ID: 1079480902

View in Genome Browser
Species Human (GRCh38)
Location 11:20878903-20878925
Sequence TTAAGGTGCTTACAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079480898_1079480902 26 Left 1079480898 11:20878854-20878876 CCAGATAGTAGAAATGCTGACTT 0: 1
1: 0
2: 2
3: 5
4: 177
Right 1079480902 11:20878903-20878925 TTAAGGTGCTTACAGTGTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079480902 Original CRISPR TTAAGGTGCTTACAGTGTGC TGG Intronic
901637788 1:10678380-10678402 TAAAGCTGGTTACAGTGTGAGGG + Intronic
901714613 1:11143247-11143269 TTAAGGTGGTGGCAGTGTCCTGG + Intronic
902857632 1:19220593-19220615 TCATGGAGCTTACAGTCTGCTGG - Intronic
902938911 1:19785594-19785616 TTAAGGGGCTTACATTCTGGTGG + Intronic
903056012 1:20636685-20636707 TTAAGTTGCTTACAGATAGCAGG + Intronic
903347178 1:22694223-22694245 TTATGGTCCTTACTGTGGGCCGG - Intergenic
903748065 1:25602054-25602076 TTATGGTGCTAACAGAGGGCAGG + Intergenic
905430509 1:37919337-37919359 TGCAGGTTCTTCCAGTGTGCTGG - Intronic
906963548 1:50434536-50434558 TTAAGGCCCTAGCAGTGTGCTGG + Intergenic
907234147 1:53029506-53029528 TTAAGGTGATCAAAGTGGGCTGG + Intronic
907500740 1:54878041-54878063 CCAAGGTGAATACAGTGTGCAGG + Intronic
911378005 1:97075425-97075447 TCAAGGTGCTTACAATGTACAGG - Intergenic
912477157 1:109946148-109946170 TCAAGTTGCTCACAGTGTACTGG - Intergenic
912703735 1:111896993-111897015 TTAAGGAGTTTGCAGTTTGCAGG - Intronic
914936499 1:151985835-151985857 TCAAGGAGCTTACAGTCTGCAGG - Intronic
916382726 1:164230592-164230614 TTAAGGTGCTTACAGTATATTGG - Intergenic
1064701211 10:18023657-18023679 TTATGCTGGTTGCAGTGTGCTGG + Intronic
1065748050 10:28859627-28859649 TTAAGAAGCTTACGGTGAGCTGG - Intronic
1069390258 10:67927871-67927893 TCATGGTGCTTACATTGTGGTGG + Intronic
1073550494 10:104396019-104396041 ATAATGTGCTGACAGTGTACAGG - Intronic
1073714578 10:106089081-106089103 TTAAGGTGATTTCAGTGTTGTGG - Intergenic
1074175360 10:110995311-110995333 TTACGGTGAAAACAGTGTGCTGG + Intronic
1076473922 10:130739290-130739312 TGAAGGCACTCACAGTGTGCAGG + Intergenic
1077904408 11:6518618-6518640 TAAAGGAGCTTACAGTGTAGTGG + Intronic
1078021347 11:7658040-7658062 TAAAGGTGCTTACAGTGTAGTGG + Intergenic
1078266492 11:9759094-9759116 TGGAGGTGCTGACAGAGTGCGGG - Intergenic
1078565689 11:12412166-12412188 TTAAGAAGCTTCCAGTGTACAGG - Intronic
1078898390 11:15618411-15618433 TTAAGCTGCTCAGAGTGTGCTGG - Intergenic
1079480902 11:20878903-20878925 TTAAGGTGCTTACAGTGTGCTGG + Intronic
1080299187 11:30765396-30765418 TCCAGGTGATTCCAGTGTGCAGG - Intergenic
1080325427 11:31066525-31066547 CTAAGGTACTTACATTGTTCTGG + Intronic
1080628203 11:34050608-34050630 TTAAGCACCTTACTGTGTGCTGG - Intergenic
1085888202 11:80545746-80545768 GCAAGGTGCTTCCAGTCTGCTGG - Intergenic
1086295860 11:85367456-85367478 TTCAAGTGCTTACTGTGTGGTGG - Intronic
1089565021 11:119366567-119366589 TTGAGGAGGTTTCAGTGTGCTGG - Intronic
1091691559 12:2600862-2600884 TTATGGGGCTCACCGTGTGCAGG + Intronic
1094664088 12:32500950-32500972 TTGAGGTGCTCACAGTCTGAAGG + Intronic
1095395772 12:41760877-41760899 TTAAGGAGCTTACAGTTTTGTGG + Intergenic
1096914281 12:55014811-55014833 TCAAGGTGCATTCAGTGTTCTGG - Intergenic
1097234218 12:57528556-57528578 TTAAGGTGAGTGCAGAGTGCTGG + Exonic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098010491 12:66045577-66045599 ATCAAGTGCTTACTGTGTGCTGG + Intergenic
1100297255 12:93274484-93274506 TTAAGGTGGTGACAGTGGGTTGG + Intergenic
1100402912 12:94247660-94247682 TTTGAGTGCTTACTGTGTGCCGG + Intronic
1105467929 13:20664491-20664513 TTATGGGGCTCACAGTGTTCAGG - Intronic
1106741079 13:32642345-32642367 TTAAGGAGCTTACAGTCTAGTGG + Intronic
1106922886 13:34582965-34582987 TAAAGGAGGTTACAGTGTCCTGG + Intergenic
1108602876 13:52009950-52009972 TTATTGAGCTTACTGTGTGCTGG - Intronic
1112742494 13:102490950-102490972 TTAAGGTGGTTGCAGTATGTGGG - Intergenic
1115814239 14:37145709-37145731 TTGAGTTGCTTACAGTTTGGAGG - Intronic
1116157647 14:41228356-41228378 TTTAGGTGCTTGCTGTGTGATGG + Intergenic
1116425666 14:44787557-44787579 TTAAGGAGCTTACAGTTTGAAGG + Intergenic
1116777531 14:49198493-49198515 TTTAAGTGCTTACAGTGTTTTGG - Intergenic
1118047927 14:61992561-61992583 TTAAAGTGTTTACACTTTGCAGG + Intergenic
1118976132 14:70678271-70678293 TTGAGGGGCTTACAGTGTATAGG + Intergenic
1119968798 14:78946458-78946480 TAAAGGAGCTTAGAGTCTGCTGG - Intronic
1120186125 14:81395561-81395583 GTAAGGTGCTTACAGTTTAGGGG + Intronic
1120726541 14:87948163-87948185 TTAAGGAGCTTACTGTGTAGTGG - Intronic
1123877907 15:24642593-24642615 ATATGGTGGCTACAGTGTGCTGG - Intergenic
1124021810 15:25932405-25932427 TCAAGGAGCTTAGAGTGTGTCGG + Intergenic
1124620578 15:31271785-31271807 TTAAGGTGCCTACTGTGTGCTGG + Intergenic
1125362611 15:38880055-38880077 TTCAGTTGCTTACTGTGAGCTGG - Intergenic
1126005240 15:44250190-44250212 TCAAGGAGCTTACAGTCTACTGG - Intergenic
1127939154 15:63676196-63676218 TTAAGATGCATACAGTAGGCTGG - Intronic
1130866553 15:87938188-87938210 TTAAGGTGCTTACAGCCTGCTGG - Intronic
1133545273 16:6800273-6800295 CTAAGGTGTTTCCAGGGTGCTGG - Intronic
1138618041 16:58187675-58187697 ATTAGGTGCTTACTGTGTTCTGG - Intronic
1140998671 16:80287063-80287085 ATAAGGAGCTTACAGTGTTATGG - Intergenic
1143317654 17:6044658-6044680 TCAAGGTGCTTACAGTCTGCAGG + Intronic
1144930545 17:18855633-18855655 TCATGGGGCTTACAGTGTACAGG + Intronic
1147054208 17:37821747-37821769 TCAAGGAGCTCACAGTGTACTGG - Intergenic
1147208279 17:38854717-38854739 TTATGGAGCTTACATTCTGCTGG + Intergenic
1148702877 17:49601004-49601026 TTTGAGTGCTTACTGTGTGCTGG - Intronic
1149269917 17:54967137-54967159 TTTAGGTGATTCCAGCGTGCAGG - Intronic
1151341918 17:73477146-73477168 CGGAGGTGCTTACAGTGCGCTGG - Intronic
1152000900 17:77644786-77644808 TTAAGGGGCTTCCAGTCTGGAGG - Intergenic
1152534496 17:80942638-80942660 TTAAGGAGCCAACTGTGTGCTGG + Intronic
1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG + Intergenic
1157358471 18:46956619-46956641 TTAAGGAGCCTACAGTCTACTGG - Intronic
1159109558 18:64041387-64041409 TTAAGGAGCTTATAGTGTAGTGG + Intergenic
1160310812 18:77788450-77788472 TGAAGGTGCTCCCAGTGGGCAGG + Intergenic
1163986298 19:20954008-20954030 AAAAGATGGTTACAGTGTGCAGG + Intergenic
1168284999 19:55326872-55326894 TTAAAATGCTTAGAGTGGGCCGG + Intronic
926592060 2:14750661-14750683 ATAAAGTGCTTACTCTGTGCAGG + Intergenic
927282353 2:21320435-21320457 TCAAGTTGCTTACAGTTTGCAGG + Intergenic
928687073 2:33760736-33760758 TTAAGATGCTTCCAGTGCACTGG - Intergenic
929631921 2:43471849-43471871 TTAGGGAGCATACAGTGTGCTGG - Intronic
932231037 2:70084815-70084837 ACTAGGTGCTTACTGTGTGCTGG - Intergenic
932344388 2:70986033-70986055 TCAAGGAGCTTACAGTCTACTGG + Exonic
939488443 2:142846908-142846930 TTGAGGTACTTATACTGTGCGGG - Intergenic
939979430 2:148760507-148760529 TTAAAGTGCCTACACTGTGCAGG - Intronic
942962512 2:181849003-181849025 TTAAGATGCTTGCAGGGTGGAGG + Intergenic
1168928435 20:1601656-1601678 TTTGGGTGCTTTCAGTGTGCTGG - Intronic
1172598629 20:36168188-36168210 GTCAGATGCTGACAGTGTGCTGG + Intronic
1172859375 20:38035211-38035233 TCAAGTTGCTTACAGTCTGGTGG + Intronic
1173005715 20:39138266-39138288 TGCAAGTGCTTACTGTGTGCAGG + Intergenic
1174312567 20:49669312-49669334 TTAAGGAGCTTACAGTCTATTGG - Intronic
1174901532 20:54505898-54505920 TGAAGATGCTTTCAGTGAGCTGG + Intronic
1175263269 20:57688004-57688026 TTATGGTGCTCACAGTGAGAGGG - Intronic
1176022296 20:62967991-62968013 TTAAGCATCCTACAGTGTGCAGG - Exonic
1177422181 21:20874251-20874273 TTTATTTGCTCACAGTGTGCAGG + Intergenic
1177963457 21:27698179-27698201 TTATAATGCTTACAGTGTGAAGG + Intergenic
1179053405 21:37909331-37909353 TTAAAGTGCCTACTTTGTGCTGG + Intronic
1179640535 21:42744848-42744870 TTGAGGCACTTACTGTGTGCGGG + Intronic
1181626313 22:24124505-24124527 CTAAGGTGTGCACAGTGTGCAGG - Intronic
1181680394 22:24492057-24492079 TTAAGGTGATAACACTGAGCTGG - Intergenic
1183316181 22:37138035-37138057 TCAAGGAGCTCACAGTCTGCTGG - Intronic
1183602650 22:38849066-38849088 TCGAGGAGCTCACAGTGTGCAGG - Intergenic
1184550288 22:45200752-45200774 TCAAGGAGCTCACAGTCTGCTGG + Intronic
950900342 3:16491920-16491942 TTTAAGTGCCTACAATGTGCTGG - Intronic
951607330 3:24450755-24450777 TTAAGGTGCATACAGTCAACTGG + Intronic
953340411 3:42129678-42129700 GTACGGTACTTGCAGTGTGCTGG + Intronic
953576615 3:44117753-44117775 TTAAGCTGCTTACCATCTGCTGG + Intergenic
953791208 3:45949655-45949677 GCATGGTGCTTGCAGTGTGCTGG - Intronic
955509117 3:59661808-59661830 TCAAGGTGCTTACACTCTGAAGG + Intergenic
955855001 3:63263378-63263400 TTTAAGTGCTTACTGTGTACTGG + Intronic
956218466 3:66875524-66875546 TTAAAAGGCTTACAGTTTGCAGG - Intergenic
959986669 3:112580891-112580913 TGAAGATGCTTTCAGTGAGCTGG - Exonic
961001074 3:123374428-123374450 ACCAGATGCTTACAGTGTGCAGG + Intronic
961501026 3:127336213-127336235 TGAAGGTGAGTACAGTGTGGCGG + Intergenic
961545674 3:127631135-127631157 CTCAGGTGCTTACAGAGTGGAGG + Intronic
962987946 3:140552784-140552806 TTGAGGTGCTCACAATCTGCTGG + Intronic
964424465 3:156536494-156536516 TCAAGGAGCTTACAATGTGATGG + Intronic
966610645 3:181864505-181864527 TTAAGATGCTTACATTCGGCCGG - Intergenic
966924826 3:184637543-184637565 ATAAAGTGCCTACTGTGTGCCGG + Intronic
967881041 3:194301855-194301877 GTAAAGTTCTAACAGTGTGCTGG + Intergenic
969210704 4:5685065-5685087 GTTAGTTGCTTACAGTGTGCAGG + Intronic
969666489 4:8560371-8560393 TTAAGCTGCTGACAGTGTTGAGG - Intronic
970098966 4:12498538-12498560 TTAAGGTACTTTTAGTGTACTGG + Intergenic
970150501 4:13084307-13084329 CCAAAGTCCTTACAGTGTGCTGG + Intergenic
972672074 4:41222138-41222160 TTAAAGTGCTGACAGTGTCTTGG + Intergenic
973223676 4:47757763-47757785 TTAAGCTGCTTACAGTTTTCAGG - Intronic
973559101 4:52116400-52116422 TTAAGGTGCTTACAGTCTAGTGG - Intergenic
974384591 4:61188664-61188686 TTAAGGAGCTTACATTCTGATGG + Intergenic
975569928 4:75805156-75805178 TCAAGGTTCTTACAGTGAGGGGG + Exonic
975664833 4:76725368-76725390 TTAAGGAGCTTACATTCTGCAGG - Intronic
976498788 4:85761888-85761910 TTAAGGTGCTTGCAGAGAGAAGG + Intronic
976604687 4:86971685-86971707 TTAAGGAGCTTACAGTCTATTGG + Intronic
977191767 4:94009792-94009814 TTATGGTGATTACACTGGGCTGG + Intergenic
978289663 4:107122725-107122747 TTAAGCTGCATACTGTGTGTGGG - Intronic
978609109 4:110517234-110517256 TAAAGATGCTTACAATGGGCAGG - Intronic
979121363 4:116906036-116906058 TTAAGCTTCTTACAATGTGTTGG - Intergenic
979270129 4:118749726-118749748 CTAGGCTGCTTAGAGTGTGCTGG - Intronic
979422087 4:120516904-120516926 TTAAGATGCTTACATTCTACTGG - Intergenic
980081241 4:128346534-128346556 TTGGGGTGCTGAGAGTGTGCTGG + Intergenic
981544392 4:145879325-145879347 CAAATGTGCTTACAGTGAGCTGG - Intronic
982059516 4:151590676-151590698 TTAAAGTGCCAACAGAGTGCTGG + Intronic
983255336 4:165393876-165393898 TGTAGGTACTTACAGTGTGCTGG - Intronic
984466037 4:180101168-180101190 TTACGGTGGCTTCAGTGTGCCGG + Intergenic
987908628 5:24112730-24112752 TTAATGTGCTTCCAGTTTGGGGG - Intronic
988604009 5:32664962-32664984 TTAGGTTGCTTACAGGCTGCTGG + Intergenic
991575400 5:68098205-68098227 TTAAGGAGCTTACAGTCTAATGG + Intergenic
995866073 5:116692602-116692624 TTAGGGTGCTTACAGTCTCATGG - Intergenic
996010363 5:118475606-118475628 TTAAGGAGCTTACATTGTGGTGG - Intergenic
996581439 5:125036263-125036285 TCCAGGTGATTCCAGTGTGCTGG + Intergenic
1005290921 6:24378020-24378042 TTTTGGTGCATACAATGTGCTGG - Intergenic
1007007151 6:38375425-38375447 TGAAGATGCTTACAGTTTTCAGG + Intronic
1008039746 6:46784504-46784526 TTAAGGTGCTTTCAGAGAGTGGG + Intergenic
1010434643 6:75814962-75814984 TTGAGTTGCTTACTGTGTGCTGG + Intronic
1015473517 6:133633747-133633769 TTAGGGTGCTTACAGTCTAATGG + Intergenic
1015617066 6:135088503-135088525 TCATGGTGCTTACAGCTTGCTGG - Intronic
1021647197 7:22800071-22800093 TTATGGTGCTTACATTCTACAGG + Intergenic
1021918524 7:25459774-25459796 TTAAGGAGCTTACATTCTACAGG - Intergenic
1022392024 7:29951379-29951401 ATAAGCTGAGTACAGTGTGCAGG + Intronic
1022575014 7:31489058-31489080 TTAAGGAGCTTACAGTCTAGTGG + Intergenic
1024438210 7:49383704-49383726 TTAAGGTGATTTCTGGGTGCAGG + Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027398189 7:77779793-77779815 TTAAGTTCCTCACACTGTGCAGG + Exonic
1028019393 7:85750798-85750820 CCAAGGTGTTTCCAGTGTGCTGG - Intergenic
1028853129 7:95558970-95558992 TTTACCTGCTTAAAGTGTGCAGG - Intergenic
1030421219 7:109309360-109309382 TGAAGATGTTTACAGAGTGCTGG - Intergenic
1032092761 7:128919707-128919729 TTGTGGTGCTTAAAATGTGCTGG - Intergenic
1032598039 7:133262005-133262027 TTAAGGTGGTTAGAATCTGCAGG - Intronic
1037363059 8:18094461-18094483 TTCAGGTGTTGTCAGTGTGCTGG + Intergenic
1037388299 8:18365837-18365859 ATATGGTGTTTGCAGTGTGCTGG - Intergenic
1038576837 8:28711927-28711949 ATAGAGTGTTTACAGTGTGCTGG + Intronic
1038637164 8:29296660-29296682 TGAAGGTGCTTCCTGTGTGCTGG - Intergenic
1038990319 8:32860173-32860195 TCAAGGTGTTCACAGTCTGCTGG - Intergenic
1040441534 8:47448489-47448511 TTAAGGAGCTCACAGTGTGGTGG + Intronic
1041906947 8:63043770-63043792 CTAAGGTGCTCCCAGTCTGCTGG - Intergenic
1043507471 8:80916467-80916489 TTAGGCTGCTTTCACTGTGCAGG + Intergenic
1045084105 8:98661993-98662015 TTAAGAAGCTTACAGTCTGTGGG - Intronic
1045588894 8:103570566-103570588 CTAAGGTACTCTCAGTGTGCTGG - Intronic
1046126783 8:109920197-109920219 TTAAGGAGCTTACACTCTGGTGG + Intergenic
1048153996 8:131924412-131924434 TTACAGTGCTTACAGAGTCCAGG + Intronic
1054736752 9:68760681-68760703 TCAAGGAGCTTACAGTCTGGAGG - Intronic
1054958458 9:70940539-70940561 TTATGGGGCTTACAGTATGGTGG + Intronic
1055706414 9:79010131-79010153 TCATGGTGCTTACAGTCTGGTGG - Intergenic
1056638450 9:88350170-88350192 TCCAGGTGATTCCAGTGTGCAGG + Intergenic
1057815753 9:98292889-98292911 TCAAGGTGCTTACACTCTACTGG + Intronic
1059245287 9:112844475-112844497 TTGAGGTGCGTAGAGTGTGAAGG + Intronic
1061261950 9:129485285-129485307 TTAAAGTCCCTACTGTGTGCAGG + Intergenic
1061464960 9:130770626-130770648 ATATAGTGCTTACTGTGTGCAGG + Intronic
1061949966 9:133930695-133930717 TTAAGGTCCCTGCAGGGTGCAGG + Intronic
1186587155 X:10887444-10887466 CTAAGGTGCTAATATTGTGCTGG - Intergenic
1187105928 X:16241620-16241642 TTAAGGAGTTTACAATCTGCTGG - Intergenic
1190508605 X:51154515-51154537 TTAAGGTACTTAAAGAGTGATGG + Intergenic
1192596080 X:72409828-72409850 TCAAGGAGCTTACAGTCTGATGG - Intronic
1193128291 X:77892951-77892973 TCAAGATGCTTACAGTGTTAGGG + Intronic
1193974566 X:88101469-88101491 TCATGGTGCTTACAGTGTATGGG + Intergenic
1201848818 Y:18453751-18453773 TTCATGGTCTTACAGTGTGCTGG - Intergenic
1201884500 Y:18866624-18866646 TTCATGGTCTTACAGTGTGCTGG + Intergenic