ID: 1079490301

View in Genome Browser
Species Human (GRCh38)
Location 11:20981655-20981677
Sequence GACAAATAGAAATAGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079490301_1079490305 27 Left 1079490301 11:20981655-20981677 CCTTGGCCCTATTTCTATTTGTC 0: 1
1: 0
2: 1
3: 21
4: 254
Right 1079490305 11:20981705-20981727 GCTAAGAAAGTGTAGATGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079490301 Original CRISPR GACAAATAGAAATAGGGCCA AGG (reversed) Intronic
901011292 1:6203955-6203977 CACAAATAGAACCAGGGCTAGGG + Intronic
901159183 1:7162112-7162134 GAGGAATAGAAAGAAGGCCAGGG + Intronic
902537730 1:17130959-17130981 GACAAAAAGAAATATGGCGCTGG + Intergenic
902646616 1:17804135-17804157 GTCACAGAGAAATATGGCCAGGG - Intronic
903539175 1:24087121-24087143 GACAAAGAGAGGAAGGGCCAAGG - Intronic
904202009 1:28826040-28826062 AACAAATAGATATAAGGCTAAGG + Intronic
904508066 1:30975648-30975670 TAAAAATAGAAATAGGGGCCAGG - Intronic
904596703 1:31651082-31651104 GAAAAAAAAAAATAGGGCAAAGG + Intergenic
904689367 1:32282310-32282332 GACATATAGCATTAGGGTCAGGG + Intronic
905834288 1:41103922-41103944 CACAAATAGAAATAGGAAAATGG - Intronic
906344423 1:45006292-45006314 AAAAAATAGAAATAGGGCAGAGG - Intronic
906866753 1:49429600-49429622 GACAGATAGAAGTAGTGGCAGGG - Intronic
907702889 1:56806472-56806494 GAGAAGGAGAAATAGGGCTAGGG + Intronic
907746492 1:57218846-57218868 GACAGAGAGAAATAGGTCTAAGG - Intronic
911852289 1:102835192-102835214 GACAAATCTAAAAAGAGCCAAGG + Intergenic
912369625 1:109164017-109164039 AAAAAATAGATCTAGGGCCACGG - Intronic
916172375 1:162010718-162010740 TACAAATAGAACCAGGGACAGGG + Intronic
918141864 1:181726580-181726602 GGGAAATAGAGAAAGGGCCAGGG + Intronic
918676349 1:187290646-187290668 TACAAAAAGAAATAGGGGCTTGG - Intergenic
919018961 1:192078489-192078511 GACAAATAGGAGTAGGGGGAAGG - Intergenic
919750937 1:201037801-201037823 GAGAAATAGAAATGTGGACAAGG + Intergenic
919891704 1:201980179-201980201 GGCAATTAGAAATTGGACCAAGG - Intergenic
921359260 1:214315381-214315403 GAAAAGTAGAAATAGAGGCAAGG + Intronic
922340494 1:224651042-224651064 GAGAAACAGAAAGAGGGACATGG + Intronic
1065365739 10:24935266-24935288 GACAAATATAATAAGGGTCAGGG + Intronic
1067815773 10:49475710-49475732 GACAATGAGAATTAGAGCCAGGG + Intronic
1068464968 10:57377813-57377835 GAGAGAAAGAAAGAGGGCCAAGG + Intergenic
1068619719 10:59168289-59168311 GACAGTCAGAAATAGGGCAATGG + Intergenic
1068809456 10:61239333-61239355 GACACATGGAAATAAGGGCATGG + Intergenic
1069077068 10:64049634-64049656 GACAAATAGAAAAATGGAGATGG + Intergenic
1069241307 10:66143388-66143410 GAAAAATTGAAATAGGTCCCAGG + Intronic
1069568541 10:69479893-69479915 GACCAGGAGAAATAGGGCCTAGG + Intronic
1070058157 10:72954868-72954890 GGCAATTAGAAAGAGGGCAAAGG + Intergenic
1070073452 10:73112054-73112076 GAAAAATATAAATAAGGCCGGGG + Intronic
1072076281 10:91977214-91977236 GACAAACAGAAATAAGACTATGG - Intronic
1072539778 10:96389628-96389650 GACAGATAGACAAAGGACCAAGG + Intronic
1073957171 10:108886419-108886441 GAAGAATAGAAGTAGGACCATGG - Intergenic
1074915954 10:117955223-117955245 AAGAAATATAAATAGGGCCTGGG - Intergenic
1077666729 11:4117003-4117025 GCCAAATAGAAACATGGGCAAGG + Intronic
1079490301 11:20981655-20981677 GACAAATAGAAATAGGGCCAAGG - Intronic
1079805958 11:24931458-24931480 GAGAAAGAAAAATAGGCCCAGGG + Intronic
1080999279 11:37647848-37647870 GCCACACAGAAATAGGGCAAGGG + Intergenic
1082084838 11:48041479-48041501 AACAAAGAGAAACAGGGCCCTGG - Intronic
1085408086 11:76275985-76276007 GACAAATGTAAAATGGGCCAGGG + Intergenic
1086231003 11:84569739-84569761 GACAAAAAGAAATTGGGTAAAGG - Intronic
1087907009 11:103709968-103709990 GAGAAAAAGAAATATGGCCAAGG - Intergenic
1090429011 11:126630452-126630474 AACAAATAGCAAAAGGGGCAAGG - Intronic
1091000045 11:131903132-131903154 GAAAAAAAAAAATAGGGCCGCGG + Intronic
1095722548 12:45416266-45416288 GACAAAAAGAAATGGACCCATGG - Intronic
1095748764 12:45688347-45688369 TAAAAATAGAAATAGTGCCAGGG + Intergenic
1097008577 12:55936491-55936513 GAAAAATAGACAGATGGCCAAGG + Exonic
1097045903 12:56187940-56187962 GAAACATAGAAGTAGGGCCAGGG - Intronic
1097289021 12:57898286-57898308 GAGAAAGAGAAGTAGGGCCAGGG + Intergenic
1098340437 12:69445287-69445309 CACAAATAGGAATAGGACAATGG - Intergenic
1099013878 12:77323227-77323249 GACAAAGGGTAAAAGGGCCAAGG - Intergenic
1099233676 12:80056718-80056740 AATAAATAGAAATGGGGGCAGGG - Intergenic
1103909405 12:124344148-124344170 AACAAAGAGAAAGAGGGCCCAGG + Intronic
1105617861 13:22036870-22036892 AACAAATAGAAAGAGGGCAGAGG - Intergenic
1105744619 13:23365537-23365559 GACAGTTATAAATAGGGCCCAGG - Intronic
1106908663 13:34438908-34438930 GACATAAAGAAAGAAGGCCATGG - Intergenic
1107576531 13:41730017-41730039 AACAAATAGAGAAAGTGCCATGG + Intronic
1107686394 13:42904272-42904294 ACCAAAAAGAAAAAGGGCCAAGG + Intronic
1110031321 13:70618410-70618432 AAAAAATAAAAATAGGGCCTGGG + Intergenic
1110572481 13:77021024-77021046 GAGAAATAGAAAAAGGTACATGG - Intronic
1110942688 13:81369839-81369861 GACAAATAGAAAAAGGCCTATGG - Intergenic
1112723402 13:102273303-102273325 GACAAAAAGAAATAGCAGCATGG + Intronic
1112900428 13:104351504-104351526 AGCAAGTAGAAATGGGGCCAGGG - Intergenic
1114245442 14:20909271-20909293 AATAAAAAGAAATAAGGCCAGGG + Intergenic
1114429964 14:22652398-22652420 GAAAAAGAAAAATAGTGCCAGGG + Intergenic
1115099538 14:29682053-29682075 GAGAACTAGAAAAATGGCCATGG + Intronic
1116087740 14:40262954-40262976 GAGAAATAGCAATTGGGCCAAGG - Intergenic
1117024026 14:51601449-51601471 GGCAAAGAGAAATAGGGCAATGG - Intronic
1117367054 14:55039555-55039577 GAGAAATTGAAGTAGGGCCTTGG + Intronic
1118933893 14:70268444-70268466 GACAAATAGAAATCCCCCCATGG + Intergenic
1119216175 14:72870900-72870922 GACTAATACAAATAGAGACAGGG - Intronic
1119680931 14:76591721-76591743 GAATAATAGAAAGAGGGACAGGG + Intergenic
1120014091 14:79450562-79450584 GTCAATTAAAAATAAGGCCAGGG + Intronic
1120402330 14:84047687-84047709 GAAAAATAGAAATAAGACAATGG + Intergenic
1120884806 14:89443506-89443528 GAAAAATACAAATAGTGCCTGGG + Intronic
1121942692 14:98087956-98087978 GCCAAGTAGAAATAGGACCCCGG + Intergenic
1121972387 14:98370176-98370198 GACAAATAGAAACAGGAAAAAGG + Intergenic
1122148022 14:99705504-99705526 TAAAAAGAGAAATGGGGCCAGGG - Intronic
1124885289 15:33679559-33679581 GTCAGATAGAAATAGAACCATGG + Intronic
1125197839 15:37069049-37069071 GAAAAAAAGAAATTGGGCCCTGG - Intronic
1127743369 15:61937366-61937388 GGCAAAAAGAAAAAGAGCCAGGG + Intronic
1129168372 15:73792607-73792629 CACAAATAGAAAGGTGGCCAGGG + Intergenic
1130621169 15:85464028-85464050 GACAAAAAGAAGTAGGAACAGGG - Intronic
1131393553 15:92069014-92069036 GACAAAGAGAAATAAGACCGAGG + Intronic
1131859703 15:96639470-96639492 GACAAATAATAAGATGGCCATGG + Intergenic
1133391415 16:5413295-5413317 GAAAGAAAGAAAAAGGGCCATGG - Intergenic
1134223267 16:12371835-12371857 GACGAAAAGACATAGGGCGAAGG - Intronic
1138413671 16:56858952-56858974 GGCAGAAAGAAATGGGGCCAGGG - Intergenic
1139273968 16:65709795-65709817 GAAAAATAGAAAAAGGGTCCAGG + Intergenic
1139449089 16:67016071-67016093 GACAAATGGAAAGAGAGCCAGGG + Intergenic
1141059735 16:80854681-80854703 GTCAAATACAGATATGGCCATGG - Intergenic
1142405547 16:89886945-89886967 GACAAAAGGAAATAGGAACAAGG + Intronic
1142883712 17:2899803-2899825 CAAAAATAAAAATAGGACCACGG - Intronic
1144259350 17:13502884-13502906 AAAAAAAAAAAATAGGGCCAGGG + Intronic
1144414362 17:15032284-15032306 AAAAAATAAAAATAGGGCAATGG - Intergenic
1147111698 17:38267007-38267029 AGCAAACAGAAATAGAGCCAAGG - Intergenic
1148417878 17:47521793-47521815 AGCAAACAGAAATAGAGCCAAGG + Intergenic
1148962373 17:51404031-51404053 GACTAATAAAAATAAGGCAAGGG + Intergenic
1149118888 17:53136773-53136795 GAGAAAAAGAAATAGGGTAAAGG - Intergenic
1149119793 17:53148768-53148790 GAGGAATAGAAAAAGGGCCCTGG + Intergenic
1149687400 17:58544156-58544178 GACAAATAAACCTGGGGCCAAGG - Exonic
1151087178 17:71393442-71393464 GACAAATTGCAATAGTGTCAAGG - Intergenic
1151514771 17:74586281-74586303 GACAAATCTAAAAACGGCCAAGG + Intronic
1153336577 18:3931501-3931523 GACAAAGGGAAACAGGGCCCAGG - Intronic
1153992389 18:10412082-10412104 GACAAATTCAAATAGGTCTAGGG - Intergenic
1154192379 18:12241443-12241465 CAGAAATAGAAATAGGGTCGTGG - Intergenic
1156149841 18:34228026-34228048 GAGGAATAGAAAGAAGGCCAAGG + Intergenic
1156656745 18:39297501-39297523 GAAAACTAGAAATAGAACCAAGG + Intergenic
1157332419 18:46713533-46713555 GAGAAGAAGAAAGAGGGCCAAGG + Intronic
1157799441 18:50607168-50607190 GCCAAATACTAATGGGGCCAGGG + Intronic
1158091297 18:53716906-53716928 GACAAACAGAAGTGGGGCGAAGG - Intergenic
1159178448 18:64869387-64869409 GACAAAAAGAAATAGAGAAATGG - Intergenic
1159601987 18:70436851-70436873 GACACACAGAAATAAGCCCAAGG - Intergenic
1161959430 19:7515862-7515884 GAGAGAAAGAGATAGGGCCAGGG + Intronic
1162622942 19:11858942-11858964 GACAAATCTAAAAAGAGCCAAGG - Intronic
1163927914 19:20362960-20362982 GAGAAATAGAAAAAGGGAGAGGG - Intergenic
1165064679 19:33221962-33221984 GACAAACAGACAGACGGCCAGGG - Intronic
1166477279 19:43138414-43138436 GACAGATAGAAACAGAGTCAGGG + Intronic
1167143189 19:47666260-47666282 GAAAAAAAGAAATTGGGCGAGGG - Intronic
1168059696 19:53883835-53883857 GACAAACAGACACAGGCCCACGG - Intronic
927615572 2:24590660-24590682 GACAAATAAACAAAGTGCCATGG - Intronic
929459420 2:42091316-42091338 CACAAATATAAATAGTACCAAGG + Intergenic
930681137 2:54257567-54257589 GACCAATAGAATTAGGCCAAAGG + Intronic
930973782 2:57429704-57429726 GACAAATAGAATTCAGGGCAGGG - Intergenic
932481368 2:72041527-72041549 GACAGACAGAAACAGGGCCAGGG + Intergenic
932802399 2:74752543-74752565 CACAAATAGAAATGGAGCTAGGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935594843 2:104870293-104870315 GACAAATAGAAATGGGGAGGGGG + Intergenic
935833481 2:107024670-107024692 GCCAAATACACATCGGGCCAGGG + Intergenic
935950723 2:108326047-108326069 GCCAAACAGGAATAGGGTCAGGG + Intergenic
936169072 2:110152279-110152301 GAAAAAAAAAAATAGAGCCAAGG - Intronic
936651549 2:114433070-114433092 AACAAATAGAAAAAGGTCCTTGG - Intergenic
937475684 2:122213198-122213220 CACAAATAGACATAGAGACAAGG - Intergenic
938004689 2:127779172-127779194 AAAAAAAAAAAATAGGGCCAGGG + Intronic
939236075 2:139495231-139495253 GTCAAATAGAACTAGGGAAATGG + Intergenic
939363223 2:141200672-141200694 GAAAAATAAAATTAGGGCAATGG - Intronic
943437055 2:187878855-187878877 AAAAGATATAAATAGGGCCATGG + Intergenic
944310321 2:198225749-198225771 TACAAAAAGCAATAGGGTCAAGG + Intronic
944801655 2:203242858-203242880 GACAAATGGATACAGGGCAAAGG - Intronic
945437687 2:209838429-209838451 GACAAATAGAAATACCTGCAAGG - Intronic
946113198 2:217438030-217438052 GAGAGAAAGAAATAGTGCCATGG - Intronic
946272045 2:218602537-218602559 AAAAAATAAAAATATGGCCAAGG - Intergenic
947338583 2:229112967-229112989 GATAGATAGAGATAGGGCCTTGG - Intronic
1169341749 20:4801714-4801736 AACAAATGGTAATAGTGCCAAGG - Intronic
1169763693 20:9125712-9125734 CACAAATATCAATAGGGCTATGG - Intronic
1169773258 20:9224389-9224411 GAAAAATAAACAGAGGGCCAGGG - Intronic
1171726227 20:28623604-28623626 TACAAATAGAAATAGAGAGATGG - Intergenic
1171751901 20:29059769-29059791 TACAAATAGAAATAGAGAGATGG + Intergenic
1171857287 20:30358736-30358758 TACAAATAGAAATAGAGAGATGG + Intergenic
1172382736 20:34510046-34510068 GCCCTATAGAACTAGGGCCAGGG - Exonic
1173345241 20:42193106-42193128 GACAAATAGATAATGGGCCCTGG - Intronic
1173630719 20:44512863-44512885 GACAAAGAAAAAGATGGCCATGG + Exonic
1174224204 20:48983789-48983811 GAAAGATACAAATAGGGGCAAGG - Intronic
1174264989 20:49324868-49324890 GAAAAAAAGAAAGAGTGCCAAGG - Intergenic
1176105609 20:63384399-63384421 GACATGCAGTAATAGGGCCAGGG + Intergenic
1176871897 21:14090191-14090213 GACAAATAGAAACAGATCCCTGG + Intergenic
1177836863 21:26194083-26194105 GACAAATACAAATTGGGTAAAGG + Intergenic
1180391129 22:12283224-12283246 TACAAATAGAAATAGAGAGATGG - Intergenic
1180408611 22:12581529-12581551 TACAAATAGAAATAGAGAGATGG + Intergenic
1180723405 22:17926462-17926484 ACAAAATAGAAAGAGGGCCAAGG - Intronic
1184457856 22:44621678-44621700 GACAAAGAGAAACAGGGGCTGGG - Intergenic
1184527556 22:45034476-45034498 GACAAAAAGAAATAGGGGGAAGG - Intergenic
1185392246 22:50568832-50568854 GACAAACAGAAATGGCCCCAGGG + Intergenic
949100774 3:142360-142382 AACAAATAGAAATAAACCCATGG - Intergenic
950738346 3:15029657-15029679 GAAAAATAGAAATTGGGCCTAGG + Intronic
951321158 3:21247725-21247747 AACATATAGAAATATGGCAAAGG + Intergenic
953846170 3:46428441-46428463 GACAAATCTAAAAAGAGCCAAGG + Intergenic
956917031 3:73882366-73882388 GACAAAGTGAAATAGGACCTTGG + Intergenic
957599869 3:82320253-82320275 GACAAAAGGAAAGAAGGCCAAGG - Intergenic
959062555 3:101629150-101629172 AAAAAATAGAAATAGGGGCTTGG + Intergenic
959630589 3:108502936-108502958 GAAAAATAGAATTAGGGAAAAGG - Intronic
959767750 3:110053087-110053109 CACAAATACAAATAAGGGCAAGG + Intergenic
960647720 3:119907598-119907620 GAAAAATAGAAATAGTGCTTTGG + Intronic
963278698 3:143359433-143359455 GACATTTAGATATAGCGCCAGGG + Intronic
964718453 3:159747520-159747542 GACAAATATAGGTAGGGCCAAGG + Intronic
966087138 3:176081498-176081520 GACAAATAGAAAAATCCCCATGG - Intergenic
966476205 3:180350089-180350111 GATATATAGATATAGGCCCAGGG - Intergenic
967990083 3:195124196-195124218 GACAAAGAGACAGAGGGCCAGGG + Intronic
970130469 4:12864246-12864268 GACAAATAGAGTTAGAGCCTTGG - Intergenic
971096478 4:23410529-23410551 GAGAAAGAGAAATAGATCCATGG - Intergenic
971876000 4:32309065-32309087 GACAAAGACAAATAGGCACAAGG + Intergenic
973285050 4:48405756-48405778 GACAAATAAAAAAAGGAACACGG - Intronic
974142353 4:57903283-57903305 AACAAATAGAAATAGTTCTATGG - Intergenic
974596081 4:64015914-64015936 CACAGTTAGAAATGGGGCCAAGG - Intergenic
974795805 4:66747661-66747683 GACAAATAGAAAAATGTCAATGG - Intergenic
975231932 4:71945638-71945660 TAAAAATAGAAATAGAGACAGGG - Intergenic
975344799 4:73281740-73281762 GACAAAGAGAAAGTGGGGCATGG - Intergenic
976843692 4:89462109-89462131 GACAAATAGAAATGGATCCATGG - Intergenic
977840905 4:101702970-101702992 GCCATATTGAAATAGAGCCATGG + Intronic
980541897 4:134206795-134206817 GATAATTAGAGATAGGGCCAAGG + Intergenic
981918899 4:150065609-150065631 GACAAATAGAAAGAAGGGCTGGG + Intergenic
985347463 4:189021767-189021789 GACAACTTTAAATAGGGGCATGG + Intergenic
985434299 4:189914097-189914119 TACAAATAGAAATAGAGAGATGG + Intergenic
986164301 5:5260122-5260144 GACTAAAAGCAAGAGGGCCAAGG - Intronic
987198417 5:15550419-15550441 GCCAAATAAAAATAGGCCAAAGG + Intronic
988381738 5:30505386-30505408 GAAAAATAAAAATAAAGCCAAGG + Intergenic
989255801 5:39364661-39364683 GACAAGTAGATATGGGGCAATGG + Intronic
989727042 5:44598909-44598931 GACAAATAGCAATAGGTACTAGG - Intergenic
990026859 5:51202768-51202790 AAAAAATAGAAATAATGCCATGG - Intergenic
990085560 5:51971809-51971831 GAAAAAAAGAAATATGGCCAAGG - Intergenic
990152965 5:52841355-52841377 GACAAATAATTATAGGGCCTTGG - Intronic
990792243 5:59495360-59495382 GAAACTTAGAAACAGGGCCAGGG - Intronic
991143166 5:63270576-63270598 TCCACATAAAAATAGGGCCATGG - Intergenic
991717415 5:69464687-69464709 AAAAAATAAAAATAAGGCCAAGG + Intergenic
995011887 5:107265596-107265618 GACAAGTTGAAATGGGGCAAGGG - Intergenic
995345398 5:111109827-111109849 GACAAAAAGAAATTAGGCGATGG + Intronic
996556187 5:124781391-124781413 GAGGAAGAGAAAGAGGGCCAAGG + Intergenic
998028835 5:138845869-138845891 CACATATAGATATAGGGTCAGGG + Intronic
998896616 5:146806909-146806931 GACAATGAGAAGTAGAGCCAAGG - Intronic
999765399 5:154736858-154736880 GAAAATTAAAAATAGGGCCAGGG - Intronic
1001046388 5:168375391-168375413 GGCAAATACAAAGAGGACCAAGG + Intronic
1001647881 5:173295644-173295666 AGAAAAAAGAAATAGGGCCATGG + Intergenic
1004877434 6:19969888-19969910 AACAAAAAGAAATAAGGGCAGGG + Intergenic
1005967427 6:30736943-30736965 TACAAATATAAATAAGACCATGG + Intronic
1007257395 6:40538506-40538528 AACAAAGAGAAAGAGGGCCTTGG - Intronic
1008713668 6:54261969-54261991 GACAAATGGCTACAGGGCCAGGG + Intronic
1010162616 6:72875682-72875704 GACCAATAGAAATAGTGAAATGG - Intronic
1010694681 6:78956196-78956218 GAAAAATAGAAAAAGGAACAAGG - Intronic
1011706110 6:90003093-90003115 AATAAATTGAAAGAGGGCCAGGG - Intronic
1011988310 6:93478813-93478835 TAAAACTAGAAATAGAGCCATGG - Intergenic
1014897277 6:126917668-126917690 GACAAATAGAACAAGCTCCAAGG - Intergenic
1015755856 6:136605795-136605817 GAAAAATAGAGATAGAGCTAAGG - Intronic
1016699499 6:147038292-147038314 GCCAAATAGAAACAGGGTCCAGG + Intergenic
1021000140 7:15319093-15319115 GAAAAATAGAAATAAGACAAAGG - Intronic
1021486333 7:21172556-21172578 GGCAAATGGAAATATGGGCAGGG - Intergenic
1022183550 7:27944897-27944919 GAGAAATAGAAATTAGGCAAGGG - Intronic
1023048317 7:36230290-36230312 AACTAATAAAAATATGGCCATGG - Intronic
1023127209 7:36966275-36966297 CACAAATGGGAATACGGCCAAGG - Intronic
1023784194 7:43689730-43689752 GACAAATAGCACAAGGGACAGGG + Intronic
1024056408 7:45662408-45662430 GACAAATACAAAGAATGCCAAGG - Intronic
1025224191 7:57142484-57142506 CATAAATAGGACTAGGGCCATGG - Intergenic
1026285339 7:68957763-68957785 AAAAAATAAAAAGAGGGCCAGGG - Intergenic
1027264604 7:76487476-76487498 GACAAATATCCATGGGGCCAAGG - Intronic
1027315974 7:76985578-76985600 GACAAATATCCATGGGGCCAAGG - Intergenic
1028750719 7:94379867-94379889 TCCAAATAAAAATATGGCCAAGG + Intergenic
1033049817 7:137994027-137994049 GAAAAAGAGAAATAGGCTCAAGG + Intronic
1034452742 7:151146086-151146108 GCAAAATAGAGACAGGGCCATGG + Intergenic
1034961038 7:155364572-155364594 GAGGAATAGAAATAGGGCCACGG - Intronic
1036556539 8:9864910-9864932 AAAAAATAGAAATAGGTGCATGG - Intergenic
1037062228 8:14528722-14528744 CAGAAATAGAAATTGGGCCAGGG - Intronic
1038065060 8:23955334-23955356 GAAGAATAGAAATGGGCCCAGGG + Intergenic
1040758588 8:50810190-50810212 GACTAATAGAAAGAGGGAGAGGG - Intergenic
1041512990 8:58671832-58671854 GACAAAGAAAAATGGGCCCAGGG + Intergenic
1041569257 8:59318479-59318501 GAAGAATAAAAATAGGGCTAAGG + Intergenic
1042318221 8:67447462-67447484 GACTTATAGGAATAGGGCCCTGG + Intronic
1047350468 8:124068773-124068795 GAGCAATAGGAATAGGGCAATGG - Intronic
1048685714 8:136903264-136903286 GACAAATAGAAAATGAGGCACGG + Intergenic
1050245730 9:3688081-3688103 GAGAAATAGAAATGGGGCTTTGG + Intergenic
1050369917 9:4910191-4910213 GCCAAATAGAAATGAGGCCAAGG + Intergenic
1050991925 9:12166772-12166794 GACAAGGTAAAATAGGGCCACGG - Intergenic
1053036126 9:34827858-34827880 GAGATAGAGAAATAGGGCAAGGG - Intergenic
1053723388 9:40972259-40972281 TACAAATAGAAATAGAGAGATGG + Intergenic
1054342577 9:63879737-63879759 TACAAATAGAAATAGAGAGATGG - Intergenic
1055849452 9:80608764-80608786 GAGAAAAAGAAACAGAGCCAGGG + Intergenic
1056336788 9:85578436-85578458 GAAAAATAAAAATAGAGACAGGG - Intronic
1058672698 9:107373954-107373976 CAGAAATAGAAAGAAGGCCAAGG + Intergenic
1058967487 9:110050593-110050615 GAAAAACAGAGAAAGGGCCAAGG - Intronic
1062169235 9:135125584-135125606 AACAAATAGCATTGGGGCCAAGG - Intergenic
1062483389 9:136762765-136762787 TACAAATACAAATACGGGCATGG + Intronic
1203451764 Un_GL000219v1:123722-123744 TACAAATAGAAATAGAGAGATGG - Intergenic
1186268037 X:7852817-7852839 GAAAAAAAAAAATAGGGACAGGG + Intergenic
1186840788 X:13483121-13483143 AAAAAAAAGAAATGGGGCCAAGG - Intergenic
1187019938 X:15370626-15370648 GACAAATAGCAATTGGGCCCAGG + Intronic
1189058265 X:37723409-37723431 CACAGATAGAAATGGGGTCAGGG - Intronic
1189824460 X:44902888-44902910 GACAAAAAGCAGTAGGGCAAAGG + Intronic
1196169586 X:112573128-112573150 GACACAGAGGAAGAGGGCCAGGG - Intergenic
1198806100 X:140496527-140496549 GACAGAGAGAAATAGGGAGAGGG - Intergenic
1198873273 X:141197613-141197635 GACAAATCTAAAAAGGGCCAAGG - Intergenic
1200019772 X:153192818-153192840 GACAAAGAGAAATGGGTCGAAGG - Intergenic
1201490720 Y:14538575-14538597 GACAAATAAAAATAGGGAATGGG - Intronic
1201767445 Y:17585420-17585442 GACAAATAGAAACAGATCCCTGG + Intergenic
1201834108 Y:18320565-18320587 GACAAATAGAAACAGATCCCTGG - Intergenic