ID: 1079478488

View in Genome Browser
Species Human (GRCh38)
Location 11:20857088-20857110
Sequence CTGTATGCACAGCATCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 15, 3: 39, 4: 209}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079478488_1079478491 -8 Left 1079478488 11:20857088-20857110 CCCTGCTGATGCTGTGCATACAG 0: 1
1: 1
2: 15
3: 39
4: 209
Right 1079478491 11:20857103-20857125 GCATACAGCATGCATCCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 131
1079478488_1079478497 21 Left 1079478488 11:20857088-20857110 CCCTGCTGATGCTGTGCATACAG 0: 1
1: 1
2: 15
3: 39
4: 209
Right 1079478497 11:20857132-20857154 GGAAGCTGTTGGCCGTATAAGGG 0: 1
1: 0
2: 1
3: 4
4: 29
1079478488_1079478493 0 Left 1079478488 11:20857088-20857110 CCCTGCTGATGCTGTGCATACAG 0: 1
1: 1
2: 15
3: 39
4: 209
Right 1079478493 11:20857111-20857133 CATGCATCCAGAGGGAGAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 329
1079478488_1079478496 20 Left 1079478488 11:20857088-20857110 CCCTGCTGATGCTGTGCATACAG 0: 1
1: 1
2: 15
3: 39
4: 209
Right 1079478496 11:20857131-20857153 GGGAAGCTGTTGGCCGTATAAGG 0: 1
1: 0
2: 1
3: 3
4: 49
1079478488_1079478492 -1 Left 1079478488 11:20857088-20857110 CCCTGCTGATGCTGTGCATACAG 0: 1
1: 1
2: 15
3: 39
4: 209
Right 1079478492 11:20857110-20857132 GCATGCATCCAGAGGGAGAGAGG 0: 1
1: 0
2: 3
3: 22
4: 220
1079478488_1079478490 -9 Left 1079478488 11:20857088-20857110 CCCTGCTGATGCTGTGCATACAG 0: 1
1: 1
2: 15
3: 39
4: 209
Right 1079478490 11:20857102-20857124 TGCATACAGCATGCATCCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 141
1079478488_1079478495 10 Left 1079478488 11:20857088-20857110 CCCTGCTGATGCTGTGCATACAG 0: 1
1: 1
2: 15
3: 39
4: 209
Right 1079478495 11:20857121-20857143 GAGGGAGAGAGGGAAGCTGTTGG 0: 1
1: 0
2: 12
3: 200
4: 2033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079478488 Original CRISPR CTGTATGCACAGCATCAGCA GGG (reversed) Intronic
902364803 1:15965587-15965609 ATGTATGCACAGCCTCTCCAGGG - Intronic
903603283 1:24557149-24557171 TTGTATCCCCAGCACCAGCACGG + Intronic
904466306 1:30709926-30709948 CTGTGTGCACAGCACAAGCCAGG - Intergenic
904717470 1:32479644-32479666 CAGTATTCACAGGATCCGCAGGG + Intronic
905509277 1:38505769-38505791 CTTTGAGCACAGCATCAGAAAGG + Intergenic
906529221 1:46513612-46513634 CTGGATGGAGAGCAGCAGCAGGG + Exonic
909039412 1:70631071-70631093 CCACATGTACAGCATCAGCAGGG - Intergenic
909484072 1:76154588-76154610 CTGGATGTACAGCATTACCAAGG - Intronic
910068024 1:83177075-83177097 CTGTTTCCACAACATCTGCAGGG + Intergenic
910447058 1:87309540-87309562 CTGAATGCACAGCAGCAGGCAGG - Intergenic
912557331 1:110525569-110525591 CAGCAGGCTCAGCATCAGCATGG - Intergenic
913134440 1:115874243-115874265 CTATAGGCAGAGCAGCAGCATGG + Intergenic
914442447 1:147719289-147719311 CCCCATGCACAGCATCAGCAGGG - Intergenic
915106751 1:153539649-153539671 CTGTGTGCACAGCATGGCCAGGG - Intronic
915230086 1:154439061-154439083 CTGAATGCTGAGCATCAGTATGG + Intronic
918720216 1:187842854-187842876 CCATATGTACAGCATTAGCAGGG + Intergenic
918990358 1:191691173-191691195 CTTTAAGCCAAGCATCAGCAGGG - Intergenic
919367358 1:196679749-196679771 CTGTATGCACTGAATCTGGATGG + Exonic
919373251 1:196758726-196758748 TTGTATACACAGCATTAGGATGG + Intergenic
919379695 1:196843410-196843432 ATGTATACACAGCATTAGGATGG + Intronic
919796026 1:201322132-201322154 TGGTGAGCACAGCATCAGCAGGG + Exonic
922466769 1:225849813-225849835 TTGCTTTCACAGCATCAGCATGG - Intronic
924418260 1:243882563-243882585 CCGTATGTACAGTGTCAGCAGGG - Intergenic
1063809920 10:9693046-9693068 CTGGAAGCACAGCATCTACAAGG + Intergenic
1067561606 10:47308567-47308589 CTGTACCTACAGCATCTGCAGGG - Intronic
1069735581 10:70651949-70651971 CCATATGTACAGCATCAGCAGGG - Intergenic
1070228611 10:74539546-74539568 CTATATGCACAGTCTCAGAAAGG - Intronic
1070715789 10:78720074-78720096 ATGAATGCACAGCATCAGTGGGG - Intergenic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1077350306 11:2090196-2090218 CTGTTGGCCCAGCATCAACAAGG - Intergenic
1078480318 11:11669638-11669660 CTCTATGCACAGGCTCAGCATGG + Intergenic
1079317640 11:19422569-19422591 CTGTATGCTCAGCCGCAGAAGGG - Intronic
1079478488 11:20857088-20857110 CTGTATGCACAGCATCAGCAGGG - Intronic
1079995516 11:27291379-27291401 CTGTATGTACAGCAACAGCAGGG + Intergenic
1080461619 11:32459660-32459682 CTATATGCACAGCATATTCATGG - Intergenic
1080703730 11:34668453-34668475 CTGTTTTCACAGCTTCAGCAGGG - Intergenic
1081049786 11:38324271-38324293 CCCTGTGAACAGCATCAGCAGGG - Intergenic
1081232643 11:40605171-40605193 CTGTAAGAGTAGCATCAGCAAGG + Intronic
1082581582 11:54876390-54876412 CTGTATGCATAGAATCTGAAAGG - Intergenic
1083574075 11:63776651-63776673 CTTTATGAACAGCATGAGAACGG + Intergenic
1086010209 11:82093741-82093763 CTGTATGTACAGCATCCCCTGGG - Intergenic
1087463493 11:98474696-98474718 CTTTATTCACAGCATGAGAATGG - Intergenic
1087679266 11:101200995-101201017 CTGTGTTCTCAGCATCAGAAAGG - Intergenic
1089405575 11:118194709-118194731 CTGTGTGTACAGCCTCAGAAAGG + Intronic
1090037995 11:123265265-123265287 CTGGACACACAGCATCAGTAGGG + Intergenic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091222073 11:133935656-133935678 CTGTGTGCCCAGCAACAGCCTGG - Exonic
1092848010 12:12602036-12602058 CAGTAGGCATAGAATCAGCATGG + Intergenic
1093025858 12:14244618-14244640 CTGCAGCCACAGCATAAGCATGG - Intergenic
1093525751 12:20102243-20102265 CTGTATGAACAGCCTGGGCATGG - Intergenic
1093922375 12:24873494-24873516 CTGAATGTATAGCATCAGTATGG - Intronic
1097555114 12:61127275-61127297 CTGTAGGCATAGCATTGGCATGG + Intergenic
1100799070 12:98212456-98212478 CCCTGTGCACAGCGTCAGCAGGG + Intergenic
1101474929 12:105036724-105036746 ATGTATGCACAGGAAAAGCATGG - Intronic
1103825557 12:123735371-123735393 CTGTATGCACAGCCCGACCAAGG + Intronic
1104049368 12:125185851-125185873 CTGTGTGCAGAGCCTCTGCACGG - Intergenic
1107521932 13:41192213-41192235 CGAAATGCACAGGATCAGCAGGG - Exonic
1109448853 13:62482494-62482516 CCCTATGCACAGTGTCAGCAGGG + Intergenic
1110321758 13:74168259-74168281 CAATATGCACAGCTTTAGCAAGG + Intergenic
1110641899 13:77834578-77834600 CTGCAGCCACACCATCAGCATGG + Intergenic
1111161860 13:84405387-84405409 CTTGATGCTCAGCTTCAGCAAGG - Intergenic
1112759877 13:102682639-102682661 CAGTATACACAGCAGCAACAGGG - Intergenic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1114380119 14:22194334-22194356 CTGAATGAACCGCATCAACAAGG + Intergenic
1114750021 14:25193548-25193570 CTGTCTGCACAGCATCTACCTGG - Intergenic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116524832 14:45891706-45891728 CCTTGTGCACAGCATTAGCAGGG - Intergenic
1118326169 14:64782704-64782726 CTGAATCCCCAGCATTAGCAGGG + Intronic
1122475831 14:102008275-102008297 CTGTATGCACTGCACCTGCTGGG - Exonic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1122648376 14:103210061-103210083 CTGTCTGCTCAGCACCACCAAGG + Intergenic
1126877287 15:53057385-53057407 CTGTATGTACTTCATGAGCAGGG - Intergenic
1129718108 15:77863492-77863514 CTGTATGCCCAGCACCAGGCTGG - Intergenic
1130460807 15:84157279-84157301 CTGTATGCCCAGCACCAGGCTGG + Intergenic
1130871753 15:87977592-87977614 CTGGACCCAAAGCATCAGCAGGG + Intronic
1130893076 15:88149913-88149935 CTCTATGCACAACAGCATCACGG + Intronic
1136162771 16:28431560-28431582 CTGCTTGCTGAGCATCAGCAGGG + Intergenic
1136200195 16:28683428-28683450 CTGCTTGCTGAGCATCAGCAGGG - Intergenic
1136216543 16:28797621-28797643 CTGCTTGCTGAGCATCAGCAGGG - Intergenic
1140171877 16:72613395-72613417 CTGCATGCACAGCATCTGGAAGG + Intergenic
1140477137 16:75244601-75244623 CTGGGTGGACATCATCAGCAGGG + Intronic
1140490297 16:75329842-75329864 CTGTATCCCTAGCATCAGCATGG - Intronic
1143054467 17:4152471-4152493 CTGTATCCACAGCATAACCAAGG - Intronic
1144371231 17:14593842-14593864 CTGTCTGCACAGCACCCCCATGG - Intergenic
1145769454 17:27482313-27482335 CTGTCTGCAGAACACCAGCAAGG + Intronic
1149908370 17:60547527-60547549 CTGACTGCACAGGATCACCAGGG - Intergenic
1152648765 17:81482357-81482379 CTGCATCCACAGCTTCAGCGCGG - Intergenic
1152840631 17:82565720-82565742 CTGTTTCCACAGCAGCTGCACGG - Intronic
1153587087 18:6633513-6633535 CTGTAAACACAGCACCAGCCCGG + Intergenic
1153994986 18:10432886-10432908 CTGTTTGCACAGCAGTAGAATGG + Intergenic
1155319880 18:24608806-24608828 CTGTATGTACAGCATCAGCAAGG + Intergenic
1156087499 18:33424549-33424571 CCCTATGCACAGCGTCAGAAGGG - Intronic
1156781380 18:40854518-40854540 TTGCATGCAGAGCTTCAGCAGGG - Intergenic
1157378131 18:47184946-47184968 CCATATGGACAGCACCAGCAGGG - Intergenic
1158111494 18:53944774-53944796 CCCCATGTACAGCATCAGCAGGG + Intergenic
1158316049 18:56212355-56212377 CTAGGTGCACAGCATGAGCAAGG - Intergenic
1158358050 18:56642066-56642088 CTGTATGTACAGTGTCAGCAGGG - Intronic
1158820525 18:61153473-61153495 GAGAATTCACAGCATCAGCATGG + Intergenic
1158848941 18:61474687-61474709 CTGTATTCTCAGCATTAGCATGG - Intronic
1159524316 18:69568193-69568215 CCATATGCACAGCGTCAGCAGGG + Intronic
1159786134 18:72716975-72716997 CTGTATTCTCAACATCAGTATGG - Intergenic
1162758587 19:12874798-12874820 CTGGGGGCACAGCTTCAGCAGGG - Exonic
1162874422 19:13610217-13610239 CTGTTTGCCCAACCTCAGCACGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164502563 19:28832072-28832094 CTGTAAGCCCAGGCTCAGCAGGG + Intergenic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
925699622 2:6622349-6622371 CTCTAATCACAGCATCAGCTGGG + Intergenic
925977601 2:9151969-9151991 CTGTGTGTACAGCAAGAGCATGG - Intergenic
927883362 2:26704304-26704326 CTGAATGCACAGCTTCTGCATGG + Intronic
930013731 2:46956858-46956880 CAGTTTGCCCAGGATCAGCATGG - Exonic
930912317 2:56643969-56643991 CTGAAAGCAAAGCATCAGCAGGG - Intergenic
931298956 2:60957998-60958020 ACATATGTACAGCATCAGCAGGG - Intronic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
931519552 2:63080658-63080680 TTAAATGGACAGCATCAGCAAGG - Intergenic
933641679 2:84769092-84769114 CCATATGTACAGCATCAGCAGGG - Intronic
933686220 2:85143549-85143571 CTGTTTGCACAGCAGCAAAATGG - Intronic
934118450 2:88817410-88817432 GTGCATGCACAGCATAATCAGGG + Intergenic
935320794 2:101887183-101887205 CTGAATCCACATCAACAGCATGG - Exonic
937064154 2:119004679-119004701 CTGTATGTACAGTGTCTGCAAGG + Intergenic
938060926 2:128253675-128253697 CTTTATTCACAGCATGAGAATGG - Intronic
940233367 2:151483027-151483049 CTGAATTAACAGCATCTGCAAGG + Intronic
943319586 2:186431581-186431603 GTGTGTGTACAACATCAGCAGGG - Intergenic
946050253 2:216856189-216856211 CTGTAGGCCCAGCACCTGCAAGG - Intergenic
1169046240 20:2536552-2536574 CTGTATGCACGCCTTCAGCCTGG - Intergenic
1170334815 20:15257420-15257442 CTGTATTCAAAGTACCAGCATGG - Intronic
1170894022 20:20398252-20398274 CTGTACGCACAGCATAACCAGGG - Intronic
1173963581 20:47093718-47093740 CCCTGTGCACAGCGTCAGCAGGG + Intronic
1174003717 20:47393571-47393593 CTGTATGCCTAGCACCAGGATGG - Intergenic
1174323753 20:49762664-49762686 CTGTAGGCAGAGCAGCAGCATGG + Intergenic
1174532156 20:51222566-51222588 CTGTCCTCACAGCATCAGCCAGG + Intergenic
1176993957 21:15532133-15532155 CTGTTTGCACAGTATAGGCAAGG + Intergenic
1180647048 22:17347859-17347881 CCGGATGCACAGGACCAGCAGGG - Intergenic
1180751983 22:18130911-18130933 CTGCATGCTCAGCAACACCACGG + Exonic
1181757612 22:25035667-25035689 CTGTAGTGACAGCAGCAGCAAGG + Intronic
950710923 3:14812167-14812189 CTGTATGCCCAGCAATAACAGGG - Intergenic
952958672 3:38576393-38576415 CTGTATGCCCAACAGCAGTAGGG - Intronic
955830080 3:62992079-62992101 CTGTGAGCACATCAGCAGCAAGG + Intergenic
956489412 3:69754829-69754851 CTGTATTCACAGCATCAACAAGG + Intronic
957335463 3:78822173-78822195 CTATATGCACAGTACAAGCATGG + Intronic
959649388 3:108737010-108737032 CTGTATGTACAGCATCAACAAGG - Intergenic
959886608 3:111509522-111509544 CCCCGTGCACAGCATCAGCAGGG - Intronic
961318169 3:126054803-126054825 CTCTCTCCCCAGCATCAGCAGGG + Intronic
961705073 3:128778392-128778414 ATGTATGCACAGCATATCCACGG - Intronic
963465377 3:145673926-145673948 CACTCTGCACAGCATCAGCTGGG + Intergenic
964433261 3:156626432-156626454 CTATATGTACAGCGTTAGCAGGG - Intergenic
968046895 3:195629530-195629552 CTGAGTGCCCAGCGTCAGCATGG + Intergenic
968307758 3:197660514-197660536 CTGAGTGCCCAGCGTCAGCATGG - Intergenic
968793747 4:2688135-2688157 ATGTCTGCCCAGCATTAGCAAGG + Intronic
969353307 4:6610768-6610790 CCATAGGCACAGCAGCAGCATGG - Intronic
969638260 4:8381970-8381992 CTGCCTCCACAGCATCAGCCAGG + Intronic
971558835 4:28047949-28047971 CTCTTTCCACAGCAGCAGCATGG - Intergenic
971723598 4:30279449-30279471 TTATATGCACAGAAACAGCAGGG - Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
974341481 4:60619089-60619111 CAGTATGTACAGCATGAGAAAGG + Intergenic
975166463 4:71183356-71183378 CTGTCAGCACAGCATGAGCTGGG - Intergenic
976269581 4:83217528-83217550 CTGCAATCAGAGCATCAGCATGG - Intergenic
976342615 4:83962534-83962556 CTGTATGTACAGTGTTAGCAGGG + Intergenic
976529103 4:86130600-86130622 CTTTGTGCATAGCATCAGCAGGG + Intronic
977574868 4:98665034-98665056 CCATATGTACAGCATTAGCAGGG + Intergenic
977579926 4:98713951-98713973 CTCTTTGCCCAGCATCACCATGG + Intergenic
979082048 4:116358035-116358057 CCGTATGTACAGCATCAGCAGGG - Intergenic
979082662 4:116362089-116362111 CCATATGTACAGCATCAGTAGGG - Intergenic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
981693922 4:147540146-147540168 CCTTATGCACAGCCTCAGGAGGG - Intronic
985762274 5:1755671-1755693 CTGTTTGCACATCAACAGTATGG + Intergenic
985822094 5:2167252-2167274 CTGCAGGCAAAGCATCAGCCGGG - Intergenic
987747576 5:21995902-21995924 CTGTAAGCATAGCATGATCACGG - Intronic
987856473 5:23425406-23425428 CTGTATGTACAGCATTAGCAGGG - Intergenic
989401794 5:41015636-41015658 TTGTATGCAGAGTATCTGCATGG - Intronic
991658782 5:68930152-68930174 CGGTATGTACAGCATCAGCAGGG + Intergenic
991767757 5:70005702-70005724 CTGTAAGCATAGCATGATCACGG - Intergenic
991846991 5:70880778-70880800 CTGTAAGCATAGCATGATCACGG - Intergenic
992242548 5:74786901-74786923 CTGTGTCCCCAGCATCATCAGGG - Intronic
994788166 5:104189330-104189352 CCGTATGTACAGCATCAGCAGGG - Intergenic
994825773 5:104711089-104711111 CTCTGTAGACAGCATCAGCAGGG + Intergenic
994959102 5:106575905-106575927 CGGTATGCACAGGAACACCAGGG - Intergenic
995361199 5:111299322-111299344 CGTTATGTACAGCATTAGCAGGG - Intronic
996324790 5:122260102-122260124 CCATATGTACAGCATCAGCAAGG + Intergenic
996916647 5:128720283-128720305 CTGTATGCACACCAACTGCAGGG - Intronic
997253278 5:132407888-132407910 CTGAATCCCCAGCATTAGCAGGG + Intergenic
997487669 5:134245358-134245380 CTGTATGCACAGTGTCAGCAAGG + Intergenic
998172816 5:139882419-139882441 CTGTCACCACAGCATCAGCAAGG - Intronic
999170085 5:149586589-149586611 CTGGATACACAGCATCAGAGTGG - Intronic
999504005 5:152176762-152176784 CTGAGTTCACAGCATCAGTAAGG + Intergenic
1001006686 5:168057975-168057997 CTGGATGTACAGCATCAGCAGGG + Intronic
1001933661 5:175689853-175689875 CTGCATCCACAGCATCACCACGG + Intergenic
1002470377 5:179431436-179431458 CTGGAGCCACAGCATCAGCCAGG - Intergenic
1003569768 6:7248131-7248153 CTGTATGGACAGCAGCACCTAGG - Intronic
1009712684 6:67346212-67346234 CTGTATGTACAGTGTTAGCAGGG - Intergenic
1010723237 6:79307713-79307735 CCATATGTGCAGCATCAGCAAGG + Intergenic
1010724095 6:79313336-79313358 CCATATGTACAGCATCAGCAAGG + Intergenic
1011113835 6:83867853-83867875 CTGTATGTACAGCGTAAGCAGGG - Intronic
1011554429 6:88559861-88559883 CTGTTTGCACAGCATTAATAAGG + Intergenic
1012416516 6:99019427-99019449 CTGTATGTACAGTGTTAGCAGGG + Intergenic
1012417563 6:99026233-99026255 CTGCATGTACAGCGTTAGCAGGG + Intergenic
1012428110 6:99136334-99136356 CTGTATTCACATCATCTGGAGGG + Intergenic
1014645047 6:123962811-123962833 CTGTACGTACAGCGTTAGCAGGG - Intronic
1014752085 6:125268094-125268116 CTATATGTACAGCATCAGCTGGG - Intronic
1014753086 6:125274308-125274330 CCATATGTACAGCATCAGCAGGG - Intronic
1015596391 6:134871540-134871562 CTGTATGTACAGCATCAGTAGGG + Intergenic
1015597005 6:134875432-134875454 CCATACGTACAGCATCAGCAGGG + Intergenic
1016146247 6:140677977-140677999 CTGTATGCTAAGCATGAGGAAGG + Intergenic
1017300089 6:152846899-152846921 CCGTATGTACAGCATCAGCAGGG + Intergenic
1018131743 6:160738393-160738415 CTGCAAGCCCAGCATCAGGATGG - Intronic
1018536595 6:164827054-164827076 CCCTGTGCACAGCATCAGCAGGG - Intergenic
1019993609 7:4709154-4709176 CAGTGTGCACAGCAACAGCTAGG - Intronic
1021314050 7:19124266-19124288 TCTTAAGCACAGCATCAGCAGGG - Intergenic
1023464557 7:40439757-40439779 CTGAAAGCACAGCATGAGCATGG - Intronic
1024220549 7:47283167-47283189 CTGAATGCCCAGCATAAGCATGG - Intronic
1026302024 7:69106440-69106462 CTGTAGGCAGAGCAGCGGCATGG + Intergenic
1026619410 7:71937046-71937068 CTGTATCCACAGCATGAAAATGG + Intronic
1026908919 7:74081444-74081466 CTGTGGGCACAGCATCAACATGG + Intergenic
1026915976 7:74120699-74120721 CTGCAGGCTCAGCATCTGCAGGG + Intronic
1027578178 7:79957641-79957663 CAATATGCACAGCATCAGGTAGG - Intergenic
1027684352 7:81264194-81264216 CTGTATGTACAGCATTAGCAGGG + Intergenic
1027684905 7:81267582-81267604 CTGTATGTACAGCATTAGCAGGG + Intergenic
1027754999 7:82202180-82202202 CCGTATGTACAGCGTCAGCAGGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028093682 7:86733820-86733842 CCATATGTACAGCATTAGCAGGG + Intronic
1028104712 7:86863449-86863471 CTGAAAGGAAAGCATCAGCAGGG + Intronic
1028844975 7:95470087-95470109 CTCTATGCACAGTATCAGGATGG - Intergenic
1032089655 7:128904846-128904868 CGATAGGCACATCATCAGCATGG + Intronic
1033738177 7:144245322-144245344 ATGGATCCGCAGCATCAGCAAGG + Intergenic
1033744876 7:144305631-144305653 ATGGATCCGCAGCATCAGCAAGG - Intergenic
1034197202 7:149257141-149257163 CTGCATGCACAGAATCACCTGGG - Intergenic
1035352822 7:158258516-158258538 CTGGATGCAGAGGATCAGCAGGG - Intronic
1035496031 7:159326971-159326993 CTCTATACACAGTGTCAGCAGGG + Intergenic
1037672855 8:21029996-21030018 CGATATCCACAGCAGCAGCATGG - Intergenic
1038500142 8:28037023-28037045 CTGTATGTACAGCGTTAGCAGGG - Intronic
1039334383 8:36573907-36573929 TTGTATGTACAGCATTGGCAGGG + Intergenic
1039334728 8:36576309-36576331 CCATATGTACAGCATTAGCAGGG + Intergenic
1039818957 8:41119374-41119396 CTGAATGCACAGCAAGAACAAGG + Intergenic
1040963071 8:53055431-53055453 GTGTATGCAGCGCACCAGCATGG - Intergenic
1042797761 8:72683517-72683539 ATGAATGCACAGCTTCATCAGGG + Intronic
1044753754 8:95440713-95440735 CAGTATGAAAAGGATCAGCAGGG - Intergenic
1044775726 8:95685579-95685601 CTGCCTGTACAGCATCAGCAGGG + Intergenic
1046712966 8:117533878-117533900 ATGTATGCACATCACCAACAAGG - Intronic
1048790741 8:138101048-138101070 CTGTATGTATAGCGTCAGCAGGG - Intergenic
1050092925 9:2033679-2033701 CTGAAATCAAAGCATCAGCAGGG + Intronic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1052490504 9:29160948-29160970 CCCTGTGCACAACATCAGCAGGG - Intergenic
1054769163 9:69068313-69068335 CTGTTTGCACAGCAAAATCAGGG + Intronic
1055336174 9:75235696-75235718 GTATATGTACAGCATCAGCAGGG + Intergenic
1055336725 9:75239240-75239262 CCATATGTACAGCATCAGCAAGG + Intergenic
1056194814 9:84219071-84219093 CTGCAGGCACCGCAGCAGCAAGG - Intergenic
1056542917 9:87589477-87589499 CTGCATTCACACCATCAGCAGGG + Intronic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1062681814 9:137786193-137786215 CTGCATGGACAGCAGCACCAAGG - Intronic
1187909759 X:24100812-24100834 CTGTATACACAGTCTCAGCCAGG + Intergenic
1190362482 X:49662289-49662311 ATGTCTGCAAAGCACCAGCAGGG - Intergenic
1190580878 X:51892635-51892657 CTGAATGCAGAGCATGAGCTTGG + Intronic
1190585145 X:51932419-51932441 CTGAATGCAGAGCATGAGCTTGG + Intergenic
1195433170 X:104812219-104812241 CTGTATGCAGACCATCAGCAGGG - Intronic
1197095595 X:122590950-122590972 CTGCATGCACACCAATAGCAAGG + Intergenic
1198407762 X:136332083-136332105 GTGTGTGCAGCGCATCAGCATGG - Intronic
1199404928 X:147445525-147445547 CTGTAGACAGAGCAGCAGCATGG - Intergenic
1199627454 X:149753366-149753388 ATGCATGCACAGCCTCACCAGGG - Intergenic
1200244852 X:154517439-154517461 CTGTCTGGAGAGCAGCAGCAGGG + Intergenic
1201059790 Y:10035854-10035876 CTGTGAGTACAGCATCATCAAGG - Intergenic
1201255785 Y:12107062-12107084 CTATAGGCACAGCAGCAGCTTGG + Intergenic
1202378443 Y:24257901-24257923 CTGTATGCCCAGCACCAGGCTGG - Intergenic
1202492339 Y:25412220-25412242 CTGTATGCCCAGCACCAGGCTGG + Intergenic