ID: 1079466006

View in Genome Browser
Species Human (GRCh38)
Location 11:20731642-20731664
Sequence CAGACTTACAATTCACAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079466006 Original CRISPR CAGACTTACAATTCACAAGC CGG Intronic
902576476 1:17381085-17381107 CAGGGTTGCAATTCACAAGCAGG - Exonic
909048877 1:70744961-70744983 CAGACATAGAATTCAGAATCTGG - Intergenic
909645865 1:77916274-77916296 AAGAGATACAATTCACCAGCTGG + Intronic
909827075 1:80139705-80139727 CACACTTAAAATTTACAAGGAGG - Intergenic
910014978 1:82510985-82511007 GAGACTTACAAGTCAATAGCTGG - Intergenic
910230413 1:84981019-84981041 AAGACATACAAATCACAAACAGG + Intronic
910533710 1:88271862-88271884 AAGACTTAGAATTCAAAAGTAGG + Intergenic
910820455 1:91339311-91339333 CAGACCTAGAATTCAGAATCTGG + Intronic
911966533 1:104379092-104379114 CAGACTTACAAAGGAAAAGCAGG + Intergenic
915846831 1:159275421-159275443 CAAGCTTACAAATCACAAGCAGG + Intergenic
916221482 1:162448916-162448938 CAGACTGACACCTCACACGCCGG + Intergenic
917057939 1:171004203-171004225 CAGACTTAGACTTCACAGGCAGG - Intronic
919555504 1:199047151-199047173 CAGACATAGAATTCAGAATCTGG + Intergenic
921524444 1:216200147-216200169 CAAAGTTACATTTCACAAGTTGG + Intronic
923155366 1:231273658-231273680 GAGCCTTACAAATCACAACCTGG - Intronic
924045864 1:240029957-240029979 CAGATTTACAGTACACAAGGTGG + Intronic
924140585 1:241018887-241018909 CAGAATTCCACTTCACAAGCTGG + Intronic
1064110854 10:12537591-12537613 CAGACATACAATTCACAGAATGG - Intronic
1066964249 10:42246866-42246888 CAGACATAGAATTCAGAATCTGG - Intergenic
1068353608 10:55881686-55881708 CAGACATAGAATTCAGAATCTGG + Intergenic
1069191151 10:65492313-65492335 CAGACTTCCAATTCTCATTCTGG - Intergenic
1069336674 10:67359406-67359428 CAGACATAGAATTCAGAATCTGG + Intronic
1071033705 10:81216456-81216478 CAGACTTCCATTTCCCAAGGTGG - Intergenic
1071230281 10:83578742-83578764 CAGACATAGAATTCAGAATCTGG - Intergenic
1072502154 10:96028340-96028362 AAGACATACAATTGACAAACAGG + Intronic
1072780883 10:98250960-98250982 CACACATACAAGTCACACGCTGG + Intronic
1073171265 10:101510775-101510797 CAGACTTACAATTCTCAACAGGG + Intronic
1073176801 10:101561779-101561801 AAGGCTTGCAGTTCACAAGCTGG + Intergenic
1073816469 10:107213479-107213501 CAGACTTAGAATTCAGAATCTGG - Intergenic
1074255472 10:111798126-111798148 CAGACTTTGAGTTCAAAAGCTGG + Intergenic
1074759260 10:116654164-116654186 CAGACATAGAATTCAGAATCTGG - Intergenic
1075203363 10:120424947-120424969 CAGACTTAAAAAGCAAAAGCAGG - Intergenic
1078079002 11:8190575-8190597 CAGACTGAGATTTCAAAAGCTGG - Intergenic
1078694644 11:13619388-13619410 CAGACTTAGAATTCAGAATCTGG - Intergenic
1079466006 11:20731642-20731664 CAGACTTACAATTCACAAGCCGG + Intronic
1079747296 11:24149790-24149812 CAGACATAAAATTCAGAATCTGG - Intergenic
1079865451 11:25728501-25728523 CAGACATAGAATTCAGAATCGGG - Intergenic
1080024653 11:27600747-27600769 ATGACTCACGATTCACAAGCTGG - Intergenic
1083525320 11:63359710-63359732 CAGACATATAATTCAAAATCTGG - Intronic
1085697630 11:78718634-78718656 CAGAAGTACATTTCACATGCAGG - Intronic
1085888254 11:80546158-80546180 CAGACATAGAATTCAGAAACTGG + Intergenic
1086824321 11:91476221-91476243 CAGACATAGAATTCAGAATCTGG + Intergenic
1087107482 11:94424525-94424547 CAGACATACAATTTAGAATCTGG + Intronic
1087817311 11:102673932-102673954 CAGACATAAAATTCAGAATCTGG - Intergenic
1088061031 11:105650784-105650806 TAGACTTTCAAATGACAAGCTGG + Intronic
1093100993 12:15029275-15029297 CAGACATAGAATTCAGAATCTGG - Intergenic
1093579424 12:20769703-20769725 CAGACTGACACTTCACAGCCGGG + Intergenic
1096997884 12:55850581-55850603 CACCCTTACAAATCACAAGCTGG + Intergenic
1097303372 12:58042554-58042576 CAGACATAGAATTCAGAATCTGG - Intergenic
1099106839 12:78507182-78507204 CAGACTGACACCTCACACGCTGG + Intergenic
1099499779 12:83399656-83399678 GAGACTTACATTTCACATTCAGG - Intergenic
1100156528 12:91805624-91805646 CAGACATAGAATTCAGAAGGCGG + Intergenic
1105512032 13:21060185-21060207 GAGACTTGCATTTCACAAACGGG + Intronic
1108669523 13:52670508-52670530 AAGATTTAGAATTCACAAGTCGG + Intronic
1111040312 13:82739753-82739775 CAGACATAGAATTCAGAATCTGG - Intergenic
1112320036 13:98397406-98397428 CAGTCTTACCATTCACACTCTGG + Intronic
1112522987 13:100114646-100114668 AAGACATACAAATCACAAACAGG + Intronic
1114787338 14:25616013-25616035 CAGACATAGAATTCAGAATCTGG - Intergenic
1115911437 14:38260462-38260484 CAGACGTAGAATTCAGAATCTGG + Intergenic
1116580606 14:46636731-46636753 CAGACATAGAATTCAGAATCTGG - Intergenic
1116734575 14:48672036-48672058 CAGACATAGAATTCAGAATCTGG + Intergenic
1118666301 14:68074502-68074524 CAGACGTAGAATTCAGAATCTGG - Intronic
1119531777 14:75366618-75366640 GAGGCTTAAAATACACAAGCCGG - Intergenic
1120163650 14:81171084-81171106 CAGACATAGAATTCAGAATCTGG + Intergenic
1124176073 15:27425282-27425304 CAGGTTTACAATTCACTAGAAGG - Intronic
1125082579 15:35692762-35692784 AAGACATACAATTCAAAAGTTGG - Intergenic
1126874557 15:53026223-53026245 AAGACATACAAATGACAAGCAGG - Intergenic
1127097340 15:55526316-55526338 CAGACATAGAATTCAGAATCTGG - Intergenic
1129301345 15:74627401-74627423 CAAACTCAGAATTCACAAACAGG - Exonic
1129589618 15:76904197-76904219 CAGATTTACCACTCACCAGCTGG + Intronic
1130139697 15:81215095-81215117 CAGACATAGAATTCAGAATCTGG - Intronic
1131314713 15:91324565-91324587 AAGACATACAATTGTCAAGCTGG - Intergenic
1131693600 15:94853465-94853487 CAGACATATAATTCAGAATCTGG - Intergenic
1138357211 16:56391973-56391995 CAGACTGACACTTCACACGGCGG + Intronic
1139382697 16:66543656-66543678 CAGAATTAGAATTCACATCCAGG + Intronic
1140555044 16:75912181-75912203 CAGATTTACAGATCACAAGAAGG + Intergenic
1144832266 17:18138373-18138395 CCGACCTACTATTCACAACCTGG + Intronic
1148517690 17:48236702-48236724 CAGACTTACAAGTAAGAAACAGG + Intronic
1149078875 17:52630368-52630390 CAGACATAGAATTCAGAATCTGG + Intergenic
1149525339 17:57351184-57351206 CAGTCTTGCAAGGCACAAGCAGG + Intronic
1149881400 17:60295653-60295675 CAGACTTACAGATCACAAGAAGG + Intronic
1151432192 17:74071159-74071181 CTGATTTACAATTCATAACCTGG + Intergenic
1153310239 18:3670173-3670195 CACACTTACACTTCAAAAGACGG - Intronic
1155226181 18:23731576-23731598 AAGACATACACTTCACAGGCAGG + Intronic
1155712310 18:28897866-28897888 CTGACTTAGAATTCCAAAGCAGG + Intergenic
1156240701 18:35251295-35251317 AACACTTACAATTCACAATCAGG + Exonic
1157045479 18:44098356-44098378 CAGACATAAAATTCAGAATCTGG - Intergenic
1157637523 18:49174179-49174201 CAGACTTACAATTCCTAGGATGG + Intronic
1158755523 18:60320174-60320196 CAGACATAGAATTCAGAATCTGG - Intergenic
1159415986 18:68150325-68150347 AAGACTTACAAGTCGCAAACAGG + Intergenic
1164085854 19:21901773-21901795 CAGAAATACAGTTCACAAGAGGG + Intergenic
1164388048 19:27793773-27793795 CAGGCGTACAACTAACAAGCTGG - Intergenic
1165351085 19:35276357-35276379 GAAACTTAAAATTCAGAAGCTGG - Intronic
1168122739 19:54261835-54261857 CAGACATAGAATTCAGAATCTGG - Intronic
926496195 2:13592042-13592064 CAGACATAGAATTCAGAATCTGG - Intergenic
926501704 2:13662649-13662671 CAGACATACAATTCAGAATCTGG - Intergenic
927023269 2:19039870-19039892 GAGACTGAATATTCACAAGCTGG - Intergenic
927418636 2:22906274-22906296 CATACTAACAAGGCACAAGCAGG - Intergenic
927622491 2:24676643-24676665 CAGACTAAGAATTCAGAATCTGG + Intronic
929256477 2:39816545-39816567 CAGACATAGAATTCAGAATCTGG - Intergenic
930929253 2:56861077-56861099 CAGACATAGAATTCAGAATCTGG - Intergenic
931062555 2:58547443-58547465 CAGACATACAATCCCCAAACCGG - Intergenic
931501695 2:62875657-62875679 CAGACATAGAATTCAGAATCTGG + Intronic
931549397 2:63425396-63425418 CAGACATAGAATTCAGAATCTGG + Intronic
933642659 2:84780602-84780624 CAGACATAGAATTCAGAACCTGG - Intronic
934315771 2:91918313-91918335 CAGACATAGAATTCAGAATCTGG + Intergenic
936412425 2:112272436-112272458 CAGAGTTTCACTTCACAGGCTGG - Intergenic
939086369 2:137723575-137723597 AAGACTTACAAATGACAAACAGG + Intergenic
939344214 2:140941964-140941986 CAGACATAGAATTCAGAAACTGG + Intronic
939757243 2:146129928-146129950 CAGACATAGAATTCAGAATCTGG - Intergenic
941314433 2:163974923-163974945 CAGAGTTGCATTACACAAGCTGG + Intergenic
941681110 2:168400764-168400786 CAGACATAGAATTCAGAATCTGG - Intergenic
941932004 2:170951182-170951204 CAGACATAAAAATCACAAGCAGG - Intronic
942831891 2:180246556-180246578 CAGACTTATAAATCAGGAGCTGG - Intergenic
942908303 2:181209298-181209320 CAGACATAGAATTCAGAATCTGG + Intergenic
945204014 2:207312460-207312482 TCGAATTACAATACACAAGCAGG + Intergenic
945801197 2:214433367-214433389 CATACTTACAAATCTCTAGCTGG + Intronic
1173314217 20:41929260-41929282 CAGAATCACAATTTACAACCAGG - Intergenic
1177544335 21:22536243-22536265 CAGACATAGAATTCAGAATCTGG + Intergenic
1178436724 21:32566682-32566704 CAGACATAGAATTCAGAATCTGG - Intergenic
1180542540 22:16464185-16464207 CAGACATAGAATTCAGAATCTGG + Intergenic
949284222 3:2382453-2382475 CAGACTAACAAATCACAATAGGG - Intronic
950538186 3:13593999-13594021 CTGAGTTACAGTTGACAAGCTGG + Intronic
957758002 3:84515914-84515936 CAGACACATAATTCACAATCTGG - Intergenic
957878921 3:86184632-86184654 CAGACATAAAATTCAAAATCTGG + Intergenic
960289641 3:115867919-115867941 AAAACTTACAATTCACAAAACGG + Intronic
963148819 3:142022810-142022832 CAGACTTTGAATTAAAAAGCTGG + Intronic
963638954 3:147835815-147835837 CAGACATAGAATTCAGAATCTGG - Intergenic
965115881 3:164487429-164487451 AAGATCTACAGTTCACAAGCTGG - Intergenic
965388858 3:168080189-168080211 CAGACCTGCCATTAACAAGCTGG + Intronic
965423244 3:168488681-168488703 CAGAGTTAGAAATCACAAGCTGG - Intergenic
966342603 3:178942117-178942139 CAGACTGACACTTCACACGGCGG - Intergenic
966512563 3:180780785-180780807 CAGACATAGAATTCAAAATCTGG - Intronic
967561927 3:190926377-190926399 CAGACATAGAATTCAGAATCTGG - Intergenic
970159474 4:13174590-13174612 CAGTCCTACAATTTAAAAGCTGG + Intergenic
971871791 4:32250339-32250361 CATACTTAAAAATCACATGCTGG - Intergenic
973634652 4:52850860-52850882 CAGACATAGAATTCACACCCAGG - Intergenic
974234392 4:59161773-59161795 CAGACATATAATTCAGAATCTGG + Intergenic
974446583 4:61992202-61992224 CTGTCTTACCATTCACAAGCTGG + Intronic
974621540 4:64361878-64361900 CAGACATAGAATTCAGAATCTGG + Intronic
974717503 4:65687876-65687898 CTGTCTCACAATTCATAAGCAGG + Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975745965 4:77474101-77474123 CAGACATTCAATTCACAATATGG + Intergenic
975956881 4:79851712-79851734 CTGCTTTATAATTCACAAGCTGG - Intergenic
975965057 4:79963206-79963228 GAGCCTGAAAATTCACAAGCAGG + Intronic
976789650 4:88863560-88863582 CAGAAGTACAAGTCACAACCTGG + Intronic
976974130 4:91146398-91146420 CAGACATAAAATTCAGAATCAGG - Intronic
977948031 4:102936420-102936442 CAGACATAGAATTCAGAATCTGG + Intronic
978425160 4:108574491-108574513 CAGACTTTCAACTCACAGTCTGG - Intergenic
979758588 4:124372897-124372919 CAGACATAGAATTCAGAATCTGG - Intergenic
979972859 4:127159206-127159228 CAAACTGACAATTCCCAAACAGG + Intergenic
984333290 4:178354919-178354941 CAGAGTCTCATTTCACAAGCTGG + Intergenic
984339439 4:178436725-178436747 CAGCCTTACTATTCCCAGGCAGG + Intergenic
987977421 5:25032718-25032740 CAGACGCAGAATTCAGAAGCTGG - Intergenic
988645584 5:33092204-33092226 CAGACATAGAATTCAGAATCTGG - Intergenic
989779410 5:45246564-45246586 CAGACATAGAATTCAGAATCTGG - Intergenic
993175927 5:84485289-84485311 CAGATTTTCATTTCACAAGTTGG - Intergenic
994060835 5:95475074-95475096 CAGACATAGAATTCAGAATCTGG - Intronic
995795936 5:115941336-115941358 CACACTAACATTTCACAACCAGG + Intergenic
999834408 5:155353444-155353466 CAGACTTAGAATTCAGAATCTGG + Intergenic
1000455288 5:161441319-161441341 AAGACATACAAATCACAAACAGG + Intronic
1001157208 5:169283096-169283118 CAGTTTTACCATTCACCAGCTGG - Intronic
1004972517 6:20927274-20927296 CAGACTATAAATTCACAAGGGGG - Intronic
1008135782 6:47775093-47775115 GAAACTTACTATTCAGAAGCTGG + Intergenic
1008203067 6:48616548-48616570 CAGACTTTCATTTTACATGCAGG + Intergenic
1009032937 6:58081910-58081932 CAGACATAGAATTCAGAATCTGG + Intergenic
1009436199 6:63621087-63621109 CAGAAGTACAAGTCACAACCTGG - Intergenic
1009694811 6:67088580-67088602 CAGACATCCAATTCATAATCTGG - Intergenic
1010328402 6:74592304-74592326 CAGACATACAATTGGCAAACAGG + Intergenic
1011164693 6:84432748-84432770 AAGACCAAGAATTCACAAGCAGG + Intergenic
1011781048 6:90789794-90789816 GAGACTTATAAATCAAAAGCAGG - Intergenic
1012894513 6:104933209-104933231 CAGATTTTCAATTCACAAGTAGG - Intergenic
1013229444 6:108148638-108148660 GAGAGTTATAATTCACAATCAGG + Intronic
1014323458 6:119961735-119961757 TAGCCTTACAATTTGCAAGCAGG - Intergenic
1014841326 6:126224119-126224141 CAGACATAGAATTCAGAACCTGG - Intergenic
1016107874 6:140185250-140185272 CAGAATTAGAATTCAGAATCTGG + Intergenic
1016592147 6:145757740-145757762 CAGCATTACAATTCACACACTGG - Intergenic
1017352419 6:153458423-153458445 CAGACATAGAATTCAGAATCTGG - Intergenic
1017368943 6:153681739-153681761 CAGACATAAAATTCAGAATCCGG + Intergenic
1018298380 6:162374094-162374116 CAGACTTAAAATACGCAAGGAGG + Intronic
1020452612 7:8337169-8337191 CAGAGTTACAATTTCCATGCTGG + Intergenic
1022373748 7:29793933-29793955 CAGACTTTCCATTCACAAGTGGG + Intergenic
1023785563 7:43704777-43704799 CAGACATAGAATTCAGAATCTGG - Intronic
1025283031 7:57641972-57641994 CACACCTGCAGTTCACAAGCTGG + Intergenic
1027554526 7:79647440-79647462 CATACTTAAAATTCAGAATCTGG - Intergenic
1030459264 7:109810079-109810101 CAGAATTTCAATTAAAAAGCTGG - Intergenic
1032512657 7:132484278-132484300 CAGTCTTAGAATTCCCAGGCTGG + Intronic
1033869443 7:145732700-145732722 CAGAGTTGAATTTCACAAGCTGG + Intergenic
1037321252 8:17645530-17645552 CAGACTGAAAACTCACAAGAAGG + Exonic
1039672199 8:39613643-39613665 CATACTTAGAATTCAGAATCTGG + Intronic
1040811875 8:51462322-51462344 CAGACATAAAATTCAGAATCTGG + Intronic
1041906994 8:63044185-63044207 GAGACATAGAATTCACAATCTGG + Intergenic
1042321313 8:67478436-67478458 CAGAAGTACAGGTCACAAGCTGG + Intronic
1043731061 8:83682558-83682580 CTGACTTACCATTCATAAACAGG - Intergenic
1043761491 8:84074820-84074842 CAGACATAGAATTCAGAATCTGG - Intergenic
1043913949 8:85898408-85898430 TAGACTTAAAATTGACACGCAGG + Intergenic
1044026817 8:87183506-87183528 CAGACATAGAATTCAGAATCTGG - Intronic
1044169256 8:89028037-89028059 CAGACATACAATTCAGAATCTGG + Intergenic
1044185993 8:89253109-89253131 CAGACATAGAATTCAGAATCTGG - Intergenic
1046180897 8:110646101-110646123 CAGACATAGAATTCAGAACCTGG + Intergenic
1046335118 8:112775581-112775603 CAGACTTTCTAGTTACAAGCAGG + Intronic
1048037530 8:130691993-130692015 CAGACCTAGAATTCAGAATCTGG - Intergenic
1048841197 8:138568147-138568169 CTGACTTACAATTCAAACTCTGG + Intergenic
1050464353 9:5905679-5905701 GAGACTTACAAGTCACAGGTGGG - Intronic
1050839870 9:10134899-10134921 CAGACATATAATTCAGAATCTGG + Intronic
1050917542 9:11157256-11157278 CAGACATAGAATTCAAAATCTGG - Intergenic
1057421955 9:94919943-94919965 CAGACTTACATTTATCAAGCTGG - Intronic
1057619449 9:96621635-96621657 CAGACTTCCTATTCACAAGAAGG - Intergenic
1058201357 9:102045962-102045984 CAGACTTAGAATTCAGAAACTGG - Intergenic
1059778974 9:117507116-117507138 CAGACATAAAATTCAGAATCTGG - Intergenic
1061366853 9:130176696-130176718 CAGCTTCACAATTCACAAGTGGG - Intronic
1062418222 9:136464673-136464695 CAGACTTCCAACTCAAAAGTCGG + Intronic
1187412728 X:19064768-19064790 CAGAGTTACAATTCAAATTCAGG - Intronic
1188149733 X:26657035-26657057 CAGACATAGAATTCAGAACCTGG - Intergenic
1188371743 X:29378345-29378367 CAGACATAAAATTCAGAACCTGG - Intronic
1188845515 X:35067143-35067165 AAGACCTACAAATGACAAGCTGG - Intergenic
1188943254 X:36265678-36265700 CAGACATAGAATTCAAAATCTGG - Intronic
1189653246 X:43212231-43212253 CAGACATAGAATTCAGAATCTGG + Intergenic
1190238239 X:48633828-48633850 AAGACCTACAAATGACAAGCAGG - Intergenic
1191586923 X:62837784-62837806 CAGACATAGAATTCAGAATCTGG - Intergenic
1192756434 X:74050693-74050715 CAGACATAAAATTCAGAATCTGG + Intergenic
1193055170 X:77142433-77142455 AAGACTTACAAATGACAAACAGG - Intergenic
1193489840 X:82135238-82135260 AAGAATTACAATTCATAGGCCGG + Intergenic
1193550004 X:82879897-82879919 CAGACATACAATTAAGAATCTGG + Intergenic
1193575518 X:83191133-83191155 CAGACATAGAATTCAGAATCTGG - Intergenic
1193979793 X:88168363-88168385 CAGACCTAGAATTCAGAATCTGG - Intergenic
1194210900 X:91067278-91067300 CAGACATAGAATTCAAAATCTGG + Intergenic
1194338211 X:92676132-92676154 AAGACATACAAATCACAAGCAGG - Intergenic
1195679013 X:107529873-107529895 CAGACTTCCATTTCACAGGCGGG - Intronic
1196282416 X:113837638-113837660 AAGATTTGCAATTGACAAGCTGG - Intergenic
1196515373 X:116605194-116605216 CAGATTTATAATTCAGAATCTGG - Intergenic
1197172032 X:123444958-123444980 GAGAGTTCCAATTCTCAAGCAGG + Intronic
1197177233 X:123499346-123499368 CAGACATAGAATTCAGAATCTGG - Intergenic
1197308101 X:124868846-124868868 CAGACATACAAATGGCAAGCAGG + Intronic
1198577654 X:138027348-138027370 CAGACATAGAATTCAGAATCTGG + Intergenic
1198609736 X:138384180-138384202 CAGACATAGAATTCAGAATCTGG + Intergenic
1198958531 X:142158694-142158716 CAGACATAGAATTCAGAATCTGG - Intergenic
1200646613 Y:5792910-5792932 AAGACATACAAATCACAAGCAGG - Intergenic
1201612700 Y:15860977-15860999 CAGACTTAGTATCTACAAGCTGG - Intergenic
1202333331 Y:23778387-23778409 CAGACTGACACTTCACATGGTGG - Intergenic
1202537438 Y:25891676-25891698 CAGACTGACACTTCACATGGTGG + Intergenic