ID: 1079492403

View in Genome Browser
Species Human (GRCh38)
Location 11:21003586-21003608
Sequence CAGAGTATAGAGAAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 426}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079492403_1079492405 -3 Left 1079492403 11:21003586-21003608 CCTGTCTCCTTCTCTATACTCTG 0: 1
1: 0
2: 4
3: 49
4: 426
Right 1079492405 11:21003606-21003628 CTGTTTTGCCCTGCTGTTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 222
1079492403_1079492408 12 Left 1079492403 11:21003586-21003608 CCTGTCTCCTTCTCTATACTCTG 0: 1
1: 0
2: 4
3: 49
4: 426
Right 1079492408 11:21003621-21003643 GTTTTTGGTACAGAGACCTATGG 0: 1
1: 0
2: 0
3: 18
4: 117
1079492403_1079492410 25 Left 1079492403 11:21003586-21003608 CCTGTCTCCTTCTCTATACTCTG 0: 1
1: 0
2: 4
3: 49
4: 426
Right 1079492410 11:21003634-21003656 AGACCTATGGACCTGTGTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 100
1079492403_1079492409 24 Left 1079492403 11:21003586-21003608 CCTGTCTCCTTCTCTATACTCTG 0: 1
1: 0
2: 4
3: 49
4: 426
Right 1079492409 11:21003633-21003655 GAGACCTATGGACCTGTGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079492403 Original CRISPR CAGAGTATAGAGAAGGAGAC AGG (reversed) Intronic
901004383 1:6164829-6164851 CTCAGTAGAGAGAAGGAGAGAGG + Intronic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
901835427 1:11921063-11921085 AAGAGTAGAGGGGAGGAGACGGG + Intronic
901978273 1:13012531-13012553 CAAAGTATAGAGAAAGAAATTGG + Intronic
902003811 1:13216407-13216429 CAAAGTATAGAGAAAGAAATTGG - Intergenic
902023036 1:13362151-13362173 CAAAGTATAGAGAAAGAAATTGG - Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903813475 1:26047312-26047334 CAGAGTCCAGAGAAGCAGAGAGG - Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
905040365 1:34951776-34951798 CAGAATAGAGAGGAAGAGACAGG - Intergenic
905096975 1:35480953-35480975 CTGAGCCTAGAGATGGAGACAGG - Intronic
905907309 1:41627620-41627642 CACTGTATAGAGAAGGGGATGGG - Intronic
906493757 1:46288300-46288322 CAGAGTATAGTGAAAGAGCTGGG - Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906887344 1:49664316-49664338 CATGGTATAGAGAAGAAAACAGG - Intronic
906977188 1:50588524-50588546 GAGAGGGTAGAGAAGGAGAGAGG + Intronic
907063405 1:51454370-51454392 CAGAGAATAGAGTAGGAAAAGGG + Intronic
907531541 1:55103391-55103413 CAGTGTATAGTGAAAGAGACAGG - Intronic
909094188 1:71266942-71266964 AAGAGTTGAGACAAGGAGACTGG + Intergenic
910262720 1:85307651-85307673 CAGAGGACAGAGGAGGAGAGAGG - Intergenic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
911122797 1:94312742-94312764 CAGACTTTAAAGAAGAAGACGGG - Intergenic
911240689 1:95462601-95462623 CAGAGTAAAGAAAGGCAGACAGG + Intergenic
911946791 1:104120918-104120940 CACAGTATAGTGGAAGAGACAGG - Intergenic
912111199 1:106345298-106345320 GAGAGAATAGAGAAGGAGAAAGG + Intergenic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912688970 1:111789385-111789407 CAGAGCTTAAAGTAGGAGACGGG + Intronic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913200338 1:116490990-116491012 GAGAGTAGAGAGATGCAGACAGG - Intergenic
913371743 1:118107250-118107272 CAGAGTAGAGGGAGGCAGACAGG - Intronic
914392658 1:147236298-147236320 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
914838008 1:151224062-151224084 GTGAGTATGGAGAAGGAGAGAGG + Intronic
915491498 1:156252413-156252435 CAGAGTTTAAAAAAGGAAACAGG - Exonic
915600390 1:156919960-156919982 CAGGGTCTAGAGTAGGAGTCAGG + Intergenic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
916149333 1:161771129-161771151 AAGAGAAGAGAGAAGGAGAGAGG - Intronic
917471639 1:175330805-175330827 CAGATTAGAGAGAAAGGGACTGG - Intronic
917864744 1:179183195-179183217 CAGAGTGTAGAATAGGACACTGG + Intronic
918253548 1:182726349-182726371 CAGAGCATGGAGATTGAGACTGG - Intergenic
918463826 1:184801682-184801704 CACAGTAGAGAGCAGGAGACAGG - Intronic
918579797 1:186112522-186112544 CAGAGTCTAGAGGAGGACTCTGG + Intronic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921307961 1:213816012-213816034 CAGAGGAGAGAGAAAGAGACAGG + Intergenic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
922790259 1:228307288-228307310 CAGAGTCTGGAGCAGGAGACAGG + Exonic
922920633 1:229299880-229299902 CAGAGGATAGAGGAGGTGTCAGG + Intronic
922954681 1:229589044-229589066 TATAGTTTAGAGAAGGAGACAGG - Intergenic
923207327 1:231771710-231771732 CAGAGTAGAGTGGAGAAGACCGG - Intronic
924521133 1:244807224-244807246 CAGAGTATATAGGAAGACACAGG - Intergenic
924803045 1:247341804-247341826 GAGATGATAGAGACGGAGACTGG + Intergenic
1063114199 10:3062334-3062356 CAAAGTATAGAGAAAGAAAAAGG - Intergenic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1067101580 10:43338423-43338445 CATGGTAGAGTGAAGGAGACAGG + Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1068117680 10:52752212-52752234 CAAAGTATAGGGAAGGACATGGG + Intergenic
1068590589 10:58849009-58849031 GGGAGTACAGAGAAGGAGGCTGG - Intergenic
1069342244 10:67425272-67425294 TATAGTTTAGTGAAGGAGACAGG + Intronic
1070153155 10:73817716-73817738 CAGACTGCAGAGAGGGAGACGGG - Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070516801 10:77215423-77215445 CACAGTCTAGAGGAGGAGACAGG - Intronic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071916765 10:90301737-90301759 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1072163948 10:92793782-92793804 CAGAGAAGAGACAAGGAGCCAGG - Intergenic
1074155018 10:110790376-110790398 GAGAGCAAAGAGGAGGAGACAGG + Intronic
1074492380 10:113950355-113950377 CAGATGATAGACAAGTAGACAGG + Intergenic
1075977021 10:126704950-126704972 CCGAGTCTAGACAAGGAGGCAGG + Intergenic
1076141711 10:128084603-128084625 CATTGTACAGAGAAGGAGAGAGG - Exonic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076494603 10:130888885-130888907 CACAGTGTAGACAGGGAGACAGG + Intergenic
1077295803 11:1825718-1825740 CAGAGAATAAGGAAGGAGCCAGG - Intergenic
1077346903 11:2064164-2064186 TGGAGTATAGAGATGGAGAATGG - Intergenic
1077874262 11:6290445-6290467 CACACTCTAGAGAAGAAGACAGG - Intergenic
1077942001 11:6852560-6852582 AAGAGTAGAAAGAGGGAGACTGG + Intergenic
1078367067 11:10715597-10715619 CAGGGTGTGGAGATGGAGACTGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078808782 11:14736691-14736713 GACACTATAGAGAAGGAGAGAGG + Intronic
1079389594 11:20009988-20010010 TAGAGTATAGATGAGGTGACAGG - Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1084911537 11:72393577-72393599 CATAGTATACATAAGTAGACTGG + Intronic
1085465910 11:76723215-76723237 CTGTGTACAGATAAGGAGACAGG + Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088456907 11:110042293-110042315 GAGAGAGTAGAGAAGGAGATGGG + Intergenic
1089171308 11:116513556-116513578 AAGAGTCTGGAGAGGGAGACAGG - Intergenic
1092109112 12:5946210-5946232 CACTTTATAGAGAAGGAGCCTGG + Intronic
1092306973 12:7311268-7311290 CACAGTAGAGAGCAGGAGAGGGG - Intronic
1092529010 12:9328744-9328766 CAGAGTATTGAGCAGAAGAGTGG + Intergenic
1093858154 12:24130627-24130649 AAGAGAAGAGAAAAGGAGACAGG + Intergenic
1094303221 12:28989498-28989520 CAGAGAATAGAAAAGGAAACAGG - Intergenic
1096454519 12:51774056-51774078 GGGAGTAAAGCGAAGGAGACAGG + Intronic
1096753625 12:53780618-53780640 CAGAGTCTAGTGGAGGAGACAGG + Intergenic
1097006826 12:55925827-55925849 AAGAGTAAAGAGAAGTATACTGG + Intronic
1099764001 12:86959470-86959492 CAGGAAGTAGAGAAGGAGACGGG - Intergenic
1099767454 12:87006282-87006304 CAGAGTAAAGGGATGGAGAAAGG - Intergenic
1100595954 12:96072341-96072363 AAGAGTATATAGAATGACACTGG + Intergenic
1100668162 12:96778543-96778565 GAATGTATAGAGAAGGAGACAGG - Intronic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101200908 12:102435375-102435397 CAGAATATAGAAGAGGACACAGG + Intronic
1101405762 12:104427313-104427335 CAGAGCAGAGAGACGGAGTCTGG + Intergenic
1101919804 12:108923218-108923240 CAGAGTACAGCAAAGGTGACAGG + Intronic
1102143648 12:110637646-110637668 AAGAGGAGAGAGAAGGAGACTGG - Intronic
1102402359 12:112640492-112640514 GAGAGTGTAGAGGAGAAGACAGG - Intronic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103411750 12:120717201-120717223 CAGAGTTTAGAACAGGAGCCAGG - Intronic
1105615263 13:22005964-22005986 GAGAGTATAGAGAAGGCCACAGG - Intergenic
1106123939 13:26884760-26884782 CACAGTATAAAGAAGGAGCTAGG - Intergenic
1106225972 13:27787442-27787464 GAGAGATTAGAGATGGAGACAGG - Intergenic
1106788156 13:33127929-33127951 GAGAGGAAAGAGACGGAGACAGG + Intronic
1106999514 13:35527025-35527047 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1107019703 13:35739033-35739055 CTGAGTATAGAAAAGCAAACAGG - Intergenic
1107196375 13:37657184-37657206 CAGATTATTGTGAAGGAGAAAGG + Intronic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107705150 13:43095485-43095507 TAGAGTTCAGAGAAGCAGACTGG + Intronic
1107990127 13:45812312-45812334 CATTTTATAGACAAGGAGACAGG + Intronic
1108813826 13:54266885-54266907 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1110159945 13:72363818-72363840 CAGAGTAAAGAGAGAGAAACTGG - Intergenic
1111788950 13:92828033-92828055 CAAAGCATAGAGAAAGAAACAGG + Intronic
1112492873 13:99883048-99883070 CAGAGTGAAGAAAAGGAAACAGG + Intronic
1112883127 13:104133971-104133993 CAGAGTGTAAAGAAGGAGATGGG + Intergenic
1115178990 14:30600151-30600173 CAGTGTATAGAGCAGAATACTGG + Intronic
1115403150 14:32986451-32986473 AAAAGTATGGAGAAGGAGAAAGG + Intronic
1115752428 14:36505895-36505917 CAGTGTGGAGAGAAGGAGAGGGG - Intronic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116267034 14:42705538-42705560 CAGAGTTTAGAGAAAAAGAGAGG + Intergenic
1116389945 14:44380089-44380111 GAGAGAATTGAGAAGGAGAAAGG + Intergenic
1118247502 14:64125589-64125611 CAGAGAAGATAGTAGGAGACAGG + Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1119133468 14:72195513-72195535 CAGAGTAGAGAGAAGAAAAGAGG + Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121042776 14:90762428-90762450 AAGATTCTAGCGAAGGAGACTGG - Intronic
1121156748 14:91692341-91692363 CAAAGTGCAGAGAAGTAGACGGG - Intronic
1122010526 14:98742698-98742720 CACAGTCTAGGGAGGGAGACAGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122617344 14:103028693-103028715 CACAGAATATAGAAGGAGGCAGG - Intronic
1123509548 15:20982949-20982971 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1123566770 15:21556688-21556710 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1123603031 15:21993981-21994003 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1124101390 15:26697487-26697509 CAGGGTGGAGGGAAGGAGACAGG - Intronic
1124991042 15:34674021-34674043 AAGAGTATAAAGCAGAAGACAGG - Intergenic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125979161 15:43984320-43984342 CAGTGTATAGAGGAGAAGATGGG - Intronic
1126461750 15:48922175-48922197 CAGACTATAGGCAAGGAAACAGG - Intronic
1126462838 15:48931586-48931608 CAGAGTTCAGGGAAGAAGACAGG - Intronic
1126664792 15:51066616-51066638 CACAGAACAGAAAAGGAGACGGG - Intronic
1126821607 15:52509868-52509890 AAGAGATTAGAGAAGGAGAATGG - Intronic
1126909669 15:53404377-53404399 CAGAGTACAGAGAAGAAGACTGG - Intergenic
1127336941 15:57996328-57996350 CAGAGGATAGAGAGTGACACTGG - Intronic
1127386059 15:58468141-58468163 CAGATTATAGATAAGAATACTGG + Intronic
1128709442 15:69860731-69860753 CATCCTATAGAGGAGGAGACCGG - Intergenic
1129167831 15:73788772-73788794 TGGAGTATAGAGAAGGTGGCAGG + Intergenic
1130139152 15:81209162-81209184 CAGAGGATAATGATGGAGACAGG + Intronic
1130141373 15:81229166-81229188 CAGAGGATAATGAGGGAGACAGG + Intronic
1202975131 15_KI270727v1_random:283783-283805 AAGAGTTTAGAGAAGGACAAGGG - Intergenic
1132520861 16:387907-387929 CAAAGTATAGAGAAGGAAAGGGG + Intergenic
1135209860 16:20515977-20515999 CAGAGTCTGGAAAAGGAGTCTGG + Intergenic
1137904015 16:52300600-52300622 CATTTTATAGAGAAGGTGACTGG - Intergenic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1138757484 16:59505967-59505989 GAGAGTAGAGAGAAGTAGAGGGG + Intergenic
1140179077 16:72695978-72696000 TGGAGTATACAGAAGCAGACAGG + Intergenic
1140626864 16:76804623-76804645 CAGAGTATAGAGACACAGCCAGG + Intergenic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142774436 17:2125179-2125201 GGGAAAATAGAGAAGGAGACAGG + Intronic
1146512388 17:33461332-33461354 CAGAGGATAGAGAAGGGCAATGG - Intronic
1146542368 17:33708518-33708540 AAGAGAAGAAAGAAGGAGACAGG - Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148693828 17:49547566-49547588 CTCAATATAGAGAAGGAAACGGG - Intergenic
1148824045 17:50379034-50379056 CAGAAGATACAGAAGAAGACTGG - Intronic
1148935503 17:51161756-51161778 GAGAGTGCAGAGAAGGAGATCGG + Exonic
1148955287 17:51348678-51348700 CAGAATATAGCAAAGGAGACAGG - Intergenic
1149267918 17:54947891-54947913 CTGAGTTTAGAGAAGGGGTCTGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1151566560 17:74901706-74901728 CAGAGTCTAGAGCAGGACTCTGG + Intergenic
1151950903 17:77353226-77353248 CAGAGATTCCAGAAGGAGACTGG + Intronic
1152042941 17:77916786-77916808 CAGATTAGAGGGAGGGAGACAGG + Intergenic
1152214243 17:79023369-79023391 CAGAGTCTAGGGATGGAGACTGG + Intronic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1155045209 18:22097260-22097282 CAGAGTAGGGAGGAGGATACTGG + Intronic
1155256588 18:24003124-24003146 TAGAGTATAGAGAGTGAGGCAGG - Intronic
1155279848 18:24228307-24228329 CAAAGTATAGAGGAGGAGTAAGG - Intronic
1156045441 18:32872155-32872177 CAGAGAAGAGGGAAGGAAACAGG + Intergenic
1156286267 18:35699156-35699178 CAGAGTAGAGAGAATTAGAGGGG - Intronic
1156512873 18:37655753-37655775 CTGAGTTGAGAGAAGGAGAAGGG - Intergenic
1158734257 18:60061936-60061958 TAGAATATAGAGAAGGATCCTGG + Intergenic
1158894951 18:61904041-61904063 CAGAGATTAGAGAAGGGGATGGG + Intergenic
1159563743 18:70024362-70024384 TAGATTCTAGAGCAGGAGACTGG - Intronic
1160385870 18:78495852-78495874 CAGAGCTCAGAGAAGGACACAGG + Intergenic
1161267394 19:3370621-3370643 GAGAGAAGAGAGAAGGAGAGAGG - Intronic
1162096916 19:8315710-8315732 CAAAGTATAGAGAAAGAAATCGG - Intronic
1162668069 19:12231913-12231935 CAAAGTATAGAGAAAGAAATAGG + Intronic
1165912624 19:39238308-39238330 CAGAGTATAAAGAAAAGGACAGG + Intergenic
1167834127 19:52052585-52052607 CAAAGTATAGAGAAAGAAAAGGG - Intronic
1168500408 19:56888247-56888269 GGGAGTATAGAGAAGGAAAGGGG - Intergenic
925647033 2:6045679-6045701 CAGAGTATTGAGAGGGAGCACGG + Intergenic
926419466 2:12682463-12682485 CAGGGTGTAGAGAAAAAGACAGG + Intergenic
926500675 2:13649181-13649203 GAGAGGATGGAGAAGGAAACAGG + Intergenic
926501106 2:13653385-13653407 CAGATTTTAGAGCATGAGACAGG - Intergenic
926992755 2:18697787-18697809 CAGAGTCTAGAGAGGCAGGCAGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
928154058 2:28859598-28859620 GAGGGAATAGAGAAGGAGAGGGG - Intronic
929244311 2:39685464-39685486 TAGAGTCTAGAGAAGGACAGGGG - Intronic
930014038 2:46958467-46958489 AAGAGGAGAGAGCAGGAGACAGG - Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930800291 2:55436849-55436871 CAGAGGAGAGAGACAGAGACGGG + Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931192643 2:60020506-60020528 TACAGTTTAGAGAAGGGGACAGG + Intergenic
932273931 2:70436985-70437007 CAGATTATCAAGAAGGAAACAGG + Intergenic
933624371 2:84582252-84582274 CAGAGATGAGAGAAGGAGAGAGG - Intronic
934897295 2:98129965-98129987 CAAAGTATAGAGAAAGAAAAAGG + Intronic
935365906 2:102290974-102290996 CAGTGTATACAGAAAGGGACAGG + Intergenic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936640777 2:114310669-114310691 AAGAATATAGAGAAAGAGATAGG - Intergenic
938143808 2:128817701-128817723 CAGAAAATAGAGAAAGAAACCGG - Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
939111142 2:138008739-138008761 TATAGTATAAGGAAGGAGACTGG - Intronic
939168136 2:138661678-138661700 CAGAGCATAGAGCAAGAGAGTGG - Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939517074 2:143182343-143182365 CAGAGGAGAGGGAAAGAGACAGG + Intronic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
939995821 2:148918554-148918576 AAGAGTAGTGATAAGGAGACAGG + Intronic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
941424759 2:165328516-165328538 CAGGAAGTAGAGAAGGAGACAGG + Intronic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
943782826 2:191844103-191844125 CAGTGTATAGATGAGGAAACAGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
943977617 2:194504426-194504448 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
943983745 2:194592090-194592112 CATAGTAGAGAGAGAGAGACAGG + Intergenic
944066094 2:195620405-195620427 CAGAGTTCAGAGAAAGAGAGGGG + Intronic
945713293 2:213328665-213328687 CAGAGGATGGACAAAGAGACAGG - Intronic
945975214 2:216265099-216265121 CAGTGGATAGAGAAATAGACTGG + Intronic
946187510 2:217989333-217989355 CAGAGAATAGGTCAGGAGACAGG + Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946780752 2:223191337-223191359 CAAAGTATAGAGAAAGAAAAAGG - Intronic
947269500 2:228318262-228318284 CAGAGTATGGATAAGCAGAAAGG + Intergenic
947496074 2:230638091-230638113 CAGAGTATCCATTAGGAGACAGG + Intergenic
947789615 2:232857050-232857072 CAGACTATAGATAAGTGGACTGG + Exonic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948611715 2:239173113-239173135 CAGAGAATACAAAAGGAGAGAGG + Intronic
1170369417 20:15632516-15632538 CAAAGTACAGAAAAAGAGACAGG + Intronic
1172081895 20:32348309-32348331 CAGAGTATAGAAACAGAGCCAGG - Intergenic
1172122612 20:32607761-32607783 CACAGAAGAGAGAAGGGGACAGG - Intronic
1172375323 20:34434353-34434375 AAGAGTATAGTGAAGGAAAGGGG + Intronic
1173104803 20:40123741-40123763 CAGAGGATAGAGAGGAAGAAAGG - Intergenic
1173185422 20:40836590-40836612 CAGAGTGTAGAGGAGGATAAAGG - Intergenic
1173320057 20:41979292-41979314 CAAAGTCTAGAGGGGGAGACAGG + Intergenic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174753126 20:53131971-53131993 GAGAGTAGAGGGAAAGAGACAGG + Intronic
1176888087 21:14281024-14281046 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177480561 21:21681650-21681672 CAAAGTAAAGGGATGGAGACAGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1179356875 21:40668031-40668053 CAGAGTTAATAGAATGAGACTGG - Intronic
1179593287 21:42425639-42425661 CATAGTTTATAGATGGAGACAGG + Intronic
1179878389 21:44282938-44282960 CAAAGTATAGAGAAAGAAATTGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182912491 22:33996743-33996765 CAAACTATAGAGAAGTAGAATGG - Intergenic
1183068111 22:35377635-35377657 CAGAGGACAGAGAGAGAGACTGG - Intergenic
949128839 3:477244-477266 AAGTGTATAGAGAAGGATAATGG - Intergenic
949547110 3:5081711-5081733 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
949650833 3:6157141-6157163 CAAAGCATAGAGAAGCAGCCTGG + Intergenic
949815903 3:8057482-8057504 CATAGAATATGGAAGGAGACTGG + Intergenic
949913569 3:8937550-8937572 CAGAATATTGTGGAGGAGACAGG + Intronic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
950681496 3:14588363-14588385 CAGTGTCCAGAGAAGGAGAGAGG - Intergenic
951234311 3:20216829-20216851 GAGAGTACAGGGAAGGAGAATGG + Intergenic
952354967 3:32575517-32575539 ATGAGTAAAGAAAAGGAGACTGG - Intergenic
952845040 3:37681245-37681267 CAGAGCATAGACAAGAAGGCTGG + Intronic
953414917 3:42710057-42710079 TAAAGTATAAAGATGGAGACAGG - Intronic
953481804 3:43258389-43258411 CAAAGTATAGAGAAAGAAAAGGG + Intergenic
953744802 3:45566218-45566240 TACAGAATAGAGAAGGAGAGAGG - Intronic
954800725 3:53185655-53185677 CAGGGTTTCGAGAAGAAGACCGG + Exonic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955150280 3:56360355-56360377 CAGAGTCTAGAGAAGTAGAAGGG - Intronic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
956100106 3:65759321-65759343 CATTTTATAGATAAGGAGACTGG - Intronic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
958975701 3:100666225-100666247 CAAAGTATAGAGAAAGAAATAGG + Intronic
960311834 3:116126302-116126324 GAGAGTATATAGAAGCAGATAGG + Intronic
962454327 3:135551208-135551230 AATTGTATAGAGAAGGAAACAGG - Intergenic
962505246 3:136040113-136040135 CAAAGGAGAGAGAAGGAGATAGG + Intronic
962904894 3:139792713-139792735 CAGAGAAGAAAGGAGGAGACAGG + Intergenic
963508491 3:146217959-146217981 GAGAGGAGAGAGAAGGAGATGGG + Intronic
964308942 3:155371588-155371610 GAGTGTATTGAGAAGGAGAAAGG + Intergenic
964464680 3:156977863-156977885 GGGAGTATAGAGAAAGAGCCAGG - Intronic
965406445 3:168275090-168275112 GAGAGCATAGAGCAGCAGACAGG + Intergenic
966062589 3:175777346-175777368 CATTTTATAGAGAAGGAAACGGG - Intronic
966233528 3:177674717-177674739 CATAGTAGAGAGAGGGAGAGGGG - Intergenic
967278327 3:187798260-187798282 CAGAGTCAAGAGAGGAAGACAGG + Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
970727200 4:19060574-19060596 AAGAGTCTAGAGAAGTAGTCTGG - Intergenic
971004971 4:22362931-22362953 CAGACTTTTGAGAAGGGGACTGG - Intronic
972326212 4:38017608-38017630 AAGAGTTTAGAGGAGGAGATGGG + Intronic
972422728 4:38904817-38904839 AAGAGTAAAGAGGATGAGACAGG + Intronic
972987281 4:44779993-44780015 AAGAGAATAGAGAAGGAGATGGG - Intergenic
973655600 4:53044533-53044555 TAAAGTATATAGAAGGAGAAAGG - Intronic
975098317 4:70483264-70483286 CAGAGTAAAGTGAGGGAGATGGG - Intergenic
975354476 4:73385279-73385301 CAGAGAATAGAGAACCAGATGGG - Intergenic
975474461 4:74807264-74807286 CACAATATAGAGGAGGAGATGGG + Intergenic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
978086469 4:104661957-104661979 CAGAGTCTAGACAAGTATACTGG - Intergenic
978112594 4:104980109-104980131 GAGGATATAGAGAAAGAGACAGG + Intergenic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
980581537 4:134761126-134761148 CAGTTTATACAGAAGCAGACAGG + Intergenic
981744835 4:148042686-148042708 CAGAGTATAATGCAGAAGACAGG - Intronic
981786597 4:148486609-148486631 TAAAGGAAAGAGAAGGAGACAGG - Intergenic
981928311 4:150163569-150163591 CATAGTATAGACAAGGAAATGGG - Intronic
982063790 4:151632434-151632456 CAGAAGATAAAGAAGGAAACAGG + Intronic
982568312 4:157015394-157015416 CAGAGTTTAGCGTAGGAAACAGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983512855 4:168627573-168627595 CAGAGTATATAGGATAAGACAGG + Intronic
984671383 4:182492057-182492079 CAGAGTATAGAAAAGAAAGCAGG + Intronic
985182380 4:187279454-187279476 CAGAGCATCTGGAAGGAGACAGG + Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
986046991 5:4048394-4048416 CAGAGTGTAGAGATGTTGACTGG - Intergenic
986976972 5:13405999-13406021 CAAAGTTTAGAGAAGCAGACTGG - Intergenic
987849365 5:23329600-23329622 CAGAGGTCAGAGAAGGTGACAGG - Intergenic
988678398 5:33458159-33458181 AAGAGTATCAGGAAGGAGACTGG - Intronic
989425957 5:41295836-41295858 TAAAGTTTAGTGAAGGAGACTGG - Intergenic
989667102 5:43867293-43867315 CAAAGTATAGATAAGCAAACTGG + Intergenic
989793679 5:45439822-45439844 CAGATGATATTGAAGGAGACTGG + Intronic
990892028 5:60660280-60660302 GAGAGGAGAGAGAAAGAGACAGG + Intronic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
993515926 5:88834793-88834815 CACTCTATAGAGAAAGAGACTGG - Intronic
993996146 5:94725618-94725640 GAGAGTTTAGAGAAGGAGGTGGG + Intronic
994226391 5:97255764-97255786 GAGTATATAGAGAAGGAGATGGG + Intergenic
994531932 5:100983133-100983155 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
995510299 5:112902261-112902283 CAGATTATAAACAAGAAGACAGG - Intronic
995865651 5:116687300-116687322 CAGAGGTCAGAGGAGGAGACAGG + Intergenic
996086547 5:119310899-119310921 AAGAGTATGGGGAAGGAGAAGGG - Intronic
997234906 5:132267194-132267216 CAGAGTTTGGGCAAGGAGACTGG + Intronic
998153760 5:139772284-139772306 CACAATATAAAGAAGGAAACAGG - Intergenic
998876470 5:146605295-146605317 CATATTACAGAGAAGGAAACAGG - Intronic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999416717 5:151404270-151404292 CAAAGTAAAGAGATGGAGAAAGG - Intergenic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999530461 5:152457387-152457409 CAAAGTATAGAGTATGAGAAGGG - Intergenic
999585275 5:153082780-153082802 AAAAGTAAAGAGAATGAGACTGG + Intergenic
1000267494 5:159651683-159651705 GAGAATATAGAAAATGAGACAGG - Intergenic
1000402603 5:160847077-160847099 CAGTTTATAGATAAGGAGACTGG + Intronic
1001000760 5:168004754-168004776 CAGTGTATAGGGTAGGAGAGAGG - Intronic
1002025006 5:176390766-176390788 CACAGTATAGAAGAGGAAACAGG + Intronic
1002439286 5:179256021-179256043 CTGGGGACAGAGAAGGAGACTGG - Intronic
1002603597 5:180369339-180369361 CAGAGCTGAGAGACGGAGACAGG - Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1004104180 6:12649574-12649596 CAGAGGAGAAAGAAAGAGACAGG - Intergenic
1004135605 6:12963105-12963127 CAGAATTCAGAGAAAGAGACAGG + Intronic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004925706 6:20413262-20413284 CAGAGGATAGGGATGGAGCCTGG - Intronic
1005444131 6:25903606-25903628 CAAAGTATAATGAAGGAGAGAGG + Intergenic
1005798586 6:29394230-29394252 GAGAGAATAGAATAGGAGACAGG + Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006646943 6:35521340-35521362 CAGAGGACAGACAATGAGACAGG + Intergenic
1007355685 6:41314132-41314154 CAGAGAATAGTGAAGGCAACTGG + Intergenic
1007895971 6:45358771-45358793 CAGAGTCTAGAGAAGCATTCAGG + Intronic
1008025233 6:46628634-46628656 CAGAGTACAAAGTAGGAGAGAGG + Intronic
1008512224 6:52287030-52287052 CAGAGTATACAGGAAGAGAATGG + Intergenic
1008787797 6:55190509-55190531 AAGAGTTTAGATAAGGAGACAGG + Intronic
1009319379 6:62267470-62267492 AAGTGTTCAGAGAAGGAGACAGG + Intronic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1010320727 6:74505727-74505749 GAGAGTGTAGAGAAAGAGAAAGG + Intergenic
1010366988 6:75062573-75062595 CAGAGGGGAGAGAATGAGACTGG - Intergenic
1011693549 6:89891659-89891681 CAAAGTATAGAGAAAGAAAAAGG - Intergenic
1013076917 6:106780003-106780025 CACAGTATGGAGAAGAAGACAGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013851927 6:114526692-114526714 TAGTGTATAGAGGAGGAGACGGG - Intergenic
1014396711 6:120932313-120932335 CAAAGTATAGAGAAAGAAAAAGG - Intergenic
1014831092 6:126103845-126103867 CAGAATATAGCAAAGGAGATAGG - Intergenic
1014952966 6:127580446-127580468 AAGAGTATAAAGAAGGAACCTGG - Exonic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015547470 6:134376196-134376218 CATAGCATAGAGAAGGAGCATGG - Intergenic
1015552719 6:134428792-134428814 CAGGTTGTGGAGAAGGAGACTGG + Intergenic
1015788474 6:136942629-136942651 CAGTGTAGAGGGAAGGAAACAGG - Intergenic
1016279494 6:142399150-142399172 CTGAGTGTAGAGAAGGCGAAGGG - Intronic
1016513096 6:144864911-144864933 CAGAGAAGAGAGAAAGAGAGAGG - Intergenic
1016523862 6:144977393-144977415 CACAGTATAAACAAAGAGACCGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017824073 6:158068870-158068892 GTGAGCATAGAGAAGGAGCCAGG - Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1019907084 7:4072954-4072976 CAGAGTTTACTGAAGGAGAGTGG - Intronic
1020329309 7:7001860-7001882 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1020501622 7:8930024-8930046 CAGAGTATTAGGAAGAAGACTGG + Intergenic
1021936713 7:25638605-25638627 CAGAGTGATGACAAGGAGACTGG - Intergenic
1022381787 7:29867212-29867234 CTAAGTAGAGAGAAGGAGCCGGG + Intronic
1022825902 7:34013426-34013448 TATAGTACAGAGAAGGAGACTGG - Intronic
1022918774 7:34990998-34991020 GGGAGTATCCAGAAGGAGACAGG + Intronic
1023745207 7:43316807-43316829 GAGAGTAGAGGGGAGGAGACGGG - Intronic
1024009198 7:45253318-45253340 GAGAGAGAAGAGAAGGAGACAGG - Intergenic
1024408475 7:49010620-49010642 CAGAGTAAAGAAAGGGACACTGG + Intergenic
1026253584 7:68691509-68691531 CACAGTACAGAGAAAGAGAAGGG + Intergenic
1027381709 7:77617412-77617434 CAGATTATATATAAGGAGATAGG + Intronic
1028104678 7:86863037-86863059 CAGAGTATATACAAATAGACAGG + Intronic
1030441843 7:109596550-109596572 CAGAGTAGAGACAGGGAGAAGGG + Intergenic
1031230545 7:119100332-119100354 CAAAGTATAGAGAAAGAAAATGG + Intergenic
1031731160 7:125302531-125302553 CAGAATATAGCAAAGGAGAAAGG - Intergenic
1031772690 7:125864739-125864761 CAAAGTATAGCTAAGAAGACCGG - Intergenic
1032089131 7:128902520-128902542 CACAGGCTAGAGAAGGAGACCGG - Intronic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1032800526 7:135314055-135314077 CAGATTCTAGAGGGGGAGACAGG - Intergenic
1034210335 7:149357670-149357692 AAGAGAAGAGAGAAGGAGAGAGG - Intergenic
1034286459 7:149886497-149886519 CAGAGTATTGAGAGGGACACTGG + Intergenic
1034324082 7:150213669-150213691 GAAAGAATAGAAAAGGAGACAGG + Intergenic
1034769113 7:153755567-153755589 GAAAGAATAGAAAAGGAGACAGG - Intergenic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG + Intergenic
1040568974 8:48591629-48591651 CAAAGTCCAGGGAAGGAGACTGG + Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1042191944 8:66195924-66195946 CAGACTATACTGAAGGAGACAGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1042640298 8:70926810-70926832 CAGACTATAGACTAGGAGTCAGG + Intergenic
1042648262 8:71011149-71011171 CAGACGAGAGAGAAGGAGAGGGG - Intergenic
1044341062 8:91046824-91046846 CAGAGTATATTGAAGCAGTCAGG + Intergenic
1044476507 8:92632941-92632963 GAGAGTAGAGAGTAGGACACAGG - Intergenic
1044620519 8:94186908-94186930 CAGAGTATAGAGTGGGAGACAGG - Intronic
1045258301 8:100548296-100548318 TAGAGTATAGAGAACAAGAAGGG - Intronic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1045767377 8:105690444-105690466 CAGTGTATCGAGAAGGACACCGG + Intronic
1045997498 8:108380305-108380327 CAGAGTATTAAAAAAGAGACGGG + Intronic
1046237795 8:111449392-111449414 TAGGATACAGAGAAGGAGACAGG + Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1048134325 8:131732764-131732786 CAAAGTATAAAGAAGGGGCCAGG + Intergenic
1048728795 8:137414430-137414452 CAAAGTATAGAGAAAGAAAAAGG + Intergenic
1048762534 8:137811538-137811560 CAGAGTACAGGAAAGGAAACAGG - Intergenic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1050707897 9:8424662-8424684 CAGAAAATAAAGAAGGGGACTGG + Intronic
1050856903 9:10369677-10369699 CAGTGTATAGAAAAAGAGAATGG - Intronic
1053182297 9:35983449-35983471 CATAGTTTAGAGGAGGAGATTGG + Intergenic
1053414288 9:37937132-37937154 CACAGTCCAGACAAGGAGACAGG - Intronic
1055034921 9:71808377-71808399 AAGAGAATTGAGAAGAAGACTGG - Intronic
1055040414 9:71864785-71864807 CATGGTATAGCTAAGGAGACAGG - Intronic
1055773697 9:79744831-79744853 CAGAGTCTAGAAAAGAAGAGAGG - Intergenic
1055939079 9:81632160-81632182 CAGAGTACAGATAAGTAAACTGG - Intronic
1056507415 9:87270390-87270412 CAGAGTAGAGTGGAGGAGACGGG - Intergenic
1058303318 9:103404934-103404956 CGTAGTATAGATAATGAGACAGG + Intergenic
1058503675 9:105647768-105647790 CAGAGAATAAAGAAGGAAAGGGG + Intergenic
1059663556 9:116425055-116425077 GAAATTATAGAGAAGGAGTCTGG - Intergenic
1059700426 9:116770550-116770572 CAAGGTATAGAGAAAGAGCCAGG - Intronic
1061635505 9:131905954-131905976 AACAGTCTAGTGAAGGAGACAGG + Intronic
1185751187 X:2610610-2610632 GAGACAAGAGAGAAGGAGACAGG - Intergenic
1186204039 X:7182720-7182742 CAGAGTCTAGAGAGGTAGACAGG - Intergenic
1186640906 X:11454387-11454409 CAGAGTAAAGAAAAAGAGAAAGG + Intronic
1187009238 X:15263572-15263594 GAGAGAAGAGAGAGGGAGACAGG - Intronic
1187616710 X:21002815-21002837 ACGAATCTAGAGAAGGAGACAGG - Intergenic
1188417829 X:29957909-29957931 CAGATTATAGAGAAGGACACAGG - Intergenic
1188809485 X:34635346-34635368 AAGAGTATGGAAAATGAGACGGG - Intronic
1189402681 X:40686981-40687003 AAGAGTATACAGAAGGAGATGGG - Intronic
1190938706 X:55019734-55019756 CAGACTAGAGAGTAGGAGACTGG + Intronic
1191223772 X:58017899-58017921 CAGAGCATAGAGAGGGAGCATGG + Intergenic
1191940433 X:66474485-66474507 CAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1192057510 X:67787356-67787378 CTGATTATAGAGAAAGAGGCTGG - Intergenic
1192459141 X:71302389-71302411 CCTAGTATAGATAAGGAGATAGG - Exonic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1193751673 X:85353378-85353400 AAGAGTACAGATGAGGAGACTGG + Intronic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1195211680 X:102656297-102656319 CTGAGACTAGAGAAGAAGACAGG + Exonic
1195318214 X:103699376-103699398 GGGAGTATAGAGAAGGAGGCAGG + Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196463321 X:115950523-115950545 CACAGGGAAGAGAAGGAGACTGG + Intergenic
1197365518 X:125561438-125561460 CAGAGAATAGAGAGTGAGACAGG + Intergenic
1198317038 X:135478233-135478255 CAGAGTACAGATGGGGAGACTGG - Intergenic
1198752215 X:139947189-139947211 CAGAATGCAGAGAAGGCGACAGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200341864 X:155406072-155406094 CAGAATATAGAGAAATAGATGGG + Intergenic
1201295892 Y:12462960-12462982 CAAAGTATAGAGAAAGAAATAGG + Intergenic