001 2:46848386-46848408 TCCCCAAGGCAGAGGAGCAGTGG - Intronic
931075899 2:58711125-58711147 TACCCAAGGGAGAGTAGGAGGGG + Intergenic
931165591 2:59744112-59744134 TGGCCAAGGCAGATGGAGGGAGG + Intergenic
931245590 2:60490028-60490050 CCCCCATTGCAGATGGGGAGTGG - Intronic
933977041 2:87520070-87520092 TAACCAAAGGAAATGGGGAGCGG + Intergenic
935207292 2:100907292-100907314 GGCCCAAAGCAAATGGGGAGGGG - Intronic
936020869 2:108993928-108993950 CTCCCATGGCAGATGGGGTGAGG + Intergenic
936316776 2:111430735-111430757 TAACCAAAGGAAATGGGGAGCGG - Intergenic
937639398 2:124194235-124194257 TAGCCAAGTCATTTGGGGAGGGG - Intronic
937716439 2:125038274-125038296 TAGCTAAGGCACATGGGCAGAGG + Intergenic
937779424 2:125820285-125820307 TACCCAAGGCAGCAGAGGAGGGG + Intergenic
938828053 2:135026247-135026269 TAATCTAGGCAGATGAGGAGAGG - Intronic
940959100 2:159762244-159762266 TCCCCAAGGCAGCTTGGAAGTGG + Intronic
941062857 2:160867788-160867810 TACCAAATGCTGATGGGGATTGG + Intergenic
942290521 2:174465473-174465495 TACTGAAGGCAGATGGAGAAAGG - Intronic
943221362 2:185110981-185111003 TTCCCAAGGCTGAAGGGCAGTGG - Intergenic
943943477 2:194028908-194028930 TAGTGTAGGCAGATGGGGAGGGG + Intergenic
944687021 2:202126479-202126501 TGCCCAAGGAAGATGGCAAGGGG - Intronic
945779579 2:214152815-214152837 CAGCCAAGGCAGAGAGGGAGAGG + Intronic
947239577 2:227979428-227979450 TACCCAAGGCCCATGGAGTGTGG - Intergenic
947702044 2:232242660-232242682 TGCCCAAGGCAGCTGGGTGGGGG - Intronic
948729744 2:239955516-239955538 CACCTTAGGAAGATGGGGAGTGG - Intronic
1168787940 20:556174-556196 TACCCAAGGAAGGTCAGGAGGGG + Intergenic
1168944306 20:1738876-1738898 CACTCAAGGCAGAAGGGGAAGGG - Intergenic
1170772810 20:19348833-19348855 TGACCAGGGCAGATGGAGAGTGG - Intronic
1172077499 20:32310584-32310606 TACCCAAAGCGGAAAGGGAGAGG - Exonic
1173686034 20:44924099-44924121 TCCCCAAGGCAGTTGGGGCTTGG + Intronic
1174205613 20:48836186-48836208 TACCCAAGTCAGATGTTGAGTGG + Intergenic
1175808865 20:61846770-61846792 TAACCAAGGCAGACTTGGAGCGG + Intronic
1177767112 21:25471658-25471680 TTCCCAAGGCAGATGTGCAGTGG + Intergenic
1178006589 21:28227331-28227353 TCCACAAGGGAGTTGGGGAGAGG - Intergenic
1178307001 21:31499205-31499227 CACCCCAGGGAGATGGGGTGAGG - Intronic
1179588304 21:42388186-42388208 TGCTCAAGGCACATGGGAAGTGG - Intronic
1181162865 22:20968042-20968064 TACCGAGTGCAGAGGGGGAGGGG - Intronic
1181622020 22:24097872-24097894 GACACCAGGCAGATGGGGTGGGG + Intronic
1184185336 22:42861119-42861141 TTCACAAGGAAGATGGGGACTGG + Intronic
1184350896 22:43943521-43943543 GACCCCAGGCAGAAGGGGAGGGG - Intronic
1184359632 22:44007226-44007248 TACCCAGGAAAGATGGGGAGGGG + Intronic
1185233682 22:49699039-49699061 AACCCCAGGCAGCTGTGGAGAGG + Intergenic
950098993 3:10345909-10345931 CACCCACGGCAGATGGCGGGTGG + Intronic
950191570 3:10980281-10980303 TGCCCCAGGCTGATGGGGACTGG - Intergenic
950290356 3:11779189-11779211 CACTCATGGCAGATGGGGAAGGG - Intergenic
950573649 3:13817653-13817675 GACCCAAAGCAGATGGGGTGAGG - Exonic
951299521 3:20977006-20977028 CAGCCAAGGGAGATGGGGTGGGG + Intergenic
951681006 3:25294659-25294681 CACCTAAGGCAGAGGGAGAGAGG + Intronic
951727344 3:25774750-25774772 AAGCCAAGGCAGACGGAGAGGGG - Intronic
953043365 3:39274276-39274298 GAGCTAAGGCTGATGGGGAGAGG + Intronic
953570701 3:44069144-44069166 TACCTAAGGCAGACTGTGAGGGG + Intergenic
954262446 3:49449335-49449357 TATCCAAGGCTGATGGGGCCTGG + Intergenic
954848120 3:53577606-53577628 TACCCAAACCACATGGGGAAAGG + Intronic
955156969 3:56426484-56426506 CTGCCAAGGCAGAGGGGGAGTGG - Intronic
955348188 3:58176213-58176235 TCCCCAAGGCAGACTGGAAGGGG + Intergenic
956108491 3:65846730-65846752 TACCCAAGGCAGGTAGGAAATGG + Intronic
956249986 3:67225818-67225840 CTCCCAAGGCAGATGCTGAGAGG + Intergenic
956361167 3:68449343-68449365 TACCAAAGACAAAAGGGGAGAGG + Intronic
958854627 3:99369784-99369806 TCCCCATTTCAGATGGGGAGAGG + Intergenic
960154874 3:114289825-114289847 TTCCCAAGGAAGATGGGGCCGGG + Intronic
961003250 3:123388231-123388253 TAACCAGGGCAGGTTGGGAGGGG + Intronic
961385324 3:126520096-126520118 TTCCCTGGGCAGGTGGGGAGGGG - Intergenic
961631041 3:128298732-128298754 TACCAAAGGCTGGTGGGCAGGGG - Intronic
962008596 3:131371907-131371929 TGCCCAAGTCAGAAGGGAAGCGG - Intergenic
962010633 3:131387249-131387271 TGCCCAAGCCAGAAGGGAAGTGG - Intronic
962421176 3:135230277-135230299 CCTCCAAGGCAGGTGGGGAGGGG - Intronic
962684085 3:137829841-137829863 TACCCATGGCAGAAGGTGACAGG + Intergenic
966689978 3:182732015-182732037 CACTCATGGCAGAAGGGGAGGGG - Intergenic
966971912 3:185052063-185052085 ATCCCGAGGCAGCTGGGGAGAGG + Exonic
967364845 3:188674418-188674440 TACCCAAGGCAGATTGGAGAAGG - Intronic
967546803 3:190739519-190739541 TACTGAAGTCAGATGGGCAGAGG + Intergenic
967952785 3:194853553-194853575 TCCCCAGGGCAGAGGGGGAATGG + Intergenic
968611699 4:1560090-1560112 CACCCAAGACAGATGTGGAGGGG - Intergenic
969063595 4:4459713-4459735 GACGTAAGCCAGATGGGGAGAGG + Intronic
969334400 4:6499074-6499096 TGCCCAAGGCAGATTGGGAGGGG + Intronic
972275890 4:37557531-37557553 TTCATAAGGCAGATGGGGCGAGG + Intronic
973001755 4:44960916-44960938 TCCCCTAGGGAGATGGGGAAAGG - Intergenic
974488595 4:62534962-62534984 TACCCATGGCGGATGGTGAAAGG + Intergenic
975684809 4:76909216-76909238 GACTCAAGGGAGAAGGGGAGGGG - Intergenic
976349095 4:84040281-84040303 GAGACAGGGCAGATGGGGAGGGG - Intergenic
978682460 4:111397948-111397970 TACCCCAGGCAACTGGGAAGAGG + Intergenic
980107294 4:128600089-128600111 GACCCATGTAAGATGGGGAGTGG - Intergenic
980977075 4:139621365-139621387 TTCCCCAGGAAGATGGGGACTGG - Intergenic
985807800 5:2059919-2059941 GAGCCCAGGCAGATGGGGCGAGG + Intergenic
986032609 5:3908512-3908534 TGCCAAAGGGAGCTGGGGAGAGG - Intergenic
986628633 5:9747434-9747456 CACTCAAGGCAGAATGGGAGGGG + Intergenic
986861360 5:11929947-11929969 TACCCAAGGCTAATAGTGAGGGG + Intergenic
987252025 5:16109643-16109665 GACCCAAGGCAGGTGGGGGGAGG + Intronic
989168114 5:38450203-38450225 TACCCAAGGCAAATGGGAGAGGG + Intronic
989168297 5:38451464-38451486 TGCTGAAGGCAGATGGAGAGGGG - Intronic
989288017 5:39725474-39725496 TAGGCAAGGGAGATGGGCAGAGG - Intergenic
989710259 5:44389087-44389109 AACCCAAGGGAGGTGGGGTGGGG + Intronic
990441695 5:55852559-55852581 TGCCTAAGGAAGATGGGGAATGG + Intronic
991017742 5:61949590-61949612 GAGCCAAGCCAGATGGGCAGGGG - Intergenic
991149009 5:63344441-63344463 TATCCCAGGGAGATGGAGAGTGG + Intergenic
991453481 5:66777783-66777805 TAGATAAGGCAGCTGGGGAGAGG + Intronic
993607719 5:90014469-90014491 TCCCCAAGGCCTATGTGGAGGGG + Intergenic
995535398 5:113130752-113130774 TACTCATGGCAGAAGGGGAAGGG - Intronic
995856573 5:116598853-116598875 TATCCAAGCAAGATGGGTAGGGG - Intergenic
996131200 5:119783180-119783202 TAGTCAAGGCACATGGGTAGGGG + Intergenic
996372638 5:122769632-122769654 TACTCAAGGCAGAAGGGTTGAGG - Intergenic
997111112 5:131075688-131075710 TACCCAAGGCTGAAGTGCAGTGG - Intergenic
997895678 5:137714605-137714627 TGCCTAGGGCTGATGGGGAGTGG + Intronic
998539307 5:142965056-142965078 CAGCCAAGGCAGAGAGGGAGAGG + Intronic
999277191 5:150339105-150339127 TCCCCCAGGCAGAGGGAGAGGGG - Intronic
1000889686 5:166787780-166787802 TCCCCAAGGGTGATGTGGAGTGG + Intergenic
1002206818 5:177568657-177568679 CAGCCAAGGCAGAGGGGAAGAGG + Intergenic
1002451630 5:179322267-179322289 GACCCAGCGCAGGTGGGGAGAGG + Intronic
1006824449 6:36924140-36924162 TAGGCAAGGGAGAAGGGGAGGGG - Intronic
1007714162 6:43844844-43844866 AGCCCCAGGCACATGGGGAGGGG + Intergenic
1009392773 6:63164060-63164082 CAGACAAGGCAGATGGGCAGAGG - Intergenic
1010735196 6:79436142-79436164 TTCCCATGGCACGTGGGGAGTGG - Intergenic
1011328303 6:86174932-86174954 CAGCCAAGGCAGAGAGGGAGAGG + Intergenic
1011531907 6:88332147-88332169 TACTCATGGCAGAAGGCGAGGGG + Intergenic
1011765717 6:90617353-90617375 AACCCAAGGCAGGTGGTAAGGGG - Intergenic
1012011167 6:93787828-93787850 TTTCCACGACAGATGGGGAGTGG - Intergenic
1012113331 6:95262561-95262583 TACCCAAGCCAGGAGGGGAGTGG + Intergenic
1013400800 6:109794492-109794514 TGCCCATGGCAGATGGAGAGGGG - Intronic
1016241683 6:141938759-141938781 CACCCAGAGGAGATGGGGAGGGG + Intergenic
1016546758 6:145232683-145232705 CACCCCAGGGACATGGGGAGAGG - Intergenic
1019640039 7:2098466-2098488 GACCCCAGGCAGCAGGGGAGAGG - Intronic
1023814592 7:43939843-43939865 TACCTGAGGCTGATGGGGGGTGG + Intronic
1024702569 7:51920619-51920641 TACCCACAGCTGATGGGGACTGG - Intergenic
1025105076 7:56163881-56163903 TTCCCAAGGCAGCAGGGGAAAGG + Intergenic
1025809473 7:64866288-64866310 TACCCAAGGCAGGTGGTGGTAGG - Intergenic
1025873999 7:65462865-65462887 TACCTAAGGGAGATAGGGAGAGG + Intergenic
1027409572 7:77900997-77901019 TACCCATGGCAGAAGGCAAGCGG + Intronic
1028502913 7:91538866-91538888 AAGCCAAGGCAAATGGGGATGGG - Intergenic
1029307614 7:99631996-99632018 TTCCAAAGGCAGGTGGGGACTGG + Exonic
1029611505 7:101628989-101629011 CACCCAAGGCAGATAAGAAGTGG + Intronic
1032510718 7:132470276-132470298 GATCCAAGCCAGATGGGGTGAGG - Intronic
1033296941 7:140147631-140147653 TAACAAAGGAGGATGGGGAGTGG + Intronic
1035426869 7:158783928-158783950 AACCCACTGCAGCTGGGGAGAGG + Intronic
1035473800 7:159128457-159128479 GGCCCAAGGCAGGAGGGGAGTGG - Intronic
1035781844 8:2233784-2233806 GCCCCGAGGCAGATGTGGAGAGG + Intergenic
1037905554 8:22714095-22714117 TCCCCATGGCAGAGGTGGAGGGG + Intronic
1038024130 8:23573916-23573938 AACCCAAGGCAGGTTGAGAGCGG - Exonic
1038038709 8:23706598-23706620 TCCCGAAGGCGGATGGGGCGGGG + Exonic
1038040304 8:23718550-23718572 GACCCAAGGGAGGTGGGGAAAGG + Intergenic
1038534971 8:28347298-28347320 TACCCGAGGCAGCTGGGCAGTGG + Exonic
1038946297 8:32364295-32364317 TGCCCAAGGAAAAAGGGGAGAGG - Intronic
1039344209 8:36686179-36686201 TACTTTGGGCAGATGGGGAGAGG + Intergenic
1039545327 8:38406181-38406203 AACGCAAGGAAGATGGGGAGAGG - Intronic
1040997070 8:53413086-53413108 AATCCAAGGCAGTTTGGGAGGGG + Intergenic
1043294051 8:78642409-78642431 TACCAAAGGCTGAGGGGCAGGGG - Intergenic
1043520207 8:81036780-81036802 GAGCCAAAGCAGCTGGGGAGTGG - Intronic
1044414385 8:91919637-91919659 TTCACAAGGCAGCAGGGGAGAGG + Intergenic
1044726379 8:95197622-95197644 AGGCAAAGGCAGATGGGGAGGGG - Intergenic
1045483533 8:102612214-102612236 CACCCAAGGCAGAAGGTGACGGG + Intergenic
1045548428 8:103149173-103149195 AGCCCAAGGCAGATGGGGTGGGG - Intronic
1046067507 8:109214098-109214120 CAGCCAAGGCAGAGAGGGAGAGG - Intergenic
1047409828 8:124615260-124615282 ACCCCAAGGCAAATGGAGAGCGG + Intronic
1047620984 8:126607671-126607693 TACCCAAGGAAGATTTAGAGTGG + Intergenic
1047846343 8:128809728-128809750 AACCCAAGGCATAGGGGCAGGGG - Intergenic
1048166612 8:132067218-132067240 TGCCCAAAGCAGAAAGGGAGGGG + Intronic
1048832951 8:138494348-138494370 AACCAAAGTCAGATAGGGAGAGG + Intronic
1048926457 8:139276656-139276678 GACCCAAAGAAGCTGGGGAGAGG + Intergenic
1049223136 8:141436944-141436966 CACCCAGTGCAGATGGGGTGAGG - Intergenic
1049607563 8:143536752-143536774 TTTCCTGGGCAGATGGGGAGGGG - Intronic
1049798621 8:144507628-144507650 TACCCAAGGAAGCAGGGGTGGGG + Intergenic
1050276627 9:4007862-4007884 TACCCATGGCAGGTCGGGCGGGG + Intronic
1051053374 9:12956037-12956059 AAGCCATGGCAGGTGGGGAGGGG - Intergenic
1051246557 9:15117756-15117778 TTCCCAAGGAAAATGAGGAGTGG - Intergenic
1052176114 9:25464619-25464641 TTCACAAGGCAGCAGGGGAGAGG + Intergenic
1052390731 9:27876270-27876292 TATCCAAGAAGGATGGGGAGAGG + Intergenic
1055002293 9:71465619-71465641 TCCCCAGGGCTGATGGGGAATGG + Intergenic
1055453230 9:76449629-76449651 TAGACAAGGGAAATGGGGAGAGG - Intronic
1055789639 9:79910131-79910153 TGCCCAAGGGAGAGGAGGAGGGG + Intergenic
1056061987 9:82892970-82892992 TATCCAAGTCATATGGGGAAGGG + Intergenic
1057259995 9:93577690-93577712 TCCCTAAGGAAGATGGGGAGGGG + Intronic
1057411082 9:94817038-94817060 TACCCAAGGCTGAAGTGCAGTGG + Intronic
1057564529 9:96156164-96156186 TTCTCAAGGCAGGTGAGGAGGGG - Intergenic
1057958553 9:99432945-99432967 CACCCAAAGCAGAAGGGGGGTGG - Intergenic
1058383405 9:104405227-104405249 TATCCAATGCAGATGCAGAGGGG + Intergenic
1059035727 9:110751727-110751749 TACCCAAGGAACTTGGGTAGAGG + Intronic
1059237471 9:112773660-112773682 AACTCAAGGCATATGGGGAAGGG + Intronic
1059934744 9:119298476-119298498 AACACAAGGAAGAAGGGGAGGGG - Intronic
1060265093 9:122107389-122107411 CTCACCAGGCAGATGGGGAGGGG + Intergenic
1060452595 9:123756975-123756997 TAACCAAGGCAGATGGAGAGGGG + Intronic
1060910387 9:127344981-127345003 TAGACAAGGCAGGTGGAGAGAGG + Intronic
1060989971 9:127843030-127843052 GCTCCAAGGCAGATGGGGTGAGG - Intronic
1061281827 9:129602015-129602037 TGCCCAAGAAGGATGGGGAGGGG - Intergenic
1061564634 9:131430082-131430104 TTTCAAAGGCAGATCGGGAGCGG + Exonic
1061709616 9:132478625-132478647 TCTCCAAGGCAGATGGGGCCCGG + Intronic
1061819379 9:133217651-133217673 CACCCAAGGCAGGTGGGCTGGGG - Intergenic
1185913975 X:4014373-4014395 CACACATGGCAGAAGGGGAGGGG - Intergenic
1186520053 X:10197851-10197873 TTGTCAAGACAGATGGGGAGGGG + Intronic
1187200837 X:17132347-17132369 TACTGAAGGCAGAGAGGGAGAGG + Intronic
1187406288 X:19007224-19007246 AACCCGAGCCAGGTGGGGAGAGG - Exonic
1189604445 X:42661433-42661455 TAGCCAAGGCCCATGGGGACAGG - Intergenic
1190968836 X:55329503-55329525 TAGCAAATGCAGGTGGGGAGGGG - Intergenic
1192535396 X:71923041-71923063 TACCTAATGCACATGGGGTGTGG + Intergenic
1195138262 X:101932180-101932202 GACGCAAGGCAGTGGGGGAGGGG - Intergenic
1195214358 X:102683755-102683777 TACTCATGGCAGATGGTGAAGGG + Intergenic
1196402125 X:115327940-115327962 TATTCAAGGCAGAGAGGGAGAGG - Intergenic
1197242733 X:124137134-124137156 CAGCCAAGGCAGAGAGGGAGAGG - Intronic
1197819547 X:130530439-130530461 CACCCAAGGCTGAGGGGGTGGGG - Intergenic
1197819573 X:130530520-130530542 CACCCAAGGCTGAGGGGGTGTGG - Intergenic
1197819640 X:130530762-130530784 CACCCAAGGCTGAGGGGGTGGGG - Intergenic
1197819716 X:130531005-130531027 CACCCAAGGCTGAGGGGGTGTGG - Intergenic
1198159152 X:133989777-133989799 TACCTGAGGGATATGGGGAGAGG - Intergenic
1198227378 X:134657960-134657982 TACCCTGTGCAGTTGGGGAGTGG + Intronic
1199092285 X:143705819-143705841 AAGCCGAGGCAGCTGGGGAGTGG + Intergenic
1200822927 Y:7606418-7606440 TACCCAATGCAGGTGGTCAGAGG + Intergenic
1202237128 Y:22724677-22724699 TACCCAATGCAGGTGGTCAGAGG - Intergenic