ID: 1079459402

View in Genome Browser
Species Human (GRCh38)
Location 11:20667119-20667141
Sequence TGGACTTGGGATCTGGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079459398_1079459402 -9 Left 1079459398 11:20667105-20667127 CCTGAAGGGGAGGGTGGACTTGG No data
Right 1079459402 11:20667119-20667141 TGGACTTGGGATCTGGCATCAGG No data
1079459397_1079459402 -5 Left 1079459397 11:20667101-20667123 CCATCCTGAAGGGGAGGGTGGAC No data
Right 1079459402 11:20667119-20667141 TGGACTTGGGATCTGGCATCAGG No data
1079459387_1079459402 18 Left 1079459387 11:20667078-20667100 CCTGAAGAACCCATGGAGGTAGG No data
Right 1079459402 11:20667119-20667141 TGGACTTGGGATCTGGCATCAGG No data
1079459389_1079459402 9 Left 1079459389 11:20667087-20667109 CCCATGGAGGTAGGCCATCCTGA No data
Right 1079459402 11:20667119-20667141 TGGACTTGGGATCTGGCATCAGG No data
1079459390_1079459402 8 Left 1079459390 11:20667088-20667110 CCATGGAGGTAGGCCATCCTGAA No data
Right 1079459402 11:20667119-20667141 TGGACTTGGGATCTGGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079459402 Original CRISPR TGGACTTGGGATCTGGCATC AGG Intergenic
No off target data available for this crispr