ID: 1079493502

View in Genome Browser
Species Human (GRCh38)
Location 11:21015393-21015415
Sequence CACTATGAGCACAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079493502_1079493511 20 Left 1079493502 11:21015393-21015415 CCCTTTTCCCTGTGCTCATAGTG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1079493511 11:21015436-21015458 TTGGTTAAAAATGCCTGTCCAGG 0: 1
1: 0
2: 1
3: 22
4: 180
1079493502_1079493513 29 Left 1079493502 11:21015393-21015415 CCCTTTTCCCTGTGCTCATAGTG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1079493513 11:21015445-21015467 AATGCCTGTCCAGGTGGTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 164
1079493502_1079493512 23 Left 1079493502 11:21015393-21015415 CCCTTTTCCCTGTGCTCATAGTG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1079493512 11:21015439-21015461 GTTAAAAATGCCTGTCCAGGTGG 0: 1
1: 0
2: 1
3: 9
4: 145
1079493502_1079493507 1 Left 1079493502 11:21015393-21015415 CCCTTTTCCCTGTGCTCATAGTG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1079493507 11:21015417-21015439 TTCCTACCTTAGAGTGACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079493502 Original CRISPR CACTATGAGCACAGGGAAAA GGG (reversed) Intronic
900799460 1:4728349-4728371 CACAATGACTCCAGGGAAAAAGG - Intronic
904603294 1:31685255-31685277 CACCATGGGCACTGGGGAAATGG - Intronic
906667409 1:47631649-47631671 CACTGGGAGCACAGGGACAATGG - Intergenic
908118430 1:60963466-60963488 CACTTTGACCACAGTGAACAGGG - Intronic
908957323 1:69648906-69648928 CACTATGAGAAAAGGCAAATGGG + Intronic
909530013 1:76671582-76671604 CACTCTGGGCCCATGGAAAAGGG + Intergenic
909907923 1:81221651-81221673 CACTGTGAGCACTGGGAACCTGG - Intergenic
910817447 1:91306467-91306489 CACTATGTTAACAGAGAAAAAGG - Intronic
912566754 1:110592903-110592925 GAGTATGAGCACAGGGAAGTCGG - Intergenic
916444581 1:164860526-164860548 CATCATGAGCAAAGGTAAAAAGG - Intronic
916712398 1:167423535-167423557 CACTTTGAGCACAGAAACAAAGG + Exonic
917766586 1:178226415-178226437 CACAATAAAAACAGGGAAAATGG - Intronic
921086425 1:211797832-211797854 CACTATTTCCAAAGGGAAAAAGG + Intronic
921634375 1:217475644-217475666 AATTAGGAGCACAGAGAAAATGG + Intronic
921894926 1:220390069-220390091 TCCTATGAGCAAAGGGAAAGGGG + Intergenic
923448396 1:234093830-234093852 CACCACGTGCACAGGGGAAATGG - Intronic
923938859 1:238796453-238796475 TAGTATGGGCACAGGGAAAAAGG + Intergenic
1063291032 10:4749143-4749165 GAATATGACCACAGGGACAAAGG + Intergenic
1063820895 10:9833977-9833999 CACTATACACACAGGTAAAAAGG - Intergenic
1066223366 10:33357659-33357681 CTCTATGAGCAGCGAGAAAATGG + Intergenic
1066546497 10:36505765-36505787 CACTCTGACCCCAGGGAATAAGG - Intergenic
1066623475 10:37382175-37382197 CACTCTTAGCACGGGGCAAAGGG + Intronic
1068121013 10:52781971-52781993 CAAAATCAGCAAAGGGAAAAAGG + Intergenic
1068613184 10:59083213-59083235 CACAAAGAGCACAGAGAAAATGG - Intergenic
1069422501 10:68260100-68260122 CACTGTGATCACAGAGAGAAGGG + Intergenic
1071093530 10:81947519-81947541 CACTATGAGCAATGGGATCAAGG - Intronic
1071776095 10:88789639-88789661 CACTAGGCAGACAGGGAAAATGG + Intergenic
1072454063 10:95561126-95561148 CCCCATGGGCACAGGGAAAGCGG - Intronic
1075916173 10:126169327-126169349 CACTATGTGCTCAAGGAACAGGG - Intronic
1076802081 10:132835497-132835519 CATGGTGAGCACTGGGAAAAGGG + Intronic
1079493502 11:21015393-21015415 CACTATGAGCACAGGGAAAAGGG - Intronic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1083209452 11:61173999-61174021 CACAAAGAGCACATGGGAAAAGG + Intergenic
1084361761 11:68673279-68673301 CTTTATGAGCAGCGGGAAAATGG - Intergenic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1086217817 11:84404982-84405004 CACTATTATAATAGGGAAAAGGG + Intronic
1088643739 11:111898736-111898758 CACTATGTGGACAGGGAGAGAGG + Intergenic
1089639630 11:119839219-119839241 CACCATGAGCTCAGGGAAGTGGG + Intergenic
1092710276 12:11329185-11329207 CACTAATTGCACAGGGAAACTGG + Intergenic
1095355343 12:41266408-41266430 AACTAGGTGCACAGGTAAAATGG - Intronic
1095987270 12:48007296-48007318 CACAATGAGAACAGGAAAAAGGG + Intergenic
1100659118 12:96677895-96677917 CATTATGAGCCCAGGGAGCAGGG - Intronic
1101997651 12:109536369-109536391 GACTGTCAGCACAGGGAAGATGG + Exonic
1106885777 13:34182798-34182820 AACTAAGAACAAAGGGAAAAGGG - Intergenic
1106934294 13:34701403-34701425 GGCTATGAGCACAGGAACAAAGG + Intergenic
1111207061 13:85024738-85024760 CACTATGAGAACAGAGTAATTGG + Intergenic
1112629208 13:101141834-101141856 CACTATAAGCAAAAGAAAAAGGG + Intronic
1112911504 13:104490520-104490542 CACTATGGGAACACAGAAAAAGG - Intergenic
1113600457 13:111564839-111564861 GACAATGGGCACAGGGAAAGTGG + Intergenic
1118945236 14:70379455-70379477 CAGTTTGAGCACAGGTATAAAGG - Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1120480905 14:85047852-85047874 CTTTATGAGCAGCGGGAAAATGG + Intergenic
1124558005 15:30745824-30745846 CACACTGAACACAGGGATAAGGG - Intronic
1124673236 15:31659820-31659842 CACACTGAACACAGGGATAAGGG + Intronic
1125483136 15:40094022-40094044 CACTCTGAGCACAGAGATAATGG - Intronic
1126224373 15:46253264-46253286 CATTTTGAGGAGAGGGAAAATGG + Intergenic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1130134798 15:81173641-81173663 CAGTATGATCTCAGGGAAAGAGG + Intronic
1131646811 15:94353403-94353425 CTCTATGAGCTCTGTGAAAATGG - Intronic
1141664609 16:85459465-85459487 CAACAAGAGCCCAGGGAAAAGGG - Intergenic
1141747839 16:85938036-85938058 CTCTATGAGCAAGGAGAAAAGGG - Intergenic
1142238516 16:88934532-88934554 CACACTGTGCACAGGGAAGATGG - Intronic
1143372730 17:6450323-6450345 TACCTTGAGCACAGTGAAAAAGG + Intronic
1145027588 17:19480138-19480160 CACTAAAAGCACAAGCAAAAAGG - Intergenic
1145187532 17:20808059-20808081 CACTGTGAGAACAGGAACAATGG + Intergenic
1146487369 17:33254296-33254318 CAGTATGAGGACAGGGACAGGGG - Intronic
1147815009 17:43203211-43203233 CACTCTTAGCACTGGGGAAAAGG + Intronic
1148521454 17:48279860-48279882 AACTGTGAGCACAGGAAAGAAGG - Intronic
1150977608 17:70106409-70106431 CACAAGGAGCACAGAGTAAATGG + Intronic
1151700479 17:75740190-75740212 CACCATCAGCACAGGGCAAAAGG - Intronic
1155500735 18:26484679-26484701 CCCAAAGAGCACAGGGAACATGG - Intronic
1155823662 18:30410328-30410350 CACTATGGGCACATGGAAACTGG - Intergenic
1156533474 18:37840514-37840536 CACAATGAGCACAGGAACATGGG + Intergenic
1156704473 18:39862759-39862781 CCCTATGTTCACAGGGAAACTGG - Intergenic
1157720075 18:49916739-49916761 CACTATGGGGTCTGGGAAAAGGG + Intronic
1158342421 18:56480925-56480947 TACCATGAGAACAGGGAAAGGGG - Intergenic
1158898008 18:61933714-61933736 CAATGGGAGCACAGGGAATAGGG + Intergenic
1160207132 18:76843921-76843943 TAATATGAGCACAAGGAAGAAGG + Intronic
1161572356 19:5037518-5037540 CACTATGGCCACAGTGCAAAAGG - Intronic
1162642139 19:12019446-12019468 CACCATCAACAAAGGGAAAAGGG + Intronic
1162958259 19:14111912-14111934 TGCTAAGAGCAAAGGGAAAACGG - Intronic
1163408077 19:17136046-17136068 AACTATGAGCAGATGGCAAAGGG - Intronic
1164326012 19:24192406-24192428 CACCTTGTGCACAGGGAAGATGG - Intergenic
1164713032 19:30372537-30372559 TACCTTGAGAACAGGGAAAATGG - Exonic
1165007217 19:32817062-32817084 CACTGTTAGCACAGCTAAAAAGG + Intronic
1166298241 19:41899447-41899469 CACAATTAGCAAAGGAAAAAAGG - Intronic
1167219817 19:48191570-48191592 CATTCTGATCACATGGAAAAGGG + Intronic
1202649274 1_KI270706v1_random:165986-166008 CACGGTGAGGACAGGGAAATGGG - Intergenic
925981822 2:9183302-9183324 CTTTATCAGCACAGTGAAAACGG + Intergenic
926946599 2:18194637-18194659 AAGTATGATCACAGAGAAAAGGG + Intronic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
927255009 2:21033600-21033622 GAGTATCAGCACAGGGGAAAAGG + Intronic
929716312 2:44314449-44314471 CACTATGGGAACAGAAAAAAGGG - Intronic
930284235 2:49408205-49408227 ATCTATGAACACAGTGAAAATGG + Intergenic
931587771 2:63846793-63846815 CACTTTTAGCACAGGGATAGTGG + Intronic
932714538 2:74091751-74091773 CACCACGAGCACAGGCACAAAGG - Intronic
933878342 2:86643035-86643057 CACTGTCAGAAGAGGGAAAAAGG - Intronic
934042854 2:88144172-88144194 TACTATGGGCACAGAGATAAAGG + Intergenic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
935548294 2:104423959-104423981 GGCTATGAGAACAGAGAAAAGGG - Intergenic
937250562 2:120521228-120521250 CTCTTTGAGCCCATGGAAAATGG - Intergenic
937419555 2:121742301-121742323 CAGTAGGAGAACAGAGAAAAGGG - Intronic
938341337 2:130538532-130538554 CACCATGGGCAGAGGGAAAGTGG + Intergenic
938348494 2:130582177-130582199 CACCATGGGCAGAGGGAAAGTGG - Intronic
938686944 2:133747634-133747656 CACTATCATCAGAGTGAAAAGGG + Intergenic
938742283 2:134244363-134244385 ATCAATGAGCACAGGGAAGAAGG - Intronic
940409391 2:153343170-153343192 AACTATGATTACAGGAAAAATGG + Intergenic
941407448 2:165108463-165108485 CACTAACAGCACAGGTTAAAAGG - Intronic
941941586 2:171044354-171044376 CACTAAGAGAACACAGAAAAGGG + Intronic
942383944 2:175421722-175421744 CACCATGAGGACAGGGACTAAGG + Intergenic
943016598 2:182517954-182517976 CAAAATGAGCACAGGAAAAGGGG + Intronic
943113652 2:183639228-183639250 CACTATGAACACACAGAGAAAGG + Intergenic
943343731 2:186712301-186712323 TACTATGGGCACAAAGAAAAAGG - Intronic
944880498 2:204008039-204008061 CACTATGAGCATAGAAAATATGG - Intergenic
945252444 2:207775861-207775883 CATTATGAACCCAGGAAAAATGG - Intergenic
945742433 2:213680017-213680039 CACTCCTAGCACAGGGAAAGAGG + Intronic
947588843 2:231373093-231373115 CACTCTGTGCTCAGGGAAGAAGG + Intronic
948223074 2:236288794-236288816 GATTAGGAGCAAAGGGAAAATGG + Intergenic
948792492 2:240386210-240386232 GTCTATGAGCTCAGGCAAAATGG - Intergenic
1168956456 20:1837716-1837738 CCCTCTGAGCAATGGGAAAAGGG + Intergenic
1171069688 20:22056100-22056122 TTTTATGAGCACAGGGTAAATGG - Intergenic
1171381903 20:24740023-24740045 TGCTGTGAGCATAGGGAAAAGGG - Intergenic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1175492831 20:59390479-59390501 CACTGTCAGCTCAGGGGAAAAGG - Intergenic
1176602545 21:8806560-8806582 CACGGTGAGGACAGGGAAATGGG + Intergenic
1177334554 21:19706911-19706933 CACTATGAGCAGTGTGAAAATGG + Intergenic
1177522614 21:22247529-22247551 CATTATTAGCAGAGTGAAAATGG + Intergenic
1178205859 21:30464198-30464220 CACTTTTAGCACAGAGAAAGTGG + Intergenic
1180344831 22:11698113-11698135 CACGGTGAGGACAGGGAAATGGG + Intergenic
1180352657 22:11817107-11817129 CACGGTGAGGACAGGGAAATGGG + Intergenic
1180352892 22:11818739-11818761 CACGGTGAGGACAGGGAAATGGG - Intergenic
1180385347 22:12173618-12173640 CACGGTGAGGACAGGGAAATGGG + Intergenic
1180385595 22:12175250-12175272 CACGGTGAGGACAGGGAAATGGG - Intergenic
1182853941 22:33500960-33500982 CATTATGAGACCAGTGAAAAGGG + Intronic
1183144037 22:35972797-35972819 CACTAGGAGGACAGGGAATATGG - Intronic
1185253329 22:49817137-49817159 CACTGTGAGGTCAGGGGAAAAGG - Intronic
949758808 3:7445276-7445298 CCCTATCCACACAGGGAAAAGGG - Intronic
950716832 3:14853681-14853703 AACTCTGAGCACAGCCAAAAGGG - Intronic
950971065 3:17188387-17188409 CAATATAAACACATGGAAAAAGG + Intronic
952186661 3:30976941-30976963 CACAATCAGCAGAAGGAAAAGGG - Intergenic
952542933 3:34386975-34386997 CATCATGAGCAATGGGAAAAAGG - Intergenic
953696173 3:45161412-45161434 CACTATGAGAAGAGGGAGCAAGG - Intergenic
956903631 3:73742804-73742826 CACAATGAGCACAGGACAGAAGG - Intergenic
959965681 3:112351836-112351858 CACTAATAGCAGAAGGAAAAGGG + Intronic
960620982 3:119636452-119636474 CACCATGAGAACAGAGAAACAGG + Intronic
960990303 3:123305822-123305844 TCCTATCAGCACAGGGAAAGAGG + Intronic
961240900 3:125410735-125410757 CATTATGAGCAATGTGAAAAGGG + Intergenic
961733849 3:128987962-128987984 GGCTCTGAGCTCAGGGAAAATGG + Intronic
964692714 3:159469603-159469625 CACCATGAGCACTGGGGAACAGG + Intronic
964720104 3:159762618-159762640 CACAATCACCACAGAGAAAAGGG + Intronic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
965162272 3:165149814-165149836 GCTTATGAGTACAGGGAAAATGG - Intergenic
965369223 3:167840341-167840363 CACTGTGTGCCCAGTGAAAAGGG - Intergenic
965821125 3:172685306-172685328 CATTATGAGCCCAGTGAAGATGG - Intronic
967072032 3:185970916-185970938 CACTGAGAGCCCAGAGAAAAAGG + Intergenic
967319716 3:188183663-188183685 CACAGTGAGCACTGGGTAAATGG - Intronic
968754751 4:2409468-2409490 CACTTGGAGCACAGGGGACAAGG - Intronic
970451558 4:16171655-16171677 CACTATGAGAAAAGTGACAATGG + Intronic
971092760 4:23363746-23363768 CTCTATGAACACAGGGAATGGGG + Intergenic
973376094 4:49287443-49287465 CACGGTGAGGACAGGGAAATGGG + Intergenic
973377938 4:49299761-49299783 CACGGTGAGGACAGGGAAATGGG + Intergenic
973378881 4:49306041-49306063 CACGGTGAGGACAGGGAAATGGG + Intergenic
973379337 4:49309613-49309635 CACGGTGAGGACAGGGAAATGGG - Intergenic
973380209 4:49315609-49315631 CACGGTGAGGACAGGGAAATGGG - Intergenic
973381129 4:49321775-49321797 CACGGTGAGGACAGGGAAATGGG - Intergenic
974858726 4:67493554-67493576 AACTATGAGAAAATGGAAAATGG + Intronic
974890793 4:67879734-67879756 AACTATTTGCACTGGGAAAAGGG + Intronic
975503790 4:75116553-75116575 CAATGTGAGCACTTGGAAAAGGG + Intergenic
977888577 4:102280206-102280228 ACCTATGACCAAAGGGAAAAGGG - Intronic
978931889 4:114324405-114324427 CACAAAGAACACAAGGAAAAGGG - Intergenic
981259152 4:142698929-142698951 TACTAGGGGCCCAGGGAAAAGGG - Intronic
986865560 5:11982240-11982262 AACAATGAGCATATGGAAAAAGG + Intergenic
988433704 5:31149246-31149268 AACAATGAGCAAAGGGGAAAGGG - Intergenic
989466940 5:41768139-41768161 AACTATGAGCTCAGGAATAAAGG - Intronic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990050353 5:51492482-51492504 TACTGTGAGCACAAGGACAATGG + Intergenic
990137628 5:52665874-52665896 CACTTTGAGTTCTGGGAAAAAGG - Intergenic
991931406 5:71756437-71756459 CATGATGAGCAGATGGAAAAAGG - Intergenic
992771348 5:80051104-80051126 CAAGATGAGCACCGGGAAAGGGG + Intronic
993569439 5:89518917-89518939 TACTCTGAATACAGGGAAAAGGG - Intergenic
994608477 5:102003588-102003610 CAATATATGCACAGGGTAAATGG + Intergenic
995763903 5:115595161-115595183 CTCAATAAGCACAGGGTAAATGG + Intronic
998053144 5:139053048-139053070 TACTATGATCACAGGGCAAGAGG + Intronic
998812356 5:145978967-145978989 AAGTATGAGCACAGGAAAACAGG - Intronic
1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG + Intronic
1001778134 5:174344525-174344547 CACTCTGAGCACAGGAAAAAGGG + Intergenic
1001886886 5:175300360-175300382 CACTATGAGCCCAGAGCTAATGG + Intergenic
1002768777 6:269145-269167 CACTATAACCACAGTTAAAAGGG - Intergenic
1002887245 6:1308698-1308720 CACTATGAGGAAAGGTAAAGAGG + Intergenic
1005129478 6:22488834-22488856 CACTGTGAGCACAGTAAAATGGG + Intergenic
1005484614 6:26287765-26287787 CACTAAGTGCACTGGGAATAAGG + Intergenic
1005775218 6:29124028-29124050 CACTATTAGCACATGAAAAATGG - Intergenic
1005781281 6:29195264-29195286 CACTATTAGCACATGAAAAATGG - Intergenic
1006151841 6:31994046-31994068 CACTAAGAGCAAAGGGAACAGGG - Intronic
1006158142 6:32026784-32026806 CACTAAGAGCAAAGGGAACAGGG - Intronic
1007126207 6:39427696-39427718 CACTATGGCCACAAGGAAGATGG + Intronic
1009853228 6:69225466-69225488 CACTGAGAGAACAGGGTAAAGGG + Intronic
1010730390 6:79384675-79384697 CAAAATCAGCAAAGGGAAAAAGG + Intergenic
1010811995 6:80311320-80311342 CTTTATGAGCAATGGGAAAACGG + Intronic
1015512102 6:134048112-134048134 CACTGTGAGCACTGGGCAAATGG - Intronic
1015568626 6:134599434-134599456 CAGTCTGAGCCCAGGGTAAAGGG - Intergenic
1016056741 6:139585969-139585991 CACTATAATTACAGGGAAAAAGG + Intergenic
1017954253 6:159165363-159165385 TTCTATGAACAGAGGGAAAAGGG - Intergenic
1018398989 6:163403652-163403674 CACGATGAGGACAGAGAGAATGG + Intergenic
1020453291 7:8344723-8344745 CACTAGAATCACAGGCAAAAGGG + Intergenic
1021149016 7:17126662-17126684 CATTATGAGCAAAGGTAAAGAGG - Intergenic
1022012824 7:26323691-26323713 CACTCTGAGCGCATGGAGAATGG + Intronic
1023677652 7:42647328-42647350 TACTAGGAACACAGAGAAAAGGG + Intergenic
1023996120 7:45159950-45159972 CAATATGACCACAGGTAACATGG - Intronic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028016165 7:85716136-85716158 AAATATGAGCAGAGGGCAAATGG - Intergenic
1030300796 7:107972647-107972669 CAATCTAAGCACATGGAAAATGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1032696619 7:134342242-134342264 CTTTATGAGCACCGTGAAAATGG - Intergenic
1035748031 8:1975048-1975070 CACTATTAGCTCAGGATAAAAGG - Intronic
1035905507 8:3505701-3505723 CACTATGAGCACTGGATAGAAGG + Intronic
1037699615 8:21262741-21262763 CACTAAGAGCTCTGGAAAAAGGG + Intergenic
1038237255 8:25771013-25771035 CACTATAAGAACTGGTAAAAAGG + Intergenic
1042826066 8:72980788-72980810 CAGTAAGAGGACAGAGAAAAAGG - Intergenic
1043563928 8:81526910-81526932 AACTATGAGAACAAGGAAAATGG + Intronic
1046794040 8:118351249-118351271 CAAAATGATCACAGGGGAAATGG + Intronic
1048120679 8:131577853-131577875 AACTATTAGAACAGGCAAAAAGG - Intergenic
1048707088 8:137165837-137165859 CACTATGAAAACAGTGAAATTGG + Intergenic
1049916652 9:324228-324250 GAATATGAGCACAGACAAAAAGG - Intronic
1050276713 9:4008378-4008400 CAGAATGAGGGCAGGGAAAATGG - Intronic
1050425564 9:5509288-5509310 CCCTATAAGCACAAGGAAAAGGG + Intergenic
1052007969 9:23373326-23373348 AACTATGAGCAGATAGAAAAAGG - Intergenic
1055217979 9:73890859-73890881 TACTATATGCACAGGGGAAAGGG - Intergenic
1056387707 9:86112707-86112729 CACTATGAGAACAAAAAAAATGG + Intergenic
1057073323 9:92119361-92119383 CACTATGAGGACAGGGTCATGGG - Intergenic
1058128014 9:101218906-101218928 TAAAATGAGCACAGGGAAAAAGG + Intronic
1058758273 9:108104197-108104219 CATTTGGGGCACAGGGAAAAAGG + Intergenic
1059528234 9:115013022-115013044 CACTATGAGTACTGGGAATGGGG + Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059917721 9:119122349-119122371 CAGTAAGAGCACAGGGAATAAGG - Intergenic
1060417538 9:123443054-123443076 CACAATGATCACAAGGTAAATGG + Intronic
1060619382 9:125049821-125049843 CATTATGAGCAGAGTGAAAAAGG - Intronic
1060689016 9:125639576-125639598 CACTATGTACACAGGGAAGTGGG + Intronic
1062670953 9:137709126-137709148 AAATATCAGCACAGTGAAAAAGG + Intronic
1203698912 Un_GL000214v1:119670-119692 CACGGTGAGGACAGGGAAATGGG + Intergenic
1203699869 Un_GL000214v1:125968-125990 CACGGTGAGGACAGGGAAATGGG + Intergenic
1203700770 Un_GL000214v1:131960-131982 CACGGTGAGGACAGGGAAATGGG + Intergenic
1203479603 Un_GL000224v1:558-580 CACGGTGAGGACAGGGAAATGGG + Intergenic
1203480570 Un_GL000224v1:6854-6876 CACGGTGAGGACAGGGAAATGGG + Intergenic
1203549091 Un_KI270743v1:153355-153377 CACGGTGAGGACAGGGAAATGGG + Intergenic
1203549359 Un_KI270743v1:155194-155216 CACGGTGAGGACAGGGAAATGGG - Intergenic
1203550318 Un_KI270743v1:161506-161528 CACGGTGAGGACAGGGAAATGGG - Intergenic
1203569209 Un_KI270744v1:115916-115938 CACGGTGAGGACAGGGAAATGGG + Intergenic
1203570158 Un_KI270744v1:122205-122227 CACGGTGAGGACAGGGAAATGGG + Intergenic
1186080269 X:5923439-5923461 CTCTATGAGCAGTGTGAAAATGG - Intronic
1186643532 X:11482518-11482540 CAGTATGAGCACAAGGAAGGTGG - Intronic
1196409796 X:115405934-115405956 CTCTATGAGCAGAGAGAAAGAGG - Intergenic
1197317201 X:124981748-124981770 CCCTATCAGCCCAGGGAAAGTGG + Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197915992 X:131536034-131536056 CACTGTGGGCAAAGGGAAAGTGG - Intergenic
1198083595 X:133262729-133262751 CAGTATCAGCACTGTGAAAATGG - Intergenic
1198237862 X:134752750-134752772 CACTAAGAGCACTGGGAAACAGG + Intronic
1202047932 Y:20753021-20753043 CACTTGAAGCACAGAGAAAAGGG - Intergenic