ID: 1079473998

View in Genome Browser
Species Human (GRCh38)
Location 11:20808797-20808819
Sequence AGAGGGAGTACAATGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079473998_1079474005 21 Left 1079473998 11:20808797-20808819 CCCACAATCATTGTACTCCCTCT 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1079474005 11:20808841-20808863 TTTGCTATGTGGCTGCTGCTGGG 0: 1
1: 0
2: 6
3: 50
4: 306
1079473998_1079474007 23 Left 1079473998 11:20808797-20808819 CCCACAATCATTGTACTCCCTCT 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1079474007 11:20808843-20808865 TGCTATGTGGCTGCTGCTGGGGG 0: 1
1: 1
2: 14
3: 68
4: 400
1079473998_1079474006 22 Left 1079473998 11:20808797-20808819 CCCACAATCATTGTACTCCCTCT 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1079474006 11:20808842-20808864 TTGCTATGTGGCTGCTGCTGGGG 0: 1
1: 1
2: 5
3: 52
4: 364
1079473998_1079474004 20 Left 1079473998 11:20808797-20808819 CCCACAATCATTGTACTCCCTCT 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1079474004 11:20808840-20808862 TTTTGCTATGTGGCTGCTGCTGG 0: 1
1: 0
2: 2
3: 40
4: 822
1079473998_1079474009 30 Left 1079473998 11:20808797-20808819 CCCACAATCATTGTACTCCCTCT 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1079474009 11:20808850-20808872 TGGCTGCTGCTGGGGGCTGAGGG 0: 1
1: 3
2: 24
3: 112
4: 830
1079473998_1079474008 29 Left 1079473998 11:20808797-20808819 CCCACAATCATTGTACTCCCTCT 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1079474008 11:20808849-20808871 GTGGCTGCTGCTGGGGGCTGAGG 0: 1
1: 5
2: 34
3: 185
4: 1266
1079473998_1079474003 10 Left 1079473998 11:20808797-20808819 CCCACAATCATTGTACTCCCTCT 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1079474003 11:20808830-20808852 CACAGATTCTTTTTGCTATGTGG 0: 1
1: 1
2: 1
3: 32
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079473998 Original CRISPR AGAGGGAGTACAATGATTGT GGG (reversed) Intronic
901223521 1:7597588-7597610 AGAGAGAGGAGCATGATTGTGGG + Intronic
904119802 1:28190372-28190394 AGAGGGGGTGGAATGAGTGTGGG + Intronic
904481211 1:30794668-30794690 AATGGTAGTACACTGATTGTGGG + Intergenic
906476193 1:46171223-46171245 AGAGGGAGTAGACTGAGTGTTGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908979342 1:69935152-69935174 GCAGGGAGTACAATGGTTATTGG + Intronic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911241650 1:95474363-95474385 CCAGGGAGTACAAAGACTGTTGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921982847 1:221276814-221276836 AGTGTGAGTCCCATGATTGTAGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066160945 10:32727406-32727428 AAAGGAAGCACAATCATTGTTGG - Intronic
1071956150 10:90761813-90761835 AGAGAGAGTAGCATGGTTGTTGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1073732473 10:106306268-106306290 AGAGGAAGTAGAATGTTTGCTGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075154909 10:119967276-119967298 AGAAGGAGTTTAATGATTGCAGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1082987027 11:59177936-59177958 AGAGTGAGTACCATGAGAGTGGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1085217539 11:74845448-74845470 AGAGGGAATACAGTGGTTTTGGG + Intronic
1085549008 11:77349449-77349471 AGAGGTAGTACAGAGAATGTAGG + Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1088803960 11:113333798-113333820 AAAGAGAGAACAATAATTGTTGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1092184676 12:6470282-6470304 GGAGAGGGTGCAATGATTGTGGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1094078844 12:26510277-26510299 AGAAGGAGTAAAAGGATGGTGGG - Intronic
1094483116 12:30900802-30900824 AGAGGGAGGATAATAAATGTTGG + Intergenic
1095839070 12:46672145-46672167 CAAGGGAGTAAAATGATTCTTGG - Intergenic
1098331448 12:69357917-69357939 AGAGGGAAAGCAATGTTTGTTGG + Intergenic
1099452333 12:82822531-82822553 AGAGGGTTTACAAAGATTGAGGG + Intronic
1106800656 13:33253140-33253162 AGCAGGACTACAATGATGGTAGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108961281 13:56234293-56234315 AGAGGAAGGACAGTGATTGAAGG + Intergenic
1109272078 13:60266834-60266856 AAATGGAGCACAAGGATTGTTGG + Intergenic
1109708775 13:66136099-66136121 AGAGGGACACCAATGATTCTGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110089951 13:71432996-71433018 AGAGGTAATAAGATGATTGTTGG + Intergenic
1110708502 13:78623768-78623790 AGAGGAAATACAAAAATTGTAGG + Intronic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111240808 13:85472365-85472387 AGAGGCAATACAATTACTGTTGG + Intergenic
1114542197 14:23469441-23469463 AGACTGAGTAAAATGATTGACGG - Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116951781 14:50884874-50884896 AAATGAAATACAATGATTGTTGG - Intronic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119269480 14:73289430-73289452 AGAGATGGTACAATAATTGTTGG + Intronic
1119636564 14:76278112-76278134 AGAGGGAAGGAAATGATTGTAGG + Intergenic
1119648559 14:76366911-76366933 ACAGTGAGTACAGTGATTGATGG - Intronic
1120694321 14:87627533-87627555 AGCAGGAGTCCAATGATTGGTGG - Intergenic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1128712115 15:69879737-69879759 TGAGGGAGGACAATGTTTGTTGG - Intergenic
1130395879 15:83500821-83500843 AGAAAGAGTCCAAGGATTGTGGG - Intronic
1131767213 15:95691252-95691274 AAAGGGAGAACAATGAATGATGG + Intergenic
1131830033 15:96348186-96348208 AGAGGGTTTGGAATGATTGTAGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1136241527 16:28947570-28947592 AGAGAGAGTTTAATGATTGCAGG + Intergenic
1137063440 16:35812405-35812427 TGTGGAAGTACAATGGTTGTAGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139520341 16:67479192-67479214 ATCGGCAGTACAATAATTGTAGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150355852 17:64484039-64484061 AGAGGCATTAAAATGTTTGTTGG - Intronic
1150993504 17:70288510-70288532 AGATGGAAAACAAAGATTGTTGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1159607256 18:70487794-70487816 AAAGGCAGTACAATGACTCTGGG - Intergenic
1159794300 18:72822970-72822992 AGTGGGAGTACAAGGAGTTTGGG + Intronic
1165351270 19:35277298-35277320 AGAGGGAGCACAAGGATGGAAGG + Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926445667 2:12938861-12938883 AGAGGGAGGACAATGCCTGTTGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
928877282 2:36054677-36054699 AGAGGGAGTAAAATAATTCCAGG + Intergenic
929362615 2:41112354-41112376 AAAGGGAATACACTGTTTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930869372 2:56154425-56154447 AGAGGAAGTACAATATTTGGGGG + Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931462392 2:62460472-62460494 AAAGGGAGTAAAAGGTTTGTGGG - Intergenic
932025269 2:68125836-68125858 AGCGGGAGTACAAAGATTCTAGG - Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934039809 2:88118414-88118436 AGAGTAAGTACAGTGATTGGTGG - Intergenic
934330840 2:92066520-92066542 AGAGATGGTACAATGATGGTTGG - Intergenic
935549206 2:104433990-104434012 TGAGGGAGTATAGTAATTGTTGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942653323 2:178191225-178191247 AGTGAGAGTACAAAGATGGTTGG + Intergenic
942721824 2:178961745-178961767 ACAGGGAGTAGAATGAGCGTGGG + Intronic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943881247 2:193147320-193147342 ACAGAGAGTAGAATGATAGTTGG + Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
947353893 2:229272570-229272592 AGAGAGAACACAATGTTTGTGGG + Intergenic
948087577 2:235264418-235264440 AGAGGAAGGAAAATTATTGTAGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG + Intergenic
1173639856 20:44593588-44593610 AGAGAGAGTAGAAGGGTTGTTGG + Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953385486 3:42503471-42503493 AGAGGGAGGCCACTGCTTGTTGG - Intronic
956445202 3:69319336-69319358 ATGGGGACTACAATAATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959814194 3:110656131-110656153 ATATGGACTACAAAGATTGTAGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
966922213 3:184619838-184619860 AGAGTTAGTATAATGATTGCAGG - Intronic
967232898 3:187357469-187357491 ACAGGGAGATCAATGATAGTGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976232792 4:82862772-82862794 TGAGGAAATAGAATGATTGTCGG - Intronic
978077430 4:104550431-104550453 AGTGGAAGTAAAATGATTCTTGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985187256 4:187331120-187331142 AGAAAAAGAACAATGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
989165992 5:38434025-38434047 AGAGGGAGGAGAATGAATCTGGG - Intronic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994459018 5:100050322-100050344 AGTGGTAGTAATATGATTGTTGG + Intergenic
996066104 5:119081044-119081066 AGAGGTAGTACAATTCTAGTGGG - Intronic
998330176 5:141318768-141318790 ATAGGCAGAAAAATGATTGTAGG - Exonic
998333825 5:141352500-141352522 AGAGGCAATACATAGATTGTAGG - Exonic
998920001 5:147057445-147057467 TGAGGGAGTAGAAGGAGTGTGGG + Intronic
1002759227 6:188990-189012 AGAGGGAGCCAGATGATTGTGGG + Intergenic
1004447706 6:15715720-15715742 ACAGGGAGTTCAATGACTGTGGG + Intergenic
1004679808 6:17882370-17882392 AGAGGTATTAAAATGATTTTAGG - Intronic
1005387234 6:25297448-25297470 AGAGAGAGTAAAATGATAGAGGG - Intronic
1007714426 6:43847288-43847310 AGTTGGAGTAAAAAGATTGTTGG - Intergenic
1008004981 6:46401239-46401261 AGAGGAGGGACAATGATTCTGGG - Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1014764515 6:125391271-125391293 AGAAGGAGTACATTTATTTTAGG + Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1019066301 6:169302206-169302228 AGAGAGAGTCAAATGAATGTGGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022771315 7:33475792-33475814 AGAGCGAGAGGAATGATTGTTGG + Intronic
1024707308 7:51974121-51974143 GGAGGGAGTACAATGTCTGCTGG - Intergenic
1027338080 7:77175395-77175417 AAAGGGAGAACAAACATTGTAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029175887 7:98664193-98664215 AGAGAGAGTTTAATGATTGCAGG - Intergenic
1029777653 7:102695413-102695435 AAAGGGAGAACAAACATTGTAGG - Intergenic
1030021595 7:105280593-105280615 AGAGGTGGTAAAATGATTGTGGG + Intronic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035264410 7:157683289-157683311 AGAGCTTGCACAATGATTGTCGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1036261193 8:7241664-7241686 AGAGGCAGTTCAGTGAGTGTAGG - Intergenic
1036305411 8:7597883-7597905 AGAGGCAGTTCAGTGAGTGTAGG + Intergenic
1036313232 8:7700208-7700230 AGAGGCAGTTCAGTGAGTGTAGG - Intergenic
1036356261 8:8045880-8045902 AGAGGCAGTTCAGTGAGTGTAGG + Intergenic
1036806793 8:11840441-11840463 AGAGGGAGGAAAATGGTTTTGGG - Intergenic
1039031380 8:33313203-33313225 AGTGGGAGTACAATTTTTGAGGG + Intergenic
1041419189 8:57647510-57647532 AGAGGGAATACAATGATAGATGG - Intergenic
1042443358 8:68853549-68853571 AGAGGCAATATAATGAGTGTTGG - Intergenic
1043313488 8:78891811-78891833 AGAGGGAGAGCAATGGTTGTTGG - Intergenic
1043525297 8:81090149-81090171 AGAGAGAGTAGAAAAATTGTGGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044559364 8:93597285-93597307 AGAGGGAGGACAATGAGGCTTGG - Intergenic
1044636798 8:94333380-94333402 AGAGGGAGAAGAATGGGTGTAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048727178 8:137400131-137400153 AGAGGGAGGACAAAGATGCTGGG + Intergenic
1048838790 8:138546729-138546751 AAAGGGGGTACAATGTTGGTGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1054941962 9:70753380-70753402 AGATTTAGAACAATGATTGTAGG + Intronic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1059216114 9:112564428-112564450 AGAGAGACTACAAGGATTTTTGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060862553 9:126966916-126966938 AGAGGGAGAATATTGATTCTGGG + Intronic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1190117986 X:47638204-47638226 AGAGGGTGTGTAAGGATTGTTGG + Intronic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1194562039 X:95433696-95433718 AGAGGGGTTATAATGAATGTTGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196250423 X:113453514-113453536 AGAGTGAGTAAAATGGTCGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197439586 X:126472903-126472925 AGTGGTAGTAATATGATTGTTGG - Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1199031656 X:143007247-143007269 GGAGGGAGTACGTTGATTCTAGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic