ID: 1079471522

View in Genome Browser
Species Human (GRCh38)
Location 11:20782657-20782679
Sequence TTATTTCTCCAGGACTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079471522_1079471529 24 Left 1079471522 11:20782657-20782679 CCCATGTAGTCCTGGAGAAATAA 0: 1
1: 0
2: 0
3: 20
4: 131
Right 1079471529 11:20782704-20782726 GGAGATGGTCAGGATGTGAGAGG 0: 1
1: 0
2: 3
3: 33
4: 391
1079471522_1079471526 3 Left 1079471522 11:20782657-20782679 CCCATGTAGTCCTGGAGAAATAA 0: 1
1: 0
2: 0
3: 20
4: 131
Right 1079471526 11:20782683-20782705 TGTAGTTATCTTGCAGTCAGAGG 0: 1
1: 1
2: 0
3: 10
4: 131
1079471522_1079471527 9 Left 1079471522 11:20782657-20782679 CCCATGTAGTCCTGGAGAAATAA 0: 1
1: 0
2: 0
3: 20
4: 131
Right 1079471527 11:20782689-20782711 TATCTTGCAGTCAGAGGAGATGG 0: 1
1: 0
2: 2
3: 21
4: 522
1079471522_1079471528 14 Left 1079471522 11:20782657-20782679 CCCATGTAGTCCTGGAGAAATAA 0: 1
1: 0
2: 0
3: 20
4: 131
Right 1079471528 11:20782694-20782716 TGCAGTCAGAGGAGATGGTCAGG 0: 1
1: 0
2: 1
3: 28
4: 272
1079471522_1079471530 27 Left 1079471522 11:20782657-20782679 CCCATGTAGTCCTGGAGAAATAA 0: 1
1: 0
2: 0
3: 20
4: 131
Right 1079471530 11:20782707-20782729 GATGGTCAGGATGTGAGAGGAGG 0: 1
1: 0
2: 2
3: 30
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079471522 Original CRISPR TTATTTCTCCAGGACTACAT GGG (reversed) Intronic
901225541 1:7611017-7611039 TGATTTGTCCAGGACTGCACAGG - Intronic
903900896 1:26644492-26644514 TAATTTCTCAAGGTCTGCATGGG - Intergenic
907307494 1:53521453-53521475 TTATTTGTCCAGCATTACACAGG - Intronic
907909536 1:58814514-58814536 TAAGTCCTCCAGGACTACATTGG + Intergenic
909226131 1:73025402-73025424 TTATGGTTCCATGACTACATGGG + Intergenic
909294100 1:73923889-73923911 TTATTTTTCCTGGAGTTCATAGG + Intergenic
909784385 1:79592809-79592831 TTATTTCTCCAGCTCTATATTGG + Intergenic
910723149 1:90309783-90309805 TGATTCCTTTAGGACTACATTGG + Intergenic
918044173 1:180931408-180931430 ATATGTCTCCAGGACTGCAGCGG + Intronic
921511249 1:216033504-216033526 TTATTTCTACAACACTACATTGG - Intronic
923429535 1:233906439-233906461 TTATGTCACCAGGACTAATTTGG + Intronic
924401728 1:243690519-243690541 ACATTTCTACAGCACTACATTGG + Intronic
924471071 1:244343050-244343072 TTTTTTTTCCAGCACCACATAGG - Intergenic
1063001055 10:1923464-1923486 TTATTTCTCAATGAATGCATAGG + Intergenic
1063310932 10:4951075-4951097 TAATAACTCCAGGACTTCATGGG - Intronic
1063757475 10:9030435-9030457 AAATTTCTGAAGGACTACATGGG - Intergenic
1063888203 10:10601156-10601178 TTCATTCTCCAGGACTGAATGGG + Intergenic
1069507651 10:69015529-69015551 TTTTTCCTTCAGGACAACATAGG + Exonic
1069596220 10:69672868-69672890 CTCTTTCTCCAGGCATACATTGG - Intergenic
1071129717 10:82376655-82376677 ATATTTCCCCATGGCTACATGGG + Intronic
1072281513 10:93869939-93869961 TAATTTCTCTAAGACTACATGGG - Intergenic
1077996464 11:7456687-7456709 TTATTTTTTCAGAACTCCATTGG + Intronic
1079471522 11:20782657-20782679 TTATTTCTCCAGGACTACATGGG - Intronic
1079961434 11:26928863-26928885 TTATTTCTCCAGGAATTTAATGG + Intergenic
1081953576 11:47068865-47068887 TTTTTAATCCAGGACTATATTGG - Intronic
1086180758 11:83948600-83948622 TTTTTTTTCCAGTACTACATAGG - Intronic
1086257939 11:84902157-84902179 TTGTTTCTCCAGCACTCCATGGG + Intronic
1089710463 11:120310905-120310927 TCATTTCTCCAGGAGAACTTAGG + Intronic
1093141096 12:15511303-15511325 TTATTTCTCCTGGACCTCCTTGG - Intronic
1093567937 12:20630728-20630750 TTATTTCTTCGTGACAACATTGG - Intronic
1095372839 12:41490271-41490293 AGTTTTCTCCAGGTCTACATTGG + Intronic
1095502384 12:42854660-42854682 TGATTTGTCCTGGACTACAAAGG + Intergenic
1097322955 12:58245990-58246012 TTATGTCTTCAGGACTAGGTGGG - Intergenic
1098626160 12:72672132-72672154 TCATTTATACAGGACTACAGGGG - Intergenic
1102212861 12:111139496-111139518 TTATTTTTCCAGCACTGCGTTGG + Intronic
1102213079 12:111141114-111141136 TTATTTTTCCGGCACTGCATTGG - Intronic
1105049537 12:133036545-133036567 ATGATTCTCCAGGACAACATGGG - Intergenic
1105318634 13:19293819-19293841 TTATTTCTCCAAGACACCAATGG + Intergenic
1106443079 13:29797471-29797493 TTCTTTCTCCAGCACTATCTTGG - Intronic
1106760222 13:32860428-32860450 CTATTTCTCCAGGACTGCTCTGG + Intergenic
1106962203 13:35012047-35012069 TTATTTTTCCAGTATGACATGGG - Intronic
1112028467 13:95435013-95435035 TTATTTATCTAAGAATACATGGG + Intronic
1113757324 13:112822232-112822254 TTATTTCTCCCTTACTACTTAGG + Intronic
1117584631 14:57187714-57187736 TTAATTCATAAGGACTACATAGG - Intergenic
1120646975 14:87085923-87085945 TTTTTTGTACAGGACTAGATAGG + Intergenic
1123962340 15:25417288-25417310 TTATCCCTTCAGGGCTACATTGG - Intronic
1127714473 15:61635802-61635824 TTATTTATTCAGGATGACATAGG + Intergenic
1129935189 15:79441657-79441679 ATACTTCTCCAGGAATACATGGG + Intronic
1133364463 16:5199788-5199810 TTAATTCTCAAGGAGTCCATAGG + Intergenic
1133594128 16:7273803-7273825 TTATTTTTCCAGGGCTGGATTGG + Intronic
1135548795 16:23382779-23382801 TTATTAAACAAGGACTACATTGG + Intergenic
1138095498 16:54208059-54208081 CTATTTCTCCAGGACTACCCAGG - Intergenic
1139167738 16:64589240-64589262 TTATTTCTGCTGCCCTACATGGG + Intergenic
1139713841 16:68796964-68796986 TTATGTTTACAGGACTAGATGGG - Intronic
1143730471 17:8879858-8879880 TCATTTCTCCAGCACTAAAATGG - Exonic
1144359665 17:14479901-14479923 TTGTTCCTCCAGGACAACAGAGG - Intergenic
1145326012 17:21826112-21826134 TTATTTCACAAGGAGAACATGGG - Intergenic
1147199373 17:38789724-38789746 TCATTTCTCCATGAGTAAATTGG - Intronic
1148972668 17:51498082-51498104 TTATTTCACCAAAAATACATTGG + Intergenic
1154224486 18:12490040-12490062 TTTTTTCTACAGAACTACATTGG - Intronic
1156931955 18:42655724-42655746 TGTTTTCTCCAGGGCTAAATGGG + Intergenic
1158240500 18:55371916-55371938 TTATTTCTCCATTAATCCATTGG - Intronic
1160338664 18:78067340-78067362 TTATTTAACCAGCATTACATGGG - Intergenic
1166983300 19:46644708-46644730 TTGTTTGTCTAGGGCTACATAGG - Intergenic
927372655 2:22374876-22374898 ACATTTCAGCAGGACTACATAGG - Intergenic
929295377 2:40240489-40240511 TTATTTCTCTAATACTACAGTGG - Intronic
931095528 2:58936291-58936313 TTATTTGTCTAGTACTACAAAGG + Intergenic
939112010 2:138019598-138019620 TTATTTCTCCAGGACTGATTGGG + Intergenic
940197954 2:151116741-151116763 TTTTTCCTACAGGACTACATAGG - Intergenic
943851786 2:192732723-192732745 TAATTTCACCAGGAATATATGGG - Intergenic
1172158069 20:32843391-32843413 AAATTTCTCCAGGACGACTTAGG - Intronic
1173469350 20:43310604-43310626 TTTTTTCTCCAGGATTACACAGG - Intergenic
1175657959 20:60788363-60788385 TTATACCTCCAGGAGTATATGGG - Intergenic
1178340647 21:31783357-31783379 TAATTTTTCCAAGACTACAGTGG - Intergenic
1181297775 22:21854889-21854911 TTATTACTGCAGGGCTATATAGG - Intronic
951371296 3:21852640-21852662 ATATTTCTACAGTACTACTTAGG + Intronic
951417692 3:22445126-22445148 TTAATTCTGCATTACTACATTGG - Intergenic
952231668 3:31437273-31437295 GAATTTCTCTAAGACTACATGGG - Intergenic
955835921 3:63055093-63055115 ATATTTCTCCAGCAATTCATTGG + Intergenic
956042223 3:65156469-65156491 TCATTTCTGCAGGACTCTATTGG + Intergenic
956748095 3:72325387-72325409 TTAATTCTCCAAGCCTACAAGGG + Intergenic
957677580 3:83389967-83389989 TTGTTTCTCCAGGACTAGCGGGG - Intergenic
958803680 3:98784207-98784229 TCATTTCTCCAGGCCTGCCTGGG + Intronic
963540971 3:146587814-146587836 TTATTTCTCCAGGATTTCAGAGG - Intronic
964535171 3:157713541-157713563 TCTTTTCTCCAGGTGTACATTGG + Intergenic
964846550 3:161050146-161050168 TTCTTTCTCTGGAACTACATTGG + Intronic
965023532 3:163267108-163267130 ATACTTCTCCAGGATTACATAGG + Intergenic
965937819 3:174136685-174136707 TTATGTCTGCAGGCCTACCTGGG - Intronic
971873576 4:32275278-32275300 TTTTTCTTCCAGGACTACTTTGG + Intergenic
972160973 4:36227159-36227181 TAATTTCTCCAAGATCACATGGG - Intronic
973694203 4:53474054-53474076 TCATTCCTATAGGACTACATAGG - Intronic
974632940 4:64518304-64518326 TTATTTTTCCAGGAGCACTTTGG - Intergenic
976249363 4:83034662-83034684 TCATTACTCCAGGACGACAGAGG + Intronic
978000289 4:103548895-103548917 TCATTTCTCCAGGCCTACCCAGG + Intergenic
978511836 4:109528775-109528797 CTCTTTCTCTAGGACTACATGGG - Intronic
983817054 4:172144083-172144105 TTATTTCTCCATGACTTCAGGGG + Intronic
984203806 4:176761708-176761730 TTATTTTTCCAAGGTTACATAGG - Intronic
985914998 5:2910836-2910858 TTCTTTGTCCAGTACTACAAAGG - Intergenic
986930246 5:12809927-12809949 TTTGGACTCCAGGACTACATAGG - Intergenic
990857392 5:60284603-60284625 ATATTTCTCCAGGACAACTAAGG + Intronic
992006977 5:72487762-72487784 ATATTTGTCCACTACTACATAGG - Intronic
993394911 5:87373896-87373918 TTATTTCTCCAGGAATATACTGG + Intronic
993931031 5:93939656-93939678 TTATTTCTGCAGTAATACAGTGG - Intronic
994649953 5:102514356-102514378 TTCTTTCTCCATAACTTCATGGG - Intergenic
995510554 5:112905210-112905232 TTCTCTCACCATGACTACATGGG - Intronic
996695645 5:126392009-126392031 TAATTTTTCCATGACTAAATTGG + Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1006902094 6:37509521-37509543 TCTTTACTCCAGGACTATATAGG - Intergenic
1009829810 6:68915608-68915630 TTAGTTCTCCAAAACTACAAAGG - Intronic
1009884448 6:69608226-69608248 TTATTTTGCCAGGCCAACATAGG + Intergenic
1011191289 6:84731060-84731082 TTATTTCTCCAAGACTATCCAGG + Intronic
1012458333 6:99431245-99431267 TAATTTCTGCATGACTTCATAGG + Intergenic
1014601104 6:123413586-123413608 TGAATTCTCCAGGAATAAATAGG + Intronic
1017034339 6:150253438-150253460 ATAATTCTCCAGGACTATTTGGG - Intergenic
1018478574 6:164167758-164167780 ATACTTCTCCAGCACTGCATGGG + Intergenic
1022214275 7:28242937-28242959 TTAGTGCTCCAGCACTATATGGG - Intergenic
1023357155 7:39378674-39378696 ATATTTATCCAAGGCTACATTGG + Intronic
1024042676 7:45567392-45567414 TTCATTTTCCAGGACTCCATTGG - Intergenic
1024396270 7:48871449-48871471 TTATTTCTTAAGGACTGTATTGG - Intergenic
1025554760 7:62292491-62292513 TTATTTCACAAGGAGAACATGGG + Intergenic
1025560021 7:62360785-62360807 TTATTTCACAAGGAGAACATGGG - Intergenic
1031014279 7:116556169-116556191 TTATTTTTCAATGAATACATAGG - Intronic
1032120534 7:129152335-129152357 TTGTTTCTCCATGCCTCCATTGG - Intronic
1032618969 7:133508114-133508136 TTTTTTATCCATGACTACAAAGG + Intronic
1038119592 8:24597983-24598005 TTATTTGCCCAGGACTGAATGGG + Intergenic
1039101956 8:33950845-33950867 TGATTTCTTCAGGAGTACATAGG + Intergenic
1040079987 8:43275784-43275806 GCAGTTCTCCAGGACGACATGGG - Intergenic
1040587152 8:48755106-48755128 GTATTTCCCCAGGACCAAATTGG + Intergenic
1043008431 8:74850316-74850338 TTATTTCTCTTAGACTTCATTGG - Exonic
1045005929 8:97916771-97916793 TTTTTCCTCCAGGACTAAACTGG + Intronic
1045256515 8:100528755-100528777 TTGTTTCTGCAGGACAAAATGGG - Intronic
1046302968 8:112322354-112322376 TTATTTTTCCAAGACAACATGGG + Intronic
1047423442 8:124726335-124726357 TGATCACTCCAGGACTACAGTGG + Intronic
1050946499 9:11527103-11527125 TTATATCTCCAGATCTACATGGG - Intergenic
1051233739 9:14978048-14978070 TTATTTCTCCAGGAGGGGATGGG + Intergenic
1051915938 9:22207718-22207740 TTATTTCTCCAGGAAGAGAGAGG + Intergenic
1052635231 9:31094507-31094529 TTCTTTCCCCAGGACTTCAGTGG - Intergenic
1057114730 9:92509831-92509853 AAATTTCTACAGGACTATATAGG + Intronic
1057960379 9:99450222-99450244 TTATTTTTAAAAGACTACATTGG - Intergenic
1059184323 9:112253519-112253541 TCATTTCTGAAGGACTAAATAGG + Intronic
1187006476 X:15237940-15237962 TTAATTCTCCAAGACTAAAGGGG + Intronic
1187406853 X:19012276-19012298 TTGTTGCCCCAGGAATACATAGG + Intronic
1188616075 X:32160619-32160641 TTATTTGTCCTGGACAACAAAGG - Intronic
1191818383 X:65274421-65274443 TTATTACTCCAAGCCCACATGGG + Intergenic
1193609197 X:83608374-83608396 TTATTTCTCTTGGACCACCTAGG + Intergenic
1196657793 X:118237903-118237925 TGAGTTCTCTAGGCCTACATGGG - Intergenic
1197272547 X:124441299-124441321 ATATTTCTTCAGGAGTACAGAGG - Intronic
1202160462 Y:21929433-21929455 TCATTTCTCCAGGAAGAGATTGG + Intergenic
1202198225 Y:22318833-22318855 TCATTTCTCCAGGAAGAGATTGG - Intronic
1202230894 Y:22656942-22656964 TCATTTCTCCAGGAAGAGATTGG - Intergenic
1202312264 Y:23539223-23539245 TCATTTCTCCAGGAAGAGATTGG + Intergenic
1202558539 Y:26131371-26131393 TCATTTCTCCAGGAAGAGATTGG - Intergenic