ID: 1079460183

View in Genome Browser
Species Human (GRCh38)
Location 11:20671495-20671517
Sequence CACGGAATGGAACGTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079460179_1079460183 -8 Left 1079460179 11:20671480-20671502 CCAAAGTACCCTTATCACGGAAT 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 34
1079460177_1079460183 6 Left 1079460177 11:20671466-20671488 CCTTTGAAAAGTCGCCAAAGTAC 0: 1
1: 0
2: 4
3: 152
4: 2286
Right 1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 34
1079460176_1079460183 23 Left 1079460176 11:20671449-20671471 CCTTTGTTCTCATTACTCCTTTG 0: 1
1: 0
2: 1
3: 26
4: 388
Right 1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 34
1079460175_1079460183 30 Left 1079460175 11:20671442-20671464 CCTAAATCCTTTGTTCTCATTAC 0: 1
1: 1
2: 17
3: 44
4: 318
Right 1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079460183 Original CRISPR CACGGAATGGAACGTGTTTC AGG Intronic
901014297 1:6219131-6219153 CTCAGAATGGAACGTCTTCCTGG - Intronic
908931264 1:69318403-69318425 GAGGGAATGGAAGGTATTTCAGG + Intergenic
917107963 1:171513929-171513951 CACAAAATGCAATGTGTTTCTGG - Intronic
921544821 1:216462063-216462085 CAAGGAATGGATTTTGTTTCTGG + Intergenic
1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG + Intergenic
1072431592 10:95376980-95377002 CATGGAATAACACGTGTTTCTGG + Intronic
1074362422 10:112834042-112834064 CAGGGAAGGGAACGAGGTTCAGG - Intergenic
1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG + Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089634535 11:119803863-119803885 CAGGGAAGGAAAGGTGTTTCTGG - Intergenic
1092245795 12:6863627-6863649 CACAGAATGGGCCCTGTTTCTGG - Intronic
1112139489 13:96622557-96622579 CAAGGAATAGAAAGGGTTTCAGG + Intronic
1120960941 14:90124306-90124328 CAGGGAATGGAACCTGTCTTGGG - Intronic
1131941248 15:97568253-97568275 CACGAAATGGAAATTGATTCAGG - Intergenic
1135180790 16:20272480-20272502 CAGGGAATGGAACATATTTGAGG + Intergenic
1147556733 17:41484444-41484466 CCAGGAATGGAACGAGTCTCCGG - Intergenic
1150101032 17:62423870-62423892 TACGGAAAGTAAAGTGTTTCCGG + Exonic
1152284845 17:79406415-79406437 CACGGAGTGGAGGGTGTTGCAGG - Intronic
1153285146 18:3449960-3449982 GGCGGAAAGGATCGTGTTTCTGG + Intronic
1160319036 18:77873153-77873175 CTCAGGATGGAACATGTTTCTGG - Intergenic
943540233 2:189204686-189204708 CACAGGATGGAACCTGTTTGTGG - Intergenic
943982193 2:194568465-194568487 CAAGAAATGGAAAGTGTTTCGGG - Intergenic
950509069 3:13414755-13414777 CAAGGCATGGAATGTGTTTTGGG - Intronic
966938818 3:184732204-184732226 CAAGGAATGGGACCTGTTACTGG - Intergenic
966976379 3:185087106-185087128 CAAGGATTGAAACGGGTTTCTGG + Intronic
970081300 4:12289679-12289701 CACAGAATGGAACCTGTTTTTGG - Intergenic
970081323 4:12290022-12290044 CACAGAATGGAACCTGTTTTTGG - Intergenic
977233908 4:94484044-94484066 CACAGAATGTACCTTGTTTCTGG - Intronic
989863910 5:46422155-46422177 CACGGAATTGAACCTTTTTTTGG - Intergenic
997424743 5:133795610-133795632 CACAGAATGGGACGTTTTCCAGG + Intergenic
998418461 5:141962208-141962230 CACACAATGGCACCTGTTTCTGG + Intronic
1000751806 5:165104743-165104765 CAAAAAATGTAACGTGTTTCTGG + Intergenic
1024028788 7:45438004-45438026 CTCGGAATGCACCGTGTTTCTGG - Intergenic
1025585653 7:62782644-62782666 CACAGAATGAAACGTTTCTCTGG + Intergenic
1047757040 8:127926741-127926763 CAGGAAAGGGAACGTGTTGCCGG - Intergenic
1049949997 9:634628-634650 CAAGGAAGGGAATGAGTTTCAGG + Intronic
1051978836 9:22988282-22988304 CACTGATGGGAAAGTGTTTCTGG - Intergenic
1055622595 9:78142161-78142183 CTCGGAAAGGAATGTGTTCCTGG + Intergenic
1062043812 9:134416068-134416090 CAGGGAAGGGGACGTGTCTCGGG + Intronic
1191228851 X:58078075-58078097 CACAGAATGGAACCTGTGTTTGG - Intergenic
1191239732 X:58175699-58175721 CACAGAATGGAACCTGTATTTGG + Intergenic